diff variant_effect_predictor/Bio/EnsEMBL/Utils/Sequence.pm @ 0:1f6dce3d34e0

Uploaded
author mahtabm
date Thu, 11 Apr 2013 02:01:53 -0400
parents
children
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/variant_effect_predictor/Bio/EnsEMBL/Utils/Sequence.pm	Thu Apr 11 02:01:53 2013 -0400
@@ -0,0 +1,113 @@
+=head1 LICENSE
+
+  Copyright (c) 1999-2012 The European Bioinformatics Institute and
+  Genome Research Limited.  All rights reserved.
+
+  This software is distributed under a modified Apache license.
+  For license details, please see
+
+    http://www.ensembl.org/info/about/code_licence.html
+
+=head1 CONTACT
+
+  Please email comments or questions to the public Ensembl
+  developers list at <dev@ensembl.org>.
+
+  Questions may also be sent to the Ensembl help desk at
+  <helpdesk@ensembl.org>.
+
+=cut
+
+=head1 NAME
+
+Bio::EnsEMBL::Utils::Sequence - Utility functions for sequences
+
+=head1 SYNOPSIS
+
+  use Bio::EnsEMBL::Utils::Sequence qw(reverse_comp expand);
+
+  my $seq = 'ACTTTAAAGGCTATCCCAATATG';
+
+  print "my sequence = $seq\n";
+
+  reverse_comp( \$seq );
+
+  print "my reverse comp = $seq\n";
+
+  my $compressed_seq = '(AC)3';
+
+  print "my expanded seq is = expand($compressed_seq)";
+
+=head1 METHODS
+
+=cut
+
+
+package Bio::EnsEMBL::Utils::Sequence;
+
+use strict;
+use warnings;
+
+use Exporter;
+
+use vars qw(@ISA @EXPORT_OK);
+
+@ISA = qw(Exporter);
+
+@EXPORT_OK = qw(&reverse_comp &expand);
+
+
+=head2 reverse_comp
+
+  Arg [1]    : reference to a string $seqref
+  Example    : use Bio::EnsEMBL::Utils::Sequence qw(reverse_comp);
+
+               $seq = 'ACCTGAA';
+               reverse_comp(\$seq);
+               print $seq;
+
+  Description: Does an in place reverse compliment of a passed in string
+               reference.  The string is passed by reference
+               rather than by value for memory efficiency.
+  Returntype : none
+  Exceptions : none
+  Caller     : SequenceAdaptor, SliceAdaptor
+
+=cut
+
+sub reverse_comp {
+  my $seqref = shift;
+
+  $$seqref = reverse( $$seqref );
+  $$seqref =~
+    tr/acgtrymkswhbvdnxACGTRYMKSWHBVDNX/tgcayrkmswdvbhnxTGCAYRKMSWDVBHNX/;
+
+  return;
+}
+
+=head2 expand
+
+  Arg [1]    : reference to a string $seqref
+  Example    : use Bio::EnsEMBL::Utils::Sequence qw(expand);
+
+               $seq = '(AC)3';
+               expand(\$seq);
+               print $seq;
+              
+
+  Description: Expands a genomic sequence. The string is passed by reference
+               rather than by value for memory efficiency.
+  Returntype : none
+  Exceptions : none
+  Caller     : SequenceAdaptor, SliceAdaptor
+
+=cut
+
+sub expand {
+  my $seq_ref = shift;
+     $$seq_ref =~ s/(\w*)\((\w+)\)(\d+)/$1.$2 x $3/eg  if ($$seq_ref =~ /\(/);#expressions with parenthesis, expand the alleles			    
+  return;
+}
+
+
+1;