Mercurial > repos > mahtabm > ensembl
diff variant_effect_predictor/Bio/EnsEMBL/DBSQL/CompressedSequenceAdaptor.pm @ 0:1f6dce3d34e0
Uploaded
| author | mahtabm |
|---|---|
| date | Thu, 11 Apr 2013 02:01:53 -0400 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/variant_effect_predictor/Bio/EnsEMBL/DBSQL/CompressedSequenceAdaptor.pm Thu Apr 11 02:01:53 2013 -0400 @@ -0,0 +1,205 @@ +=head1 LICENSE + + Copyright (c) 1999-2012 The European Bioinformatics Institute and + Genome Research Limited. All rights reserved. + + This software is distributed under a modified Apache license. + For license details, please see + + http://www.ensembl.org/info/about/code_licence.html + +=head1 CONTACT + + Please email comments or questions to the public Ensembl + developers list at <dev@ensembl.org>. + + Questions may also be sent to the Ensembl help desk at + <helpdesk@ensembl.org>. + +=cut + +=head1 NAME + +Bio::EnsEMBL::DBSQL::CompressedSequenceAdaptor - Facilitates DB storage and retrieval of compressed sequence + +=head1 SYNOPSIS + + $seq_adptr = $database_adaptor->get_SequenceAdaptor(); + + $dna = + ${ $seq_adptr->fetch_by_Slice_start_end_strand( $slice, 1, 1000, + -1 ) }; + +=head1 DESCRIPTION + +An adaptor for the retrieval of compressed DNA sequence from the EnsEMBL +database + +=head1 METHODS + +=cut + +package Bio::EnsEMBL::DBSQL::CompressedSequenceAdaptor; + +use vars qw(@ISA); +use strict; + +use Bio::EnsEMBL::DBSQL::SequenceAdaptor; + +@ISA = qw(Bio::EnsEMBL::DBSQL::SequenceAdaptor); + + +sub _fetch_seq { + my $self = shift; + my $seq_region_id = shift; + my $start = shift; + my $len = shift; + + #calculate the offset and start in the compressed sequence + my $comp_start = ($start-1 >> 2) + 1; + my $comp_len = ($len >> 2) + 2; + + my ($bvector, $nline); + + my $sth = $self->prepare( + "SELECT SUBSTRING( d.sequence, ?, ?), n_line + FROM dnac d + WHERE d.seq_region_id = ?"); + $sth->bind_param(1,$comp_start,SQL_INTEGER); + $sth->bind_param(2,$comp_len ,SQL_INTEGER); + $sth->bind_param(3,$seq_region_id,SQL_INTEGER); + $sth->execute(); + $sth->bind_columns(\$bvector, \$nline); + $sth->fetch(); + $sth->finish(); + + #convert sequence from binary string to 0123 string + my $bitlen = length($bvector) << 2; + my $str = ''; + for(my $i=0; $i < $bitlen; $i++) { + $str .= vec($bvector, $i, 2); + } + + #convert from 0123 to ACTG + $str =~ tr/0123/ACTG/; + + $str = substr($str, ($start-1)%4, $len); + + #expand the nlines and place them back in the sequence + my @nlines = split(/:/, $nline); + foreach my $nl (@nlines) { + my ($offset,$char,$nlen) = $nl =~ /(\d+)(\D)(\d+)/; + + #skip nlines entirely out of range + next if(($offset+$nlen-1) < $start || $offset > ($start+$len-1)); + + #obtain relative offset into requested region + $offset = $offset - $start + 1; + + #nlines that partially overlap requested region have to be shrunk + if($offset < 1) { + $nlen = $nlen - (1-$offset); + $offset = 1; + } + if($offset + $nlen > $start+$len) { + $nlen = $len - $offset + 1; + } + + substr($str,$offset-1,$nlen) = $char x $nlen; + } + + return \$str; +} + + +=head2 store + + Arg [1] : string $seq_region_id the id of the sequence region this dna + will be associated with. + Arg [2] : string reference $sequence the dna sequence to be stored in + the database + Example : $dbID = $seq_adaptor->store(12,\'ACTGGGTACCAAACAAACACAACA'); + Description: stores a dna sequence in the databases dna table and returns the + database identifier for the new record. + Returntype : int + Exceptions : none + Caller : Bio::EnsEMBL::DBSQL::RawContigAdaptor::store + Status : Stable + +=cut + +sub store { + my ($self, $seq_region_id, $sequence) = @_; + + if(!$seq_region_id) { + throw('seq_region_id is required'); + } + + $sequence = uc($sequence); + + my $bvector = ''; + + #convert sequence to 0s,1s,2s and 3s + $sequence =~ tr/ACTG/0123/; + + #nlines cover sequence which is not ACTG such as N + #nline format is a set of colon delimited int, char, int triplets: + #<offset><code><length> + my($nline_char,$nline_len,$nline_off); + my @nlines; + + my $len = length($sequence); + for(my $i=0; $i < $len; $i++) { + my $char = substr($sequence,$i,1); + + #quickly check if this character was an A,C,T or G (and was converted to + # a 0,1,2,3) + if($char =~ /[0-3]/) { + vec($bvector, $i,2) = $char; + if($nline_char) { + #end of an nline + push @nlines, "$nline_off$nline_char$nline_len"; + $nline_char = undef; + $nline_len = 0; + $nline_off = 0; + } + } else { + #this was not an ACTG + if($nline_char) { + if($nline_char eq $char) { + #continuation of an nline + $nline_len++; + } else { + #end of a previous nline and start of a new one + push @nlines, "$nline_off$nline_char$nline_len"; + $nline_char = $char; + $nline_len = 1; + $nline_off = $i+1; + } + } else { + #start of a new nline + $nline_char = $char; + $nline_len = 1; + $nline_off = $i+1; + } + $char = 0; #need to put numeric val into bitvector despite nline + } + + vec($bvector, $i,2) = $char; + } + + my $nline = join(':', @nlines); + my $statement = $self->prepare( + "INSERT INTO dnac(seq_region_id, sequence, n_line) VALUES(?,?,?)"); + + $statement->bind_param(1,$seq_region_id,SQL_INTEGER); + $statement->bind_param(2,$bvector,SQL_BLOB); + $statement->bind_param(3,$nline,SQL_LONGVARCHAR); + $statement->execute(); + + $statement->finish(); + return; +} + + +1;
