# HG changeset patch # User jorrit # Date 1360274320 18000 # Node ID 0c42bebab126dd98b27f912f77d1ecfbe353bbed # Parent e71204d5e03c13228a493f2a6282e82e05091070 Uploaded diff -r e71204d5e03c -r 0c42bebab126 README --- a/README Thu Feb 07 16:57:42 2013 -0500 +++ b/README Thu Feb 07 16:58:40 2013 -0500 @@ -1,4 +1,11 @@ +The following libraries need to be installed to use the obo tools: -oather This is a tools that says hello. +# termfinder needs g++ and other build tools +sudo apt-get $APT_OPTS install build-essential -And an update. +# perl dbi / perl DBD::mysql +sudo apt-get $APT_OPTS install libdbi-perl libdbd-mysql-perl + +# GO:TermFinder needs dependencies GraphViz and GD graphics libraries +sudo apt-get $APT_OPTS install libgraphviz-perl +sudo apt-get $APT_OPTS install libgd-gd2-perl diff -r e71204d5e03c -r 0c42bebab126 fetch_ontology.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fetch_ontology.xml Thu Feb 07 16:58:40 2013 -0500 @@ -0,0 +1,41 @@ + + from OBO repository + + obo_scripts + + obo-fetch-remote-ontology.pl $ont > $output + + + + + + + + + + + + + + + +.. class:: infomark + +Fetch entire ontology in OBO format + +**Example** + +Here are some common ID spaces:: + + GO gene ontology + CL cell ontology + +**More information** + +http://github.com/cmungall/obo-scripts + + + + + + diff -r e71204d5e03c -r 0c42bebab126 obo_scripts.xml --- a/obo_scripts.xml Thu Feb 07 16:57:42 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,676 +0,0 @@ - - - - freebayes - samtools - - - obo scripts - - ##set up input files - #set $reference_fasta_filename = "localref.fa" - #if str( $reference_source.reference_source_selector ) == "history": - ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" && - samtools faidx "${reference_fasta_filename}" 2>&1 || echo "Error running samtools faidx for FreeBayes" >&2 && - #else: - #set $reference_fasta_filename = str( $reference_source.ref_file.fields.path ) - #end if - #for $bam_count, $input_bam in enumerate( $reference_source.input_bams ): - ln -s "${input_bam.input_bam}" "localbam_${bam_count}.bam" && - ln -s "${input_bam.input_bam.metadata.bam_index}" "localbam_${bam_count}.bam.bai" && - #end for - ##finished setting up inputs - - ##start FreeBayes commandline - freebayes - #for $bam_count, $input_bam in enumerate( $reference_source.input_bams ): - --bam "localbam_${bam_count}.bam" - #end for - --fasta-reference "${reference_fasta_filename}" - - ##outputs - --vcf "${output_vcf}" - - ##advanced options - #if str( $options_type.options_type_selector ) == "advanced": - ##additional outputs - #if $options_type.output_trace_option: - --trace "${output_trace}" - #end if - #if $options_type.output_failed_alleles_option: - --failed-alleles "${output_failed_alleles_bed}" - #end if - - ##additional inputs - #if str( $options_type.target_limit_type.target_limit_type_selector ) == "limit_by_target_file": - --targets "${options_type.target_limit_type.input_target_bed}" - #elif str( $options_type.target_limit_type.target_limit_type_selector ) == "limit_by_region": - --region "${options_type.target_limit_type.region_chromosome}:${options_type.target_limit_type.region_start}..${options_type.target_limit_type.region_end}" - #end if - #if $options_type.input_sample_file: - --samples "${options_type.input_sample_file}" - #end if - #if $options_type.input_populations_file: - --populations "${options_type.input_populations_file}" - #end if - #if $options_type.input_cnv_map_bed: - --cnv-map "${options_type.input_cnv_map_bed}" - #end if - #if str( $options_type.input_variant_type.input_variant_type_selector ) == "provide_vcf": - --variant-input "${options_type.input_variant_type.input_variant_vcf}" - ${options_type.input_variant_type.only_use_input_alleles} - #end if - #if $options_type.haplotype_basis_alleles: - --haplotype-basis-alleles "${options_type.haplotype_basis_alleles}" - #end if - - - ##reporting - #if str( $options_type.section_reporting_type.section_reporting_type_selector ) == "set": - --pvar "${options_type.section_reporting_type.pvar}" - ${options_type.section_reporting_type.show_reference_repeats} - #end if - - ##population model - #if str( $options_type.section_population_model_type.section_population_model_type_selector ) == "set": - --theta "${options_type.section_population_model_type.theta}" - --ploidy "${options_type.section_population_model_type.ploidy}" - ${options_type.section_population_model_type.pooled} - #end if - - ##reference allele - #if str( $options_type.use_reference_allele_type.use_reference_allele_type_selector ) == "include_reference_allele": - --use-reference-allele - ${options_type.use_reference_allele_type.diploid_reference} - --reference-quality "${options_type.use_reference_allele_type.reference_quality_mq},${options_type.use_reference_allele_type.reference_quality_bq}" - #end if - - ##allele scope - #if str( $options_type.section_allele_scope_type.section_allele_scope_type_selector ) == "set": - ${options_type.section_allele_scope_type.no_snps} - ${options_type.section_allele_scope_type.no_indels} - ${options_type.section_allele_scope_type.no_mnps} - ${options_type.section_allele_scope_type.no_complex} - --use-best-n-alleles "${options_type.section_allele_scope_type.use_best_n_alleles}" - #if $options_type.section_allele_scope_type.max_complex_gap: - --max-complex-gap "${options_type.section_allele_scope_type.max_complex_gap}" - #end if - #end if - - ##indel realignment - ${options_type.left_align_indels} - - ##input filters - #if str( $options_type.section_input_filters_type.section_input_filters_type_selector ) == "set": - ${options_type.section_input_filters_type.use_duplicate_reads} - #if str( $options_type.section_input_filters_type.quality_filter_type.quality_filter_type_selector ) == "apply_filters": - --min-mapping-quality "${options_type.section_input_filters_type.quality_filter_type.min_mapping_quality}" - --min-base-quality "${options_type.section_input_filters_type.quality_filter_type.min_base_quality}" - --min-supporting-quality "${options_type.section_input_filters_type.quality_filter_type.min_supporting_quality_mq},${options_type.section_input_filters_type.quality_filter_type.min_supporting_quality_bq}" - #elif str( $options_type.section_input_filters_type.quality_filter_type.quality_filter_type_selector ) == "standard_filters": - --standard-filters - #end if - --mismatch-base-quality-threshold "${options_type.section_input_filters_type.mismatch_base_quality_threshold}" - #if $options_type.section_input_filters_type.read_mismatch_limit: - --read-mismatch-limit "${options_type.section_input_filters_type.read_mismatch_limit}" - #end if - --read-max-mismatch-fraction "${options_type.section_input_filters_type.read_max_mismatch_fraction}" - #if $options_type.section_input_filters_type.read_snp_limit: - --read-snp-limit "${options_type.section_input_filters_type.read_snp_limit}" - #end if - #if $options_type.section_input_filters_type.read_indel_limit: - --read-indel-limit "${options_type.section_input_filters_type.read_indel_limit}" - #end if - --indel-exclusion-window "${options_type.section_input_filters_type.indel_exclusion_window}" - --min-alternate-fraction "${options_type.section_input_filters_type.min_alternate_fraction}" - --min-alternate-count "${options_type.section_input_filters_type.min_alternate_count}" - --min-alternate-qsum "${options_type.section_input_filters_type.min_alternate_qsum}" - --min-alternate-total "${options_type.section_input_filters_type.min_alternate_total}" - --min-coverage "${options_type.section_input_filters_type.min_coverage}" - #end if - - ##bayesian priors - #if str( $options_type.section_bayesian_priors_type.section_bayesian_priors_type_selector ) == "set": - ${options_type.section_bayesian_priors_type.no_ewens_priors} - ${options_type.section_bayesian_priors_type.no_population_priors} - ${options_type.section_bayesian_priors_type.hwe_priors} - #end if - - ##observation prior expectations - #if str( $options_type.section_observation_prior_expectations_type.section_observation_prior_expectations_type_selector ) == "set": - ${options_type.section_observation_prior_expectations_type.binomial_obs_priors} - ${options_type.section_observation_prior_expectations_type.allele_balance_priors} - #end if - - ##algorithmic features - #if str( $options_type.section_algorithmic_features_type.section_algorithmic_features_type_selector ) == "set": - --site-selection-max-iterations "${options_type.section_algorithmic_features_type.site_selection_max_iterations}" - --genotyping-max-iterations "${options_type.section_algorithmic_features_type.genotyping_max_iterations}" - --genotyping-max-banddepth "${options_type.section_algorithmic_features_type.genotyping_max_banddepth}" - --posterior-integration-limits "${options_type.section_algorithmic_features_type.posterior_integration_limits_n},${options_type.section_algorithmic_features_type.posterior_integration_limits_m}" - ${options_type.section_algorithmic_features_type.no_permute} - ${options_type.section_algorithmic_features_type.exclude_unobserved_genotypes} - #if $options_type.section_algorithmic_features_type.genotype_variant_threshold: - --genotype-variant-threshold "${options_type.section_algorithmic_features_type.genotype_variant_threshold}" - #end if - ${options_type.section_algorithmic_features_type.use_mapping_quality} - --read-dependence-factor "${options_type.section_algorithmic_features_type.read_dependence_factor}" - ${options_type.section_algorithmic_features_type.no_marginals} - #end if - - #end if - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - options_type['options_type_selector'] == "advanced" and options_type['output_failed_alleles_option'] is True - - - options_type['options_type_selector'] == "advanced" and options_type['output_trace_option'] is True - - - - - - - - - - - - -**What it does** - -This tool uses FreeBayes to call SNPS given a reference sequence and a BAM alignment file. - -FreeBayes is a high-performance, flexible, and open-source Bayesian genetic variant detector. It operates on BAM alignment files, which are produced by most contemporary short-read aligners. - -In addition to substantial performance improvements over its predecessors (PolyBayes, GigaBayes, and BamBayes), it expands the scope of SNP and small-indel variant calling to populations of individuals with heterogeneous copy number. FreeBayes is currently under active development. - -Go `here <http://bioinformatics.bc.edu/marthlab/FreeBayes>`_ for details on FreeBayes. - ------- - -**Inputs** - -FreeBayes accepts an input aligned BAM file. - - -**Outputs** - -The output is in the VCF format. - -------- - -**Settings**:: - - input and output: - - -b --bam FILE Add FILE to the set of BAM files to be analyzed. - -c --stdin Read BAM input on stdin. - -v --vcf FILE Output VCF-format results to FILE. - -f --fasta-reference FILE - Use FILE as the reference sequence for analysis. - An index file (FILE.fai) will be created if none exists. - If neither --targets nor --region are specified, FreeBayes - will analyze every position in this reference. - -t --targets FILE - Limit analysis to targets listed in the BED-format FILE. - -r --region <chrom>:<start_position>..<end_position> - Limit analysis to the specified region, 0-base coordinates, - end_position not included (same as BED format). - -s --samples FILE - Limit analysis to samples listed (one per line) in the FILE. - By default FreeBayes will analyze all samples in its input - BAM files. - --populations FILE - Each line of FILE should list a sample and a population which - it is part of. The population-based bayesian inference model - will then be partitioned on the basis of the populations. - -A --cnv-map FILE - Read a copy number map from the BED file FILE, which has - the format: - reference sequence, start, end, sample name, copy number - ... for each region in each sample which does not have the - default copy number as set by --ploidy. - -L --trace FILE Output an algorithmic trace to FILE. - --failed-alleles FILE - Write a BED file of the analyzed positions which do not - pass --pvar to FILE. - -@ --variant-input VCF - Use variants reported in VCF file as input to the algorithm. - A report will be generated for every record in the VCF file. - -l --only-use-input-alleles - Only provide variant calls and genotype likelihoods for sites - and alleles which are provided in the VCF input, and provide - output in the VCF for all input alleles, not just those which - have support in the data. - --haplotype-basis-alleles VCF - When specified, only variant alleles provided in this input - VCF will be used for the construction of complex or haplotype - alleles. - - reporting: - - -P --pvar N Report sites if the probability that there is a polymorphism - at the site is greater than N. default: 0.0001 - -_ --show-reference-repeats - Calculate and show information about reference repeats in - the VCF output. - - population model: - - -T --theta N The expected mutation rate or pairwise nucleotide diversity - among the population under analysis. This serves as the - single parameter to the Ewens Sampling Formula prior model - default: 0.001 - -p --ploidy N Sets the default ploidy for the analysis to N. default: 2 - -J --pooled Assume that samples result from pooled sequencing. - When using this flag, set --ploidy to the number of - alleles in each sample. - - reference allele: - - -Z --use-reference-allele - This flag includes the reference allele in the analysis as - if it is another sample from the same population. - -H --diploid-reference - If using the reference sequence as a sample (-Z), - treat it as diploid. default: false (reference is haploid) - --reference-quality MQ,BQ - Assign mapping quality of MQ to the reference allele at each - site and base quality of BQ. default: 100,60 - - allele scope: - - -I --no-snps Ignore SNP alleles. - -i --no-indels Ignore insertion and deletion alleles. - -X --no-mnps Ignore multi-nuceotide polymorphisms, MNPs. - -u --no-complex Ignore complex events (composites of other classes). - -n --use-best-n-alleles N - Evaluate only the best N SNP alleles, ranked by sum of - supporting quality scores. (Set to 0 to use all; default: all) - -E --max-complex-gap N - Allow complex alleles with contiguous embedded matches of up - to this length. - - indel realignment: - - -O --left-align-indels - Left-realign and merge gaps embedded in reads. default: false - - input filters: - - -4 --use-duplicate-reads - Include duplicate-marked alignments in the analysis. - default: exclude duplicates - -m --min-mapping-quality Q - Exclude alignments from analysis if they have a mapping - quality less than Q. default: 30 - -q --min-base-quality Q - Exclude alleles from analysis if their supporting base - quality is less than Q. default: 20 - -R --min-supporting-quality MQ,BQ - In order to consider an alternate allele, at least one supporting - alignment must have mapping quality MQ, and one supporting - allele must have base quality BQ. default: 0,0, unset - -Q --mismatch-base-quality-threshold Q - Count mismatches toward --read-mismatch-limit if the base - quality of the mismatch is >= Q. default: 10 - -U --read-mismatch-limit N - Exclude reads with more than N mismatches where each mismatch - has base quality >= mismatch-base-quality-threshold. - default: ~unbounded - -z --read-max-mismatch-fraction N - Exclude reads with more than N [0,1] fraction of mismatches where - each mismatch has base quality >= mismatch-base-quality-threshold - default: 1.0 - -$ --read-snp-limit N - Exclude reads with more than N base mismatches, ignoring gaps - with quality >= mismatch-base-quality-threshold. - default: ~unbounded - -e --read-indel-limit N - Exclude reads with more than N separate gaps. - default: ~unbounded - -0 --standard-filters Use stringent input base and mapping quality filters - Equivalent to -m 30 -q 20 -R 0 -S 0 - -x --indel-exclusion-window - Ignore portions of alignments this many bases from a - putative insertion or deletion allele. default: 0 - -F --min-alternate-fraction N - Require at least this fraction of observations supporting - an alternate allele within a single individual in the - in order to evaluate the position. default: 0.0 - -C --min-alternate-count N - Require at least this count of observations supporting - an alternate allele within a single individual in order - to evaluate the position. default: 1 - -3 --min-alternate-qsum N - Require at least this sum of quality of observations supporting - an alternate allele within a single individual in order - to evaluate the position. default: 0 - -G --min-alternate-total N - Require at least this count of observations supporting - an alternate allele within the total population in order - to use the allele in analysis. default: 1 - -! --min-coverage N - Require at least this coverage to process a site. default: 0 - - bayesian priors: - - -Y --no-ewens-priors - Turns off the Ewens' Sampling Formula component of the priors. - -k --no-population-priors - Equivalent to --pooled --no-ewens-priors - -w --hwe-priors Use the probability of the combination arising under HWE given - the allele frequency as estimated by observation frequency. - - observation prior expectations: - - -V --binomial-obs-priors - Incorporate expectations about osbervations into the priors, - Uses read placement probability, strand balance probability, - and read position (5'-3') probability. - -a --allele-balance-priors - Use aggregate probability of observation balance between alleles - as a component of the priors. Best for observations with minimal - inherent reference bias. - - algorithmic features: - - -M --site-selection-max-iterations N - Uses hill-climbing algorithm to search posterior space for N - iterations to determine if the site should be evaluated. Set to 0 - to prevent use of this algorithm for site selection, and - to a low integer for improvide site selection at a slight - performance penalty. default: 5. - -B --genotyping-max-iterations N - Iterate no more than N times during genotyping step. default: 25. - --genotyping-max-banddepth N - Integrate no deeper than the Nth best genotype by likelihood when - genotyping. default: 6. - -W --posterior-integration-limits N,M - Integrate all genotype combinations in our posterior space - which include no more than N samples with their Mth best - data likelihood. default: 1,3. - -K --no-permute - Do not scale prior probability of genotype combination given allele - frequency by the number of permutations of included genotypes. - -N --exclude-unobserved-genotypes - Skip sample genotypings for which the sample has no supporting reads. - -S --genotype-variant-threshold N - Limit posterior integration to samples where the second-best - genotype likelihood is no more than log(N) from the highest - genotype likelihood for the sample. default: ~unbounded - -j --use-mapping-quality - Use mapping quality of alleles when calculating data likelihoods. - -D --read-dependence-factor N - Incorporate non-independence of reads by scaling successive - observations by this factor during data likelihood - calculations. default: 0.9 - -= --no-marginals - Do not calculate the marginal probability of genotypes. Saves - time and improves scaling performance in large populations. - - ------- - -**Citation** - -For the underlying tool, please cite `Erik Garrison and Gabor Marth. Haplotype-based variant detection from short-read sequencing <http://arxiv.org/abs/1207.3907>`_. - -If you use this tool in Galaxy, please cite Blankenberg D, et al. *In preparation.* - - - diff -r e71204d5e03c -r 0c42bebab126 sam_fa_indices.loc.sample --- a/sam_fa_indices.loc.sample Thu Feb 07 16:57:42 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,28 +0,0 @@ -#This is a sample file distributed with Galaxy that enables tools -#to use a directory of Samtools indexed sequences data files. You will need -#to create these data files and then create a sam_fa_indices.loc file -#similar to this one (store it in this directory) that points to -#the directories in which those files are stored. The sam_fa_indices.loc -#file has this format (white space characters are TAB characters): -# -#index -# -#So, for example, if you had hg18 indexed stored in -#/depot/data2/galaxy/sam/, -#then the sam_fa_indices.loc entry would look like this: -# -#index hg18 /depot/data2/galaxy/sam/hg18.fa -# -#and your /depot/data2/galaxy/sam/ directory -#would contain hg18.fa and hg18.fa.fai files: -# -#-rw-r--r-- 1 james universe 830134 2005-09-13 10:12 hg18.fa -#-rw-r--r-- 1 james universe 527388 2005-09-13 10:12 hg18.fa.fai -# -#Your sam_fa_indices.loc file should include an entry per line for -#each index set you have stored. The file in the path does actually -#exist, but it should never be directly used. Instead, the name serves -#as a prefix for the index file. For example: -# -#index hg18 /depot/data2/galaxy/sam/hg18.fa -#index hg19 /depot/data2/galaxy/sam/hg19.fa diff -r e71204d5e03c -r 0c42bebab126 src --- a/src Thu Feb 07 16:57:42 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,785 +0,0 @@ - - - - - - - jhpoelen / obo - / source / - — Bitbucket - - - - - - - - - - - - - - - - - - -

- - - - -

- -

- - - - -

- - -

- - - - -

obo

- - User icon - jhpoelen - -
- - Follow icon - Follow - -

- -

- Overview -
- Source -
- - Commits - -
- - Pull requests - - - - -
- - Issues - - - - -
- Wiki -
- - Downloads - - - - -

- - -

- -

- - -

- - - - -

- -

- - -

- obo / - - - - - - - -

- - - - -

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Filename	Size	Date modified	Message
- test-data -
- - README - -	- - 418 B - -	- - 21 hours ago - -	- - - First commit. - - -
- - fetch_ontology.xml - -	- - 846 B - -	- - 21 hours ago - -	- - - First commit. - - -
- - tool_dependencies.xml - -	- - 858 B - -	- - 21 hours ago - -	- - - First commit. - - -

- -

The following libraries need to be installed to use the obo tools:
-
-# termfinder needs g++ and other build tools
-sudo apt-get $APT_OPTS install build-essential
-
-# perl dbi / perl DBD::mysql 
-sudo apt-get $APT_OPTS install libdbi-perl libdbd-mysql-perl
-
-# GO:TermFinder needs dependencies GraphViz and GD graphics libraries 
-sudo apt-get $APT_OPTS install libgraphviz-perl
-sudo apt-get $APT_OPTS install libgd-gd2-perl
-

- - - - -

- - - - - - - -

- - -

- - - - - - - -

- -

- - - - - - - - - - - - - - - - - diff -r e71204d5e03c -r 0c42bebab126 test-data/fake_phiX_reads_1.bam Binary file test-data/fake_phiX_reads_1.bam has changed diff -r e71204d5e03c -r 0c42bebab126 test-data/fetch_GO_ontology.test diff -r e71204d5e03c -r 0c42bebab126 test-data/freebayes_out_1.output_trace --- a/test-data/freebayes_out_1.output_trace Thu Feb 07 16:57:42 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,8 +0,0 @@ -phiX174,1411,allele,phiX174,phiX174,A,60,100 -phiX174,1412,allele,phiX174,phiX174,G,60,100 -phiX174,1413,allele,phiX174,phiX174,C,60,100 -phiX174,1414,allele,phiX174,phiX174,G,60,100 -phiX174,1415,allele,phiX174,phiX174,C,60,100 -phiX174,1416,allele,phiX174,phiX174,C,60,100 -phiX174,1417,allele,phiX174,phiX174,G,60,100 -phiX174,1418,allele,phiX174,phiX174,T,60,100 diff -r e71204d5e03c -r 0c42bebab126 test-data/freebayes_out_1.vcf.contains --- a/test-data/freebayes_out_1.vcf.contains Thu Feb 07 16:57:42 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,2 +0,0 @@ -#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT A - diff -r e71204d5e03c -r 0c42bebab126 test-data/phiX.fasta --- a/test-data/phiX.fasta Thu Feb 07 16:57:42 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,79 +0,0 @@ ->phiX174 -GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT -GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA -ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG -TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA -GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC -TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT -TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT -CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT -TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG -TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC -GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA -CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG -TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT -AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC -CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA -TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC -TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA -CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA -GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT -GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA -ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC -TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT -TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC -ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC -CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT -GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC -CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC -TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG -TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT -TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA -AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT -TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT -ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC -GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC -TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT -TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA -TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG -TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC -CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG -AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC -CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT -TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG -CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA -AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT -GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG -GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA -TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT -CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG -TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA -GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC -CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA -TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA -AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC -TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT -CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA -TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG -TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT -CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT -TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC -ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG -TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA -ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG -GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC -CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT -GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG -GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT -ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG -CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC -CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC -GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT -CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG -CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA -TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT -TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG -TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC -AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC -TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA - diff -r e71204d5e03c -r 0c42bebab126 tool_data_table_conf.xml.sample --- a/tool_data_table_conf.xml.sample Thu Feb 07 16:57:42 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,8 +0,0 @@ - - - - - line_type, value, path - -

- diff -r e71204d5e03c -r 0c42bebab126 tool_dependencies.xml --- a/tool_dependencies.xml Thu Feb 07 16:57:42 2013 -0500 +++ b/tool_dependencies.xml Thu Feb 07 16:58:40 2013 -0500 @@ -1,47 +1,20 @@ - + - git clone --recursive git://github.com/ekg/freebayes.git - git checkout 9608597d12e127c847ae03aa03440ab63992fedf - git submodule update --recursive - make + git clone http://github.com/cmungall/obo-scripts - bin - $INSTALL_DIR/bin + $INSTALL_DIR + $INSTALL_DIR $INSTALL_DIR/bin -FreeBayes requires g++ and the standard C and C++ development libraries. -Additionally, cmake is required for building the BamTools API. - - - - - - http://sourceforge.net/projects/samtools/files/samtools/0.1.18/samtools-0.1.18.tar.bz2 - sed -i.bak -e 's/-lcurses/-lncurses/g' Makefile - make - - samtools - $INSTALL_DIR/bin - - - misc/maq2sam-long - $INSTALL_DIR/bin - - - $INSTALL_DIR/bin - - - - -Compiling SAMtools requires the ncurses and zlib development libraries. + obo_scripts require perl to be installed.