Mercurial > repos > jjohnson > trinityrnaseq
view trinityrnaseq_norm.xml @ 7:964364c9279f
Fix RSEM tool_dependency changeset_revision
| author | Jim Johnson <jj@umn.edu> |
|---|---|
| date | Thu, 06 Feb 2014 09:29:58 -0600 |
| parents | 5eb99d21ef0d |
| children |
line wrap: on
line source
<tool id="trinityrnaseq_norm" name="Trinity read normalization" version="0.0.2"> <!-- Written by Jeremy Goecks, modified by Josh Bowden for normalization proceedure, now maintained here by bhaas --> <description>Pre-process RNA-seq data to reduce coverage of highly covered areas</description> <requirements> <requirement type="package" version="2013_08_14">trinityrnaseq</requirement> </requirements> <command> ## symlink input in work_dir #if str($inputs.paired_or_single) == "paired": ln -s $inputs.left_input left_reads && ln -s $inputs.right_input right_reads && #else: ln -s $inputs.input single_reads && #end if \${TRINITY_HOME}/util/normalize_by_kmer_coverage.pl --JM $JM --max_cov $max_cov ## Inputs. #if str($inputs.paired_or_single) == "paired": --left left_reads --right right_reads #if $inputs.left_input.ext == 'fa': --seqType fa #else: --seqType fq #end if $inputs.pe_reads_unordered #if str($inputs.library_type) != "None": --SS_lib_type $inputs.library_type #end if $inputs.pairs_together $inputs.parallel_stats #else: --single single_reads #if str($inputs.input.ext) == 'fa': --seqType fa #else: --seqType fq #end if #if str($inputs.library_type) != "None": --SS_lib_type $inputs.library_type #end if #end if #if $kmer_size: --KMER_SIZE $kmer_size #end if #if $max_pct_stdev: --max_pct_stdev $max_pct_stdev #end if ## direct stdio to output | tee $trinity_coverage_normalization_log && #if str($inputs.paired_or_single) == "paired": cp left_reads.normalized* $output_left && cp right_reads.normalized* $output_right #else: cp single_reads.normalized* $output_single #end if </command> <inputs> <param name="JM" type="select" label="JM" help="Amount of memory to allocate to Jellyfish for Kmer catalog construction"> <option value="1G">1G</option> <option value="10G">10G</option> <option value="20G">20G</option> <option value="50G">50G</option> <option value="100G">100G</option> </param> <param name="max_cov" type="select" label="max_cov" help="Read coverage in terms of maximum covarge to keep"> <option value="30">30</option> <option value="40">40</option> <option value="50">50</option> <option value="60">60</option> <option value="70">70</option> <option value="100">100</option> </param> <conditional name="inputs"> <param name="paired_or_single" type="select" label="Paired or Single-end data?"> <option value="paired">Paired</option> <option value="single">Single</option> </param> <when value="paired"> <param format="fasta,fastq" name="left_input" type="data" label="Left/Forward strand reads" help=""/> <param format="fasta,fastq" name="right_input" type="data" label="Right/Reverse strand reads" help=""/> <param name="library_type" type="select" label="Strand-specific Library Type"> <option value="None">None</option> <option value="FR">FR</option> <option value="RF">RF</option> </param> <param name="pe_reads_unordered" type="boolean" truevalue="--PE_reads_unordered" falsevalue="" checked="false" label="set if the input paired-end reads are not identically ordered"/> <param name="pairs_together" type="boolean" truevalue="--pairs_together" falsevalue="" checked="false" label="process paired reads by averaging stats between pairs and retaining linking info"/> <param name="parallel_stats" type="boolean" truevalue="--PARALLEL_STATS" falsevalue="" checked="false" label="generate read stats in parallel for paired reads" help="(Figure 2X Inchworm memory requirement)"/> </when> <when value="single"> <param format="fasta,fastq" name="input" type="data" label="Single-end reads" help=""/> <param name="library_type" type="select" label="Strand-specific Library Type"> <option value="None">None</option> <option value="F">F</option> <option value="R">R</option> </param> </when> </conditional> <param name="kmer_size" type="integer" value="" optional="true" label="KMER SIZE" help="default: 25"> <validator type="in_range" message="kmer size between 3 and 200" min="3" max="200"/> </param> <param name="max_pct_stdev" type="integer" value="" optional="true" label="maximum pct of mean for stdev of kmer coverage across read" help="default: 100"> <validator type="in_range" message="kmer size between 10 and 100" min="10" max="100"/> </param> </inputs> <stdio> <exit_code range="1:" level="fatal" description="Failed" /> <regex match="Error" source="stdout" level="fatal" description="Failed" /> </stdio> <outputs> <!-- I have not found a way to do condional outputs so all potential output files are specified and some will be empty --> <data format="txt" name="trinity_coverage_normalization_log" label="${tool.name} on ${on_string}: log" /> <data format_source="left_input" name="output_left" label="${tool.name} on ${on_string}: Normalized left reads"> <filter>inputs['paired_or_single'] == "paired"</filter> </data> <data format_source="right_input" name="output_right" label="${tool.name} on ${on_string}: Normalized right reads"> <filter>inputs['paired_or_single'] == "paired"</filter> </data> <data format_source="input" name="output_single" label="${tool.name} on ${on_string}: Normalized reads"> <filter>inputs['paired_or_single'] == "single"</filter> </data> </outputs> <tests> <test> <param name="JM" value="1G"/> <param name="max_cov" value="30"/> <param name="paired_or_single" value="single"/> <param name="input" ftype="fastq" value="reads.left.fq"/> <param name="library_type" value="None"/> <output name="trinity_coverage_normalization_log"> <assert_contents> <has_text text="Normalization complete." /> </assert_contents> </output> <output name="output_single"> <assert_contents> <has_text text="ACTGCATCCTGGAAAGAATCAATGGTGGCCGGAAAGTGTTTTTCAAATACAAGAGTGACAATGTGCCCTGTTGTTT" /> </assert_contents> </output> </test> <test> <param name="JM" value="1G"/> <param name="max_cov" value="30"/> <param name="paired_or_single" value="paired"/> <param name="left_input" ftype="fastq" value="reads.left.fq"/> <param name="right_input" ftype="fastq" value="reads.right.fq"/> <param name="library_type" value="None"/> <param name="pe_reads_unordered" value="False"/> <param name="pairs_together" value="False"/> <param name="parallel_stats" value="False"/> <output name="trinity_coverage_normalization_log"> <assert_contents> <has_text text="Normalization complete." /> </assert_contents> </output> <output name="output_left"> <assert_contents> <has_text text="CTGGGCTGCAGCTAAGTTCTCTGCATCCTCCTTCTTGCTTGTGGCTGGGAAGAAGACAATGTTGTCGATGGTCTGG" /> </assert_contents> </output> <output name="output_right"> <assert_contents> <has_text text="CTCAAATGGTTAATTCTCAGGCTGCAAATATTCGTTCAGGATGGAAGAACATTTTCTCAGTATTCCATCTAGCTGC" /> </assert_contents> </output> </test> </tests> <help> Runs script Trinity_ script util/normalize_by_kmer_coverage.pl which reduces data sizes with minimal impact on recovered transcripts when used by Trinity.pl. .. _Trinity: http://trinityrnaseq.sourceforge.net </help> </tool>