|
0
|
1 <tool id="trinityrnaseq" name="Trinity" version="0.0.1">
|
|
|
2 <!-- Written by Jeremy Goecks, now maintained here by bhaas -->
|
|
|
3 <description>De novo assembly of RNA-Seq data Using Trinity</description>
|
|
|
4 <requirements>
|
|
|
5 <requirement type="package" version="2013-02-25">trinityrnaseq</requirement>
|
|
|
6 </requirements>
|
|
|
7 <command>
|
|
|
8 Trinity.pl --JM $JM --CPU $CPU
|
|
|
9
|
|
|
10 ## Inputs.
|
|
|
11 #if str($inputs.paired_or_single) == "paired":
|
|
|
12 --left $inputs.left_input --right $inputs.right_input
|
|
|
13 #if $inputs.left_input.ext == 'fa':
|
|
|
14 --seqType fa
|
|
|
15 #else:
|
|
|
16 --seqType fq
|
|
|
17 #end if
|
|
|
18 #if str($inputs.library_type) != "None":
|
|
|
19 --SS_lib_type $inputs.library_type
|
|
|
20 #end if
|
|
|
21 --group_pairs_distance $inputs.group_pairs_distance
|
|
|
22 #else:
|
|
|
23 --single $inputs.input
|
|
|
24 #if str($inputs.input.ext) == 'fa':
|
|
|
25 --seqType fa
|
|
|
26 #else:
|
|
|
27 --seqType fq
|
|
|
28 #end if
|
|
|
29 #if str($inputs.library_type) != "None":
|
|
|
30 --SS_lib_type $inputs.library_type
|
|
|
31 #end if
|
|
|
32 #end if
|
|
|
33
|
|
|
34 ## Additional parameters.
|
|
|
35 #if str($additional_params.use_additional) == "yes":
|
|
|
36 --min_kmer_cov $additional_params.min_kmer_cov --max_reads_per_graph $additional_params.max_reads_per_graph --bflyHeapSpaceMax $additional_params.bflyHeapSpaceMax
|
|
|
37 #if $additional_params.bfly_opts != 'None':
|
|
|
38 --bfly_opts " $additional_params.bfly_opts "
|
|
|
39 #end if
|
|
|
40 #end if
|
|
|
41
|
|
|
42
|
|
|
43 ## direct to output
|
|
|
44 > $trinity_log 2>&1
|
|
|
45
|
|
|
46 </command>
|
|
|
47 <inputs>
|
|
|
48 <param name="JM" type="select" label="JM" help="Amount of memory to allocate to Jellyfish for Kmer catalog construction">
|
|
|
49 <option value="1G">1G</option>
|
|
|
50 <option value="10G">10G</option>
|
|
|
51 <option value="50G">50G</option>
|
|
|
52 <option value="100G">100G</option>
|
|
|
53 <option value="200G">200G</option>
|
|
|
54 <option value="500G">500G</option>
|
|
|
55 </param>
|
|
|
56
|
|
|
57 <param name="CPU" type="integer" value="2" min="1" label="CPU" help="Number of CPUs to use by Trinity" />
|
|
|
58
|
|
|
59
|
|
|
60 <conditional name="inputs">
|
|
|
61 <param name="paired_or_single" type="select" label="Paired or Single-end data?">
|
|
|
62 <option value="paired">Paired</option>
|
|
|
63 <option value="single">Single</option>
|
|
|
64 </param>
|
|
|
65 <when value="paired">
|
|
|
66 <param format="fasta,fastq" name="left_input" type="data" label="Left/Forward strand reads" help=""/>
|
|
|
67 <param format="fasta,fastq" name="right_input" type="data" label="Right/Reverse strand reads" help=""/>
|
|
|
68 <param name="library_type" type="select" label="Strand-specific Library Type">
|
|
|
69 <option value="None">None</option>
|
|
|
70 <option value="FR">FR</option>
|
|
|
71 <option value="RF">RF</option>
|
|
|
72 </param>
|
|
|
73 <param name="group_pairs_distance" type="integer" value="500" min="1" label="Group pairs distance" help="Maximum length expected between fragment pairs"/>
|
|
|
74 <param name="path_reinforcement_distance" type="integer" value="75" min="1" label="Path reinforcement distance" help="Minimum read overlap required for path extension in the graph" />
|
|
|
75
|
|
|
76 </when>
|
|
|
77 <when value="single">
|
|
|
78 <param format="fasta,fastq" name="input" type="data" label="Single-end reads" help=""/>
|
|
|
79 <param name="library_type" type="select" label="Strand-specific Library Type">
|
|
|
80 <option value="None">None</option>
|
|
|
81 <option value="F">F</option>
|
|
|
82 <option value="R">R</option>
|
|
|
83 </param>
|
|
|
84 <param name="path_reinforcement_distance" type="integer" value="40" min="1" label="Path reinforcement distance" help="Minimum read overlap required for path extension in the graph" />
|
|
|
85 </when>
|
|
|
86 </conditional>
|
|
|
87
|
|
|
88 <conditional name="additional_params">
|
|
|
89 <param name="use_additional" type="select" label="Use Additional Params?">
|
|
|
90 <option value="no">No</option>
|
|
|
91 <option value="yes">Yes</option>
|
|
|
92 </param>
|
|
|
93 <when value="no">
|
|
|
94 </when>
|
|
|
95 <when value="yes">
|
|
|
96 <param name="min_kmer_cov" type="integer" value="1" min="1" label="inchworm_min_kmer_cov" help="Minimum kmer coverage required by Inchworm for initial contig construction" />
|
|
|
97 <param name="max_reads_per_graph" type="integer" value="20000000" min="10000" label="chrysalis_max_reads_per_graph" help="Maximum number of reads to be anchored within each transcript graph by Chrysalis" />
|
|
|
98 <param name="bfly_opts" type="text" value="None" label="bfly_opts" help="Options to pass on to Butterfly" />
|
|
|
99 <param name="bflyHeapSpaceMax" type="select" label="bflyHeapSpaceMax" help="Java heap space maximum value for Butterfly">
|
|
|
100 <option value="1G">1G</option>
|
|
|
101 <option value="2G">2G</option>
|
|
|
102 <option value="4G" selected="true">4G</option>
|
|
|
103 <option value="10G">10G</option>
|
|
|
104 <option value="20G">20G</option>
|
|
|
105 </param>
|
|
|
106 <param name="min_contig_length" type="integer" value="200" min="1" label="Minimum Contig Length" help=""/>
|
|
|
107 </when>
|
|
|
108 </conditional>
|
|
|
109 </inputs>
|
|
|
110 <stdio>
|
|
|
111 <exit_code range="1:" level="fatal" description="Faiiled" />
|
|
|
112 </stdio>
|
|
|
113 <outputs>
|
|
|
114 <data format="txt" name="trinity_log" label="${tool.name} on ${on_string}: log" />
|
|
|
115 <data format="fasta" name="assembled_transcripts" label="${tool.name} on ${on_string}: Assembled Transcripts" from_work_dir="trinity_out_dir/Trinity.fasta"/>
|
|
|
116 </outputs>
|
|
|
117 <tests>
|
|
|
118
|
|
|
119 <test>
|
|
|
120 <param name="JM" value="1G"/>
|
|
|
121 <param name="CPU" value="1"/>
|
|
|
122 <param name="paired_or_single" value="single"/>
|
|
|
123 <param name="input" ftype="fastq" value="reads.left.fq"/>
|
|
|
124 <param name="library_type" value="None"/>
|
|
|
125 <param name="path_reinforcement_distance" value="40"/>
|
|
|
126 <param name="use_additional" value="no"/>
|
|
|
127 <output name="trinity_log">
|
|
|
128 <assert_contents>
|
|
|
129 <!-- sequence merged from multiple reads -->
|
|
|
130 <has_text text="Butterfly assemblies are written to" />
|
|
|
131 </assert_contents>
|
|
|
132 </output>
|
|
|
133 <output name="assembled_transcripts">
|
|
|
134 <assert_contents>
|
|
|
135 <!-- sequence merged from multiple reads -->
|
|
|
136 <has_text text="CCATGAGGGGGGGGGGCAATGG" />
|
|
|
137 </assert_contents>
|
|
|
138 </output>
|
|
|
139 </test>
|
|
|
140
|
|
|
141 <test>
|
|
|
142 <param name="JM" value="1G"/>
|
|
|
143 <param name="CPU" value="1"/>
|
|
|
144 <param name="paired_or_single" value="paired"/>
|
|
|
145 <param name="left_input" ftype="fastq" value="reads.left.fq"/>
|
|
|
146 <param name="right_input" ftype="fastq" value="reads.right.fq"/>
|
|
|
147 <param name="library_type" value="None"/>
|
|
|
148 <param name="group_pairs_distance" value="500"/>
|
|
|
149 <param name="path_reinforcement_distance" value="75"/>
|
|
|
150 <param name="use_additional" value="no"/>
|
|
|
151 <output name="trinity_log">
|
|
|
152 <assert_contents>
|
|
|
153 <!-- sequence merged from multiple reads -->
|
|
|
154 <has_text text="Butterfly assemblies are written to" />
|
|
|
155 </assert_contents>
|
|
|
156 </output>
|
|
|
157 <output name="assembled_transcripts">
|
|
|
158 <assert_contents>
|
|
|
159 <!-- sequence merged from multiple reads -->
|
|
|
160 <has_text text="AAGCTGGCCTCAAATTCCTGATCC" />
|
|
|
161 </assert_contents>
|
|
|
162 </output>
|
|
|
163 </test>
|
|
|
164 </tests>
|
|
|
165 <help>
|
|
|
166 Trinity is a de novo transcript assembler that uses RNA-seq data as input. This tool runs all Trinity_ commands--Inchworm, Chrysalis, and Butterfly--in a single pass.
|
|
|
167
|
|
|
168 .. _Trinity: http://trinityrnaseq.sourceforge.net
|
|
|
169 </help>
|
|
|
170 </tool>
|
