# HG changeset patch
# User jjohnson
# Date 1349459509 14400
# Node ID 10e3476429b59daf85d82f6cc117c40fee97bcef
Uploaded
diff -r 000000000000 -r 10e3476429b5 README
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/README Fri Oct 05 13:51:49 2012 -0400
@@ -0,0 +1,71 @@
+GMAP applications and citation info are available from: http://research-pub.gene.com/gmap/
+
+
+ Installation instructions are in the README file in the download,
+ and online: http://research-pub.gene.com/gmap/src/README
+
+ These tools were consistent with gmap version: 2011-11-30
+
+
+GMAP and GSNAP use added datatypes:
+
+ add datatype definition file: lib/galaxy/datatypes/gmap.py
+
+ add the following import line to: lib/galaxy/datatypes/registry.py
+ import gmap # added for gmap tools
+
+ add to datatypes_conf.xml
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+Tools:
+ GMAP_Build - create a GmapDB set of index files for a reference sequence and optional set of annotations
+ GMAP - map sequences to a reference sequence GmapDB index
+ GSNAP - align sequences to a reference and detect splicing
+
+ Add to tool_conf.xml ( probably in the "NGS: Mapping" section )
+
+
+
+
+
+
+Admin built cached gmapdb indexes defined in tool-data/gmap_indices.loc
+
+
+TODO:
+
+
+ Add classes to gmap.py
+ CmetIndex - an index created by cmetindex
+ AtoiIndex - an index created by atoiindex
+
+ Add tally creation
+ gsnap default output -> gsnap_tally -> iit_store
+
+ Add goby support
+ Should add separate tools and datatypes for goby
+ GSNAP goby output relies on goby input, might be better to have a separate gsnap tool for goby
+
+ Possibly add Tools:
+ get_genome - retrieves from a gmapdb
+ cmetindex - create methylcytosine index
+ atoiindex - create A-to-I RNA editing index
+
+
+
+
+
diff -r 000000000000 -r 10e3476429b5 gmap.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/gmap.xml Fri Oct 05 13:51:49 2012 -0400
@@ -0,0 +1,482 @@
+
+ Genomic Mapping and Alignment Program for mRNA and EST sequences
+
+ gmap
+
+ gmap --version
+
+ #import os,os.path
+ gmap
+ --nthreads=4 --ordered
+ #if $refGenomeSource.genomeSource == "history":
+ --gseg=$refGenomeSource.ownFile
+ #elif $refGenomeSource.genomeSource == "gmapdb":
+ #set $gmapdb = $os.listdir($refGenomeSource.gmapdb.extra_files_path)[0]
+ --dir=$refGenomeSource.gmapdb.extra_files_path --db=$gmapdb
+ #if $refGenomeSource.kmer != None and len($refGenomeSource.kmer.__str__) == 2:
+ --kmer=$refGenomeSource.kmer
+ #end if
+ #else:
+ --dir=$os.path.dirname($refGenomeSource.gmapindex.value) --db=$os.path.basename($refGenomeSource.gmapindex.value)
+ #if $refGenomeSource.kmer != None and len($refGenomeSource.kmer.__str__) == 2:
+ --kmer=$refGenomeSource.kmer
+ #end if
+ #end if
+ #if $result.format == "summary":
+ --summary
+ #elif $result.format == "align":
+ --align
+ #elif $result.format == "continuous":
+ --continuous
+ #elif $result.format == "continuous-by-exon":
+ --continuous-by-exon
+ #elif $result.format == "compress":
+ --compress
+ #elif $result.format == "exons_dna":
+ --exons=cdna
+ #elif $result.format == "exons_gen":
+ --exons=genomic
+ #elif $result.format == "protein_dna":
+ --protein_dna
+ #elif $result.format == "protein_gen":
+ --protein_gen
+ #elif $result.format == "sam":
+ --format=$result.sam_paired_read
+ $result.no_sam_headers
+ #* Removed in gmap version 2011-11-30
+ #if len($result.noncanonical_splices.__str__) > 0
+ --noncanonical-splices=$result.noncanonical_splices
+ #end if
+ *#
+ #if len($result.read_group_id.__str__) > 0
+ --read-group-id=$result.read_group_id
+ #end if
+ #if len($result.read_group_name.__str__) > 0
+ --read-group-name=$result.read_group_name
+ #end if
+ #if len($result.read_group_library.__str__) > 0
+ --read-group-library=$result.read_group_library
+ #end if
+ #if len($result.read_group_platform.__str__) > 0
+ --read-group-platform=$result.read_group_platform
+ #end if
+ #elif $result.format != "gmap":
+ --format=$result.format
+ #end if
+ #if $computation.options == "advanced":
+ $computation.nosplicing
+ $computation.cross_species
+ #if len($computation.min_intronlength.__str__) > 0
+ --min-intronlength=$computation.min_intronlength
+ #end if
+ #if len($computation.intronlength.__str__) > 0
+ --intronlength=$computation.intronlength
+ #end if
+ #if len($computation.localsplicedist.__str__) > 0
+ --localsplicedist=$computation.localsplicedist
+ #end if
+ #if len($computation.totallength.__str__) > 0
+ --totallength=$computation.totallength
+ #end if
+ #if len($computation.trimendexons.__str__) > 0
+ --trimendexons=$computation.trimendexons
+ #end if
+ --direction=$computation.direction
+ --canonical-mode=$computation.canonical
+ --prunelevel=$computation.prunelevel
+ --allow-close-indels=$computation.allow_close_indels
+ #if len($computation.microexon_spliceprob.__str__) >= 0:
+ --microexon-spliceprob=$computation.microexon_spliceprob
+ #end if
+ #if len($computation.chimera_margin.__str__) >= 0:
+ --chimera-margin=$computation.chimera_margin
+ #end if
+ #end if
+ #if $advanced.options == "used":
+ #if len($advanced.npaths.__str__) > 0:
+ --npaths=$advanced.npaths
+ #end if
+ #if len($advanced.suboptimal_score.__str__) > 0:
+ --suboptimal-score=$advanced.suboptimal_score
+ #end if
+ #if len($advanced.chimera_overlap.__str__) > 0:
+ --chimera_overlap=$advanced.chimera_overlap
+ #end if
+ $advanced.protein
+ $advanced.tolerant
+ $advanced.nolengths
+ $advanced.invertmode
+ #if len($advanced.introngap.__str__) > 0:
+ --introngap=$advanced.introngap
+ #end if
+ #if len($advanced.wraplength.__str__) > 0:
+ --wraplength=$advanced.wraplength
+ #end if
+ #end if
+ #if $split_output == True
+ $split_output
+ #end if
+ #if len($quality_protocol.__str__) > 0:
+ --quality-protocol=$quality_protocol
+ #end if
+ $input
+ #for $i in $inputs:
+ ${i.added_input}
+ #end for
+ #if $split_output == True
+ 2> $gmap_stderr
+ #else
+ 2> $gmap_stderr > $output
+ #end if
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ (split_output == False)
+
+
+
+
+
+
+
+
+
+
+
+
+ (split_output == True)
+
+
+
+
+
+
+
+
+
+
+
+
+ (split_output == True)
+
+
+
+
+
+
+
+
+
+
+
+
+ (split_output == True)
+
+
+
+
+
+
+
+
+
+
+
+
+ (split_output == True)
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+**What it does**
+
+GMAP_ (Genomic Mapping and Alignment Program) The functionality provided by gmap allows a user to: (1) map and align a single cDNA interactively against a large genome in about a second, without the startup time of several minutes typically needed by existing mapping programs; (2) switch arbitrarily among different genomes, without the need for a preloaded server dedicated to each genome; (3) run the program on computers with as little as 128 MB of RAM (random access memory); (4) perform high-throughput batch processing of cDNAs by using memory mapping and multithreading when appropriate memory and hardware are available; (5) generate accurate gene models, even in the presence of substantial polymorphisms and sequence errors; (6) locate splice sites accurately without the use of probabilistic splice site models, allowing generalized use of the program across species; (7) detect statistically significant microexons and incorporate them into the alignment; and (8) handle mapping and alignment tasks on genomes having alternate assemblies, linkage groups or strains. It is developed by Thomas D. Wu of Genentech, Inc.
+
+Publication_ citation: Thomas D. Wu, Colin K. Watanabe Bioinformatics 2005 21(9):1859-1875; doi:10.1093/bioinformatics/bti310
+
+.. _GMAP: http://research-pub.gene.com/gmap/
+.. _Publication: http://bioinformatics.oxfordjournals.org/cgi/content/full/21/9/1859
+
+------
+
+**Know what you are doing**
+
+.. class:: warningmark
+
+You will want to read the README_
+
+.. _README: http://research-pub.gene.com/gmap/src/README
+
+
+
+
diff -r 000000000000 -r 10e3476429b5 gmap_build.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/gmap_build.xml Fri Oct 05 13:51:49 2012 -0400
@@ -0,0 +1,174 @@
+
+ a database genome index for GMAP and GSNAP
+
+ gmap_build
+
+ gmap --version
+ /bin/bash $shscript 2>1 1> $output
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+#!/bin/bash
+#set $ds = chr(36)
+#set $gt = chr(62)
+#set $lt = chr(60)
+#set $ad = chr(38)
+## #set $ref_files = ''
+## #for $i in $inputs:
+ ## #set $ref_files = $ref_files $i.input
+## #end for
+## echo $ref_files
+#import os.path
+#set $gmapdb = $output.extra_files_path
+#set $mapsdir = $os.path.join($os.path.join($gmapdb,str($refname)), str($refname) + '.maps')
+mkdir -p $gmapdb
+## export GMAPDB required for cmetindex and atoiindex
+export GMAPDB=$gmapdb
+#for $k in $kmer.__str__.split(','):
+gmap_build -D $gmapdb -d $refname -s numeric-alpha -k $k #for i in $inputs# ${i.input}#end for#
+#end for
+get-genome -D $gmapdb -d '?' | sed 's/^Available .*/gmap db: /'
+echo "kmers: " $kmer
+#if $splicesite.splice_source == 'refGeneTable':
+#if $splicesite.refGenes.__str__ != 'None':
+cat $splicesite.refGenes | psl_splicesites -s $splicesite.col_skip | iit_store -o $os.path.join($mapsdir,'splicesites')
+cat $splicesite.refGenes | psl_introns -s $splicesite.col_skip | iit_store -o $os.path.join($mapsdir,'introns')
+#end if
+#elif $splicesite.splice_source == 'gtf':
+#if $splicesite.gtfGenes.__str__ != 'None':
+cat $splicesite.gtfGenes | gtf_splicesites | iit_store -o $os.path.join($mapsdir,'splicesites')
+cat $splicesite.gtfGenes | gtf_introns | iit_store -o $os.path.join($mapsdir,'introns')
+#end if
+#elif $splicesite.splice_source == 'gff3':
+#if $splicesite.gff3Genes.__str__ != 'None':
+cat $splicesite.gff3Genes | gff3_splicesites | iit_store -o $os.path.join($mapsdir,'splicesites')
+cat $splicesite.gff3Genes | gff3_introns | iit_store -o $os.path.join($mapsdir,'introns')
+#end if
+#end if
+#if $dbsnp.snp_source != 'none' and $dbsnp.snps.__str__ != 'None':
+#if $dbsnp.snp_source == 'snpTable':
+#if $dbsnp.snpsex.__str__ != 'None':
+cat $dbsnp.snps | dbsnp_iit -w $dbsnp.weight -e $dbsnp.snpsex | iit_store -o $os.path.join($mapsdir,'snps')
+#else:
+cat $dbsnp.snps | dbsnp_iit -w $dbsnp.weight | iit_store -o $os.path.join($mapsdir,'snps')
+#end if
+#else:
+cat $dbsnp.snps | iit_store -o $os.path.join($mapsdir,'snps')
+#end if
+snpindex -d $refname -v snps
+echo "snpindex" -d $refname -v snps
+#end if
+#if $cmetindex.__str__ == 'yes':
+cmetindex -d $refname
+echo "cmetindex" -d $refname
+#end if
+#if $atoiindex.__str__ == 'yes':
+atoiindex -d $refname
+echo "atoiindex" -d $refname
+#end if
+get-genome -D $gmapdb -d $refname -m '?' | sed 's/^Available maps .*/maps: /'
+
+
+
+
+
+
+
+
+
+**GMAP Build**
+
+GMAP Build creates an index of a genomic sequence for mapping and alignment using GMAP_ (Genomic Mapping and Alignment Program for mRNA and EST sequences) and GSNAP_ (Genomic Short-read Nucleotide Alignment Program). (GMAP Build uses GMSP commands: gmap_build, iit_store, psl_splicesites, psl_introns, gtf_splicesites, gtf_introns, gff3_splicesites, gff3_introns, dbsnp_iit, snpindex, cmetindex, and atoiindex.)
+
+You will want to read the README_
+
+Publication_ citation: Thomas D. Wu, Colin K. Watanabe Bioinformatics 2005 21(9):1859-1875; doi:10.1093/bioinformatics/bti310
+
+.. _GMAP: http://research-pub.gene.com/gmap/
+.. _GSNAP: http://research-pub.gene.com/gmap/
+.. _README: http://research-pub.gene.com/gmap/src/README
+.. _Publication: http://bioinformatics.oxfordjournals.org/cgi/content/full/21/9/1859
+
+
+
+
+
diff -r 000000000000 -r 10e3476429b5 gsnap.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/gsnap.xml Fri Oct 05 13:51:49 2012 -0400
@@ -0,0 +1,864 @@
+
+ Genomic Short-read Nucleotide Alignment Program
+
+ gsnap
+
+ gsnap --version
+
+ #import os.path, re
+ gsnap
+ --nthreads="4" --ordered
+ #if $refGenomeSource.genomeSource == "gmapdb":
+ #set $gmapdb = $os.listdir($refGenomeSource.gmapdb.extra_files_path)[0]
+ --dir=$refGenomeSource.gmapdb.extra_files_path --db=$refGenomeSource.gmapdb.metadata.db_name
+ #else:
+ --dir=$os.path.dirname($refGenomeSource.gmapindex.value) --db=$os.path.basename($refGenomeSource.gmapindex.value)
+ #end if
+ #if $refGenomeSource.kmer != None and len($refGenomeSource.kmer.__str__) == 2:
+ --kmer=$refGenomeSource.kmer
+ #end if
+ #if $refGenomeSource.use_splicing.src == 'gmapdb':
+ #if $refGenomeSource.use_splicing.splicemap != None and len($refGenomeSource.use_splicing.splicemap.__str__) > 0:
+ -s $refGenomeSource.use_splicing.splicemap.value
+ #if $computation.trim_mismatch_score.__str__ == '0':
+ $ambig_splice_noclip
+ #end if
+ #end if
+ #elif $refGenomeSource.use_splicing.src == 'history':
+ #if $refGenomeSource.use_splicing.splicemap != None and len($refGenomeSource.use_splicing.splicemap.__str__) > 0:
+ -S $os.path.dirname($refGenomeSource.use_splicing.splicemap) -s $os.path.basename($refGenomeSource.use_splicing.splicemap)
+ #if $computation.trim_mismatch_score.__str__ == '0':
+ $ambig_splice_noclip
+ #end if
+ #end if
+ #end if
+ #if $refGenomeSource.use_snps.src == 'gmapdb':
+ #if $refGenomeSource.use_snps.snpindex != None and len($refGenomeSource.use_snps.snpindex.__str__) > 0:
+ -v $refGenomeSource.use_snps.snpindex.value
+ #end if
+ #elif $refGenomeSource.use_snps.src == 'history':
+ #if $refGenomeSource.use_snps.snpindex != None and len($refGenomeSource.use_snps.snpindex.__str__) > 0:
+ -V $refGenomeSource.use_snps.snpindex.extra_files_path -v $refGenomeSource.use_snps.snpindex.metadata.snps_name
+ #end if
+ #end if
+ #if $refGenomeSource.mode.__str__ != '':
+ --mode=$refGenomeSource.mode
+ #end if
+ #* ## No longer in options as of version 2011-11-30
+ #if $mapq_unique_score.__str__ != '':
+ --mapq-unique-score=$mapq_unique_score
+ #end if
+ *#
+ #if $computation.options == "advanced":
+ #if $computation.max_mismatches.__str__ != '':
+ --max-mismatches=$computation.max_mismatches
+ #end if
+ $computation.query_unk_mismatch
+ $computation.genome_unk_mismatch
+ #if $computation.terminal_threshold.__str__ != '':
+ --terminal-threshold=$computation.terminal_threshold
+ #end if
+ #if $computation.indel_penalty.__str__ != '':
+ --indel-penalty=$computation.indel_penalty
+ #end if
+ #if $computation.indel_endlength.__str__ != '':
+ --indel-endlength=$computation.indel_endlength
+ #end if
+ #if $computation.max_middle_insertions.__str__ != '':
+ --max-middle-insertions=$computation.max_middle_insertions
+ #end if
+ #if $computation.max_middle_deletions.__str__ != '':
+ --max-middle-deletions=$computation.max_middle_deletions
+ #end if
+ #if $computation.max_end_insertions.__str__ != '':
+ --max-end-insertions=$computation.max_end_insertions
+ #end if
+ #if $computation.max_end_deletions.__str__ != '':
+ --max-end-deletions=$computation.max_end_deletions
+ #end if
+ #if $computation.suboptimal_levels.__str__ != '':
+ --suboptimal-levels=$computation.suboptimal_levels
+ #end if
+ #if $computation.adapter_strip.__str__ != '':
+ --adapter-strip=$computation.adapter_strip
+ #end if
+ #if $computation.trim_mismatch_score.__str__ != '':
+ --trim-mismatch-score=$computation.trim_mismatch_score
+ #end if
+ #if $computation.trim_indel_score.__str__ != '':
+ --trim-indel-score=$computation.trim_indel_score
+ #end if
+ ## TODO - do we need these options (Is it tally XOR runlength?):
+ ## --tallydir= --use-tally=tally
+ ## --runlengthdir --use-runlength=runlength
+ #if $computation.use_tally != None and len($computation.use_tally.__str__) > 0:
+ ##--tallydir $os.path.dirname($computation.use_tally) --use-tally $os.path.basename($computation.use_tally)
+ --use-tally=$computation.use_tally
+ #end if
+ ## gmap options
+ #if $computation.gmap_mode.__str__ != '' and $computation.gmap_mode.__str__ != 'None':
+ --gmap-mode='$computation.gmap_mode'
+ #end if
+ #if $computation.trigger_score_for_gmap.__str__ != '':
+ --trigger-score-for-gmap=$computation.trigger_score_for_gmap
+ #end if
+ #if $computation.max_gmap_pairsearch.__str__ != '' and $re.search("pairsearch",$computation.gmap_mode):
+ --max-gmap-pairsearch=$computation.max_gmap_pairsearch
+ #end if
+ #if $computation.max_gmap_terminal.__str__ != '' and $re.search("terminal",$computation.gmap_mode):
+ --max-gmap-terminal=$computation.max_gmap_terminal
+ #end if
+ #if $computation.max_gmap_improvement.__str__ != '' and $re.search("improv",$computation.gmap_mode):
+ --max-gmap-improvement=$computation.max_gmap_improvement
+ #end if
+ #if $computation.microexon_spliceprob.__str__ != '':
+ --microexon-spliceprob=$computation.microexon_spliceprob
+ #end if
+ #end if
+ #if $splicing.options == "advanced":
+ $splicing.novelsplicing
+ #if $splicing.localsplicedist.__str__ != '':
+ --localsplicedist=$splicing.localsplicedist
+ #end if
+ #if $splicing.local_splice_penalty.__str__ != '':
+ --local-splice-penalty=$splicing.local_splice_penalty
+ #end if
+ #if $splicing.distant_splice_penalty.__str__ != '':
+ --distant-splice-penalty=$splicing.distant_splice_penalty
+ #end if
+ #if $splicing.local_splice_endlength.__str__ != '':
+ --local-splice-endlength=$splicing.local_splice_endlength
+ #end if
+ #if $splicing.distant_splice_endlength.__str__ != '':
+ --distant-splice-endlength=$splicing.distant_splice_endlength
+ #end if
+ #if $splicing.distant_splice_identity.__str__ != '':
+ --distant-splice-identity=$splicing.distant_splice_identity
+ #end if
+ #end if
+ #if $output.options == "advanced":
+ #if $output.npath.__str__ != '':
+ --npath=$output.npath
+ #end if
+ $output.quiet_if_excessive
+ $output.show_refdiff
+ $output.clip_overlap
+ #end if
+ #if $result.format == "sam":
+ --format=sam
+ $result.no_sam_headers
+ #if $result.read_group_id.__str__.strip != '':
+ --read-group-id='$result.read_group_id'
+ #end if
+ #if $result.read_group_name.__str__ != '':
+ --read-group-name='$result.read_group_name'
+ #end if
+ #if $result.read_group_library.__str__ != '':
+ --read-group-library='$result.read_group_library'
+ #end if
+ #if $result.read_group_platform.__str__ != '':
+ --read-group-platform='$result.read_group_platform'
+ #end if
+ #if $result.quality_shift.__str__ != '':
+ --quality-shift=$result.quality_shift
+ #end if
+ #elif $result.format == "goby":
+ #if $result.goby_output.__str__ != '':
+ --goby-output='$result.goby_output'
+ #end if
+ #if $result.creads_window_start.__str__ != '':
+ --creads-window-start=$result.creads_window_start
+ #end if
+ #if $result.creads_window_end.__str__ != '':
+ --creads-window-end=$result.creads_window_end
+ #end if
+ $result.creads_complement
+ #end if
+ #if $results.split_output == 'yes':
+ --split-output=gsnap_out
+ #if $results.fails.choice == 'nofails':
+ --nofails
+ #elif $results.fails.choice == 'failsonly':
+ --failsonly
+ #end if
+ $results.fails_as_input
+ #else
+ #if $results.fails.choice == 'nofails':
+ --nofails
+ #elif $results.fails.choice == 'failsonly':
+ --failsonly
+ $results.fails.fails_as_input
+ #end if
+ #end if
+ #if $seq.format == "gsnap_fasta":
+ $seq.circularinput $seq.gsnap
+ #else if $seq.format == "fastq":
+ #if $seq.barcode_length.__str__ != '':
+ --barcode-length=$seq.barcode_length
+ #end if
+ #if $seq.fastq_id_start.__str__ != '':
+ --fastq-id-start=$seq.fastq_id_start
+ #end if
+ #if $seq.fastq_id_end.__str__ != '':
+ --fastq-id-end=$seq.fastq_id_end
+ #end if
+ #if $seq.filter_chastity.__str__ != 'off':
+ --filter-chastity=$seq.filter_chastity
+ #end if
+ #if $seq.paired.ispaired.__str__ == 'yes':
+ #if $seq.paired.pairmax_dna.__str__ != '':
+ --pairmax-dna=$seq.paired.pairmax_dna
+ #end if
+ #if $seq.paired.pairmax_rna.__str__ != '':
+ --pairmax-rna=$seq.paired.pairmax_rna
+ #end if
+ #if $seq.paired.pairexpect.__str__ != '':
+ --pairexpect=$seq.paired.pairexpect
+ #end if
+ #if $seq.paired.pairdev.__str__ != '':
+ --pairdev=$seq.paired.pairdev
+ #end if
+ $seq.fastq $seq.paired.fastq
+ #else
+ $seq.fastq
+ #end if
+ #end if
+ #if $results.split_output == 'yes':
+ 2> $gsnap_stderr
+ #else:
+ #if $results.fails.choice.__str__ == 'failsonly' and $results.fails.fails_as_input.__str__ != '':
+ 2> $gsnap_stderr > $gsnap_fq
+ #else
+ 2> $gsnap_stderr > $gsnap_out
+ #end if
+ #end if
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ (results['split_output'] == 'no' and (results['fails']['choice'] != 'failsonly' or results['fails']['fails_as_input'] == False))
+
+
+
+
+
+
+
+ (results['split_output'] == 'no' and results['fails']['choice'] == 'failsonly' and results['fails']['fails_as_input'] == True)
+
+
+
+
+
+ (results['split_output'] == 'yes')
+
+
+
+
+
+
+ (results['split_output'] == 'yes')
+
+
+
+
+
+
+ (results['split_output'] == 'yes')
+
+
+
+
+
+
+ (results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)
+
+
+
+
+
+
+ (results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)
+
+
+
+
+
+
+ (results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)
+
+
+
+
+
+
+ (results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)
+
+
+
+
+
+
+ (results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)
+
+
+
+
+
+
+ (results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)
+
+
+
+
+
+
+
+ (results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)
+
+
+
+
+
+
+ (results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)
+
+
+
+
+
+
+ (results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)
+
+
+
+
+
+
+
+ (results['split_output'] == 'yes' and results['fails_as_input'] == False)
+
+
+
+
+
+
+
+ (results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == False)
+
+
+
+ (results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)
+
+
+
+ (results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)
+
+
+
+
+
+
+
+
+
+
+**What it does**
+
+GSNAP_ (Genomic Short-read Nucleotide Alignment Program) is a short read aligner which can align both single- and paired-end reads as short as 14nt and of arbitrarily long length. It can detect short- and long-distance splicing, including interchromosomal splicing, in individual reads, using probabilistic models or a database of known splice sites. Our program also permits SNP-tolerant alignment to a reference space of all possible combinations of major and minor alleles, and can align reads from bisulfite-treated DNA for the study of methylation state. It is developed by Thomas D. Wu of Genentech, Inc.
+Publication_ citation: Thomas D. Wu, Serban Nacu "Fast and SNP-tolerant detection of complex variants and splicing in short reads. Bioinformatics. 2010 Apr 1;26(7):873-81. Epub 2010 Feb 10.
+
+.. _GSNAP: http://research-pub.gene.com/gmap/
+.. _Publication: http://bioinformatics.oupjournals.org/cgi/content/full/26/7/873
+http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2844994/?tool=pubmed
+
+------
+
+**Know what you are doing**
+
+.. class:: warningmark
+
+You will want to read the README_
+
+.. _README: http://research-pub.gene.com/gmap/src/README
+
+------
+
+**Input formats**
+
+Input to GSNAP should be either in FASTQ or FASTA format.
+
+The FASTQ input may include quality scores, which will then be included in SAM
+output, if that output format is selected.
+
+For FASTA format, you should include one line per read (or end of a
+paired-end read). The same FASTA file can have a mixture of
+single-end and paired-end reads of varying lengths, if desired.
+
+Single-end reads:
+
+Each FASTA entry should contain one short read per line, like this
+
+>Header information
+AAAACATTCTCCTCCGCATAAGCCTGCGTCAGATTA
+
+Each short read can have a different length. However, the entire read
+needs to be on a single line, and may not wrap around multiple lines.
+If it extends to a second line, GSNAP will think that the read is
+paired-end.
+
+
+Paired-end reads:
+
+Each FASTA entry should contain two short reads, one per line, like
+this
+
+>Header information
+AAAACATTCTCCTCCGCATAAGCCTAGTAGATTA
+GGCGTAGGTAGAAGTAGAGGTTAAGGCGCGTCAG
+
+By default, the program assumes that the second end is in the reverse
+complement direction compared with the first end. If they are in the
+same direction, you may need to use the --circular-input (or -c) flag.
+
+( The Galaxy tool: "FASTA Width formatter" can be used to reformat fasta files to have single line sequences. )
+
+------
+
+**Output formats in GSNAP**
+
+SAM output format
+
+Default GSNAP format
+ See the README_
+
+
+
+
+
+
+
diff -r 000000000000 -r 10e3476429b5 iit_store.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/iit_store.xml Fri Oct 05 13:51:49 2012 -0400
@@ -0,0 +1,181 @@
+
+ Create a map store for known genes or SNPs
+
+ iit_store
+
+ iit_store --version
+ /bin/bash $shscript 2> $log
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ (map['type'] == 'genes' and 'splicesites' in map['maps'])
+
+
+ (map['type'] == 'genes' and 'introns' in map['maps'])
+
+
+ (map['type'] == 'snps')
+
+
+ (map['type'] == 'gmap')
+
+
+
+
+#!/bin/bash
+#set $catcmd = 'gzcat -f'
+#set $catcmd = 'cat'
+#set $ds = chr(36)
+#set $gt = chr(62)
+#set $lt = chr(60)
+#set $ad = chr(38)
+#set $ep = chr(33)
+#set $toerr = ''.join([$gt,$ad,'2'])
+#import os.path
+#if $map.type == 'genes':
+if [ $ep -e $map.src.genes ]; then echo "$map.src.genes does not exist" $toerr; exit 1; fi
+if [ $ep -s $map.src.genes ]; then echo "$map.src.genes is empty" $toerr; exit 2; fi
+ #if $map.src.src_format == 'refGeneTable':
+ #if 'splicesites' in [ $map.maps.__str__ ]:
+ $catcmd $map.src.genes | psl_splicesites -s $map.src.col_skip | iit_store -o $splicesites_iit
+ #end if
+ #if 'introns' in [ $map.maps.__str__ ]:
+ $catcmd $map.src.genes | psl_introns -s $map.src.col_skip | iit_store -o $introns_iit
+ #end if
+ #elif $map.src.src_format == 'gtf':
+ #if 'splicesites' in [ $map.maps.__str__ ]:
+ $catcmd $map.src.genes | gtf_splicesites | iit_store -o $splicesites_iit
+ #end if
+ #if 'introns' in [ $map.maps.__str__ ]:
+ $catcmd $map.src.genes | gtf_introns | iit_store -o $introns_iit
+ #end if
+ #elif $map.src.src_format == 'gff3':
+ #if 'splicesites' in [ $map.maps.__str__ ]:
+ $catcmd $map.src.genes | gff3_splicesites | iit_store -o $splicesites_iit
+ #end if
+ #if 'introns' in [ $map.maps.__str__ ]:
+ $catcmd $map.src.genes | gff3_introns | iit_store -o $introns_iit
+ #end if
+ #end if
+#elif $map.type == 'snps':
+if [ $ep -s $map.src.snps ]; then echo "$map.src.snps is empty" $toerr; exit 2; fi
+ #if $map.src.snpsex.__str__ != 'None':
+ $catcmd $map.src.snps | dbsnp_iit -w $map.src.weight -e $map.src.snpsex | iit_store -o $snps_iit
+ #else:
+ $catcmd $map.src.snps | dbsnp_iit -w $map.src.weight | iit_store -o $snps_iit
+ #end if
+#else:
+ $catcmd $map.src.snps | iit_store -o $map_iit
+#end if
+
+
+
+
+
+
+
+
+
+**iit_store**
+
+GMAP IIT creates an Interval Index Tree map of known splice sites, introns, or SNPs (it uses iit_store described in the GMAP documentation). The maps can be used in GMAP_ (Genomic Mapping and Alignment Program for mRNA and EST sequences) and GSNAP_ (Genomic Short-read Nucleotide Alignment Program). Maps are typically used for known splice sites, introns, or SNPs.
+
+You will want to read the README_
+
+Publication_ citation: Thomas D. Wu, Colin K. Watanabe Bioinformatics 2005 21(9):1859-1875; doi:10.1093/bioinformatics/bti310
+
+.. _GMAP: http://research-pub.gene.com/gmap/
+.. _GSNAP: http://research-pub.gene.com/gmap/
+.. _README: http://research-pub.gene.com/gmap/src/README
+.. _Publication: http://bioinformatics.oxfordjournals.org/cgi/content/full/21/9/1859
+
+
+**inputs**
+
+
+
+
diff -r 000000000000 -r 10e3476429b5 lib/galaxy/datatypes/gmap.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/lib/galaxy/datatypes/gmap.py Fri Oct 05 13:51:49 2012 -0400
@@ -0,0 +1,472 @@
+"""
+GMAP indexes
+"""
+import logging
+import os,os.path,re
+import galaxy.datatypes.data
+from galaxy.datatypes.data import Text
+from galaxy import util
+from galaxy.datatypes.metadata import MetadataElement
+
+log = logging.getLogger(__name__)
+
+class GmapDB( Text ):
+ """
+ A GMAP DB for indexes
+ """
+ MetadataElement( name="db_name", desc="The db name for this index set", default='unknown', set_in_upload=True, readonly=True )
+ MetadataElement( name="basesize", default="12", desc="The basesize for offsetscomp", visible=True, readonly=True )
+ MetadataElement( name="kmers", default=[''], desc="The kmer sizes for indexes", visible=True, no_value=[''], readonly=True )
+ MetadataElement( name="map_dir", desc="The maps directory", default='unknown', set_in_upload=True, readonly=True )
+ MetadataElement( name="maps", default=[''], desc="The names of maps stored for this gmap gmapdb", visible=True, no_value=[''], readonly=True )
+ MetadataElement( name="snps", default=[''], desc="The names of SNP indexes stored for this gmapdb", visible=True, no_value=[''], readonly=True )
+ MetadataElement( name="cmet", default=False, desc="Has a cmet index", visible=True, readonly=True )
+ MetadataElement( name="atoi", default=False, desc="Has a atoi index", visible=True, readonly=True )
+
+ file_ext = 'gmapdb'
+ is_binary = True
+ composite_type = 'auto_primary_file'
+ allow_datatype_change = False
+
+ def generate_primary_file( self, dataset = None ):
+ """
+ This is called only at upload to write the html file
+ cannot rename the datasets here - they come with the default unfortunately
+ """
+ return 'AutoGenerated Primary File for Composite Dataset'
+
+ def regenerate_primary_file(self,dataset):
+ """
+ cannot do this until we are setting metadata
+ """
+ bn = dataset.metadata.db_name
+ log.info( "GmapDB regenerate_primary_file %s" % (bn))
+ rval = ['GMAPDB %s
GMAPDB %s
cmet %s atoi %s
Maps:
' % (bn,bn,dataset.metadata.cmet,dataset.metadata.atoi)]
+ for i,name in enumerate(dataset.metadata.maps):
+ rval.append( '
%s' % name)
+ rval.append( '
' )
+ f = file(dataset.file_name,'w')
+ f.write("\n".join( rval ))
+ f.write('\n')
+ f.close()
+
+ def set_peek( self, dataset, is_multi_byte=False ):
+ log.info( "GmapDB set_peek %s" % (dataset))
+ if not dataset.dataset.purged:
+ dataset.peek = "GMAPDB index %s\n cmet %s\n atoi %s\n maps %s" % ( dataset.metadata.db_name,dataset.metadata.cmet,dataset.metadata.atoi,dataset.metadata.maps )
+ dataset.blurb = "GMAPDB %s" % ( dataset.metadata.db_name )
+ else:
+ dataset.peek = 'file does not exist'
+ dataset.blurb = 'file purged from disk'
+ def display_peek( self, dataset ):
+ try:
+ return dataset.peek
+ except:
+ return "GMAP index file"
+
+ def sniff( self, filename ):
+ return False
+ def set_meta( self, dataset, overwrite = True, **kwd ):
+ """
+ Expecting:
+ extra_files_path//db_name>.ref3
+ extra_files_path/db_name/db_name.ref1[2345]1[2345]3offsetscomp
+ extra_files_path/db_name/db_name.ref1[2345]1[2345]3positions
+ extra_files_path/db_name/db_name.ref1[2345]1[2345]3gammaptrs
+ index maps:
+ extra_files_path/db_name/db_name.maps/*.iit
+ """
+ log.info( "GmapDB set_meta %s %s" % (dataset,dataset.extra_files_path))
+ pat = '(.*)\.((ref)|(met)[atgc][atgc]|(a2i)[atgc][atgc])((\d\d)(\d\d))?3positions(\.(.+))?'
+ efp = dataset.extra_files_path
+ flist = os.listdir(efp)
+ for i,fname in enumerate(flist):
+ log.info( "GmapDB set_meta %s %s" % (i,fname))
+ fpath = os.path.join(efp,fname)
+ if os.path.isdir(fpath):
+ ilist = os.listdir(fpath)
+ kmers = {'':'default'} # HACK '' empty key added so user has default choice when selecting kmer from metadata
+ for j,iname in enumerate(ilist):
+ log.info( "GmapDB set_meta file %s %s" % (j,iname))
+ ipath = os.path.join(fpath,iname)
+ if os.path.isdir(ipath): # find maps
+ dataset.metadata.map_dir = iname
+ for mapfile in os.listdir(ipath):
+ mapname = mapfile.replace('.iit','')
+ log.info( "GmapDB set_meta map %s %s" % (mapname,mapfile))
+ dataset.metadata.maps.append(mapname)
+ else:
+ m = re.match(pat,iname)
+ if m:
+ log.info( "GmapDB set_meta m %s %s " % (iname, m))
+ assert len(m.groups()) == 10
+ dataset.metadata.db_name = fname
+ if m.groups()[2] == 'ref':
+ if m.groups()[-1] != None:
+ dataset.metadata.snps.append(m.groups()[-1])
+ else:
+ if m.groups()[-3] != None:
+ k = int(m.groups()[-3])
+ kmers[k] = k
+ if m.groups()[-4] != None:
+ dataset.metadata.basesize = int( m.groups()[-4])
+ elif m.groups()[3] == 'met':
+ dataset.metadata.cmet = True
+ elif m.groups()[4] == 'a2i':
+ dataset.metadata.atoi = True
+ dataset.metadata.kmers = kmers.keys()
+
+class GmapSnpIndex( Text ):
+ """
+ A GMAP SNP index created by snpindex
+ """
+ MetadataElement( name="db_name", desc="The db name for this index set", default='unknown', set_in_upload=True, readonly=True )
+ MetadataElement( name="snps_name", default='snps', desc="The name of SNP index", visible=True, no_value='', readonly=True )
+
+ file_ext = 'gmapsnpindex'
+ is_binary = True
+ composite_type = 'auto_primary_file'
+ allow_datatype_change = False
+
+ def generate_primary_file( self, dataset = None ):
+ """
+ This is called only at upload to write the html file
+ cannot rename the datasets here - they come with the default unfortunately
+ """
+ return 'AutoGenerated Primary File for Composite Dataset'
+
+ def regenerate_primary_file(self,dataset):
+ """
+ cannot do this until we are setting metadata
+ """
+ bn = dataset.metadata.db_name
+ log.info( "GmapDB regenerate_primary_file %s" % (bn))
+ rval = ['GMAPDB %s
GMAPDB %s
cmet %s atoi %s
Maps:
' % (bn,bn,dataset.metadata.cmet,dataset.metadata.atoi)]
+ for i,name in enumerate(dataset.metadata.maps):
+ rval.append( '
%s' % name)
+ rval.append( '
' )
+ f = file(dataset.file_name,'w')
+ f.write("\n".join( rval ))
+ f.write('\n')
+ f.close()
+ def set_peek( self, dataset, is_multi_byte=False ):
+ log.info( "GmapSnpIndex set_peek %s" % (dataset))
+ if not dataset.dataset.purged:
+ dataset.peek = "GMAP SNPindex %s on %s\n" % ( dataset.metadata.snps_name,dataset.metadata.db_name)
+ dataset.blurb = "GMAP SNPindex %s on %s\n" % ( dataset.metadata.snps_name,dataset.metadata.db_name)
+ else:
+ dataset.peek = 'file does not exist'
+ dataset.blurb = 'file purged from disk'
+ def display_peek( self, dataset ):
+ try:
+ return dataset.peek
+ except:
+ return "GMAP SNP index"
+
+ def sniff( self, filename ):
+ return False
+ def set_meta( self, dataset, overwrite = True, **kwd ):
+ """
+ Expecting:
+ extra_files_path/snp_name.iit
+ extra_files_path/db_name/db_name.ref1[2345]1[2345]3offsetscomp.snp_name
+ extra_files_path/db_name/db_name.ref1[2345]1[2345]3positions.snp_name
+ extra_files_path/db_name/db_name.ref1[2345]1[2345]3gammaptrs.snp_name
+ """
+ log.info( "GmapSnpIndex set_meta %s %s" % (dataset,dataset.extra_files_path))
+ pat = '(.*)\.(ref((\d\d)(\d\d))?3positions)\.(.+)?'
+ efp = dataset.extra_files_path
+ flist = os.listdir(efp)
+ for i,fname in enumerate(flist):
+ m = re.match(pat,fname)
+ if m:
+ assert len(m.groups()) == 6
+ dataset.metadata.db_name = m.groups()[0]
+ dataset.metadata.snps_name = m.groups()[-1]
+
+
+
+
+class IntervalIndexTree( Text ):
+ """
+ A GMAP Interval Index Tree Map
+ created by iit_store
+ (/path/to/map)/(mapname).iit
+ """
+ file_ext = 'iit'
+ is_binary = True
+
+class SpliceSitesIntervalIndexTree( IntervalIndexTree ):
+ """
+ A GMAP Interval Index Tree Map
+ created by iit_store
+ """
+ file_ext = 'splicesites.iit'
+
+class IntronsIntervalIndexTree( IntervalIndexTree ):
+ """
+ A GMAP Interval Index Tree Map
+ created by iit_store
+ """
+ file_ext = 'introns.iit'
+
+class SNPsIntervalIndexTree( IntervalIndexTree ):
+ """
+ A GMAP Interval Index Tree Map
+ created by iit_store
+ """
+ file_ext = 'snps.iit'
+
+class TallyIntervalIndexTree( IntervalIndexTree ):
+ """
+ A GMAP Interval Index Tree Map
+ created by iit_store
+ """
+ file_ext = 'tally.iit'
+
+class IntervalAnnotation( Text ):
+ """
+ Class describing a GMAP Interval format:
+ >label coords optional_tag
+ optional_annotation (which may be zero, one, or multiple lines)
+ The coords should be of the form:
+ chr:position
+ chr:startposition..endposition
+ """
+ file_ext = 'gmap_annotation'
+ """Add metadata elements"""
+ MetadataElement( name="annotations", default=0, desc="Number of interval annotations", readonly=True, optional=True, visible=False, no_value=0 )
+
+ def set_meta( self, dataset, **kwd ):
+ """
+ Set the number of annotations and the number of data lines in dataset.
+ """
+ data_lines = 0
+ annotations = 0
+ for line in file( dataset.file_name ):
+ line = line.strip()
+ if line and line.startswith( '>' ):
+ annotations += 1
+ data_lines +=1
+ else:
+ data_lines += 1
+ dataset.metadata.data_lines = data_lines
+ dataset.metadata.annotations = annotations
+ def set_peek( self, dataset, is_multi_byte=False ):
+ if not dataset.dataset.purged:
+ dataset.peek = data.get_file_peek( dataset.file_name, is_multi_byte=is_multi_byte )
+ if dataset.metadata.annotations:
+ dataset.blurb = "%s annotations" % util.commaify( str( dataset.metadata.annotations ) )
+ else:
+ dataset.blurb = data.nice_size( dataset.get_size() )
+ else:
+ dataset.peek = 'file does not exist'
+ dataset.blurb = 'file purged from disk'
+
+ def sniff( self, filename ):
+ """
+ Determines whether the file is a gmap annotation file
+ Format:
+ >label coords optional_tag
+ optional_annotation (which may be zero, one, or multiple lines)
+ For example, the label may be an EST accession, with the coords
+ representing its genomic position. Labels may be duplicated if
+ necessary.
+ The coords should be of the form
+ chr:position
+ chr:startposition..endposition
+ The term "chr:position" is equivalent to "chr:position..position". If
+ you want to indicate that the interval is on the minus strand or
+ reverse direction, then may be less than .
+ """
+ try:
+ pat = '>(\S+)\s((\S+):(\d+)(\.\.(\d+))?(\s.(.+))?$' #>label chr:position[..endposition][ optional_tag]
+ fh = open( filename )
+ count = 0
+ while True and count < 10:
+ line = fh.readline()
+ if not line:
+ break #EOF
+ line = line.strip()
+ if line: #first non-empty line
+ if line.startswith( '>' ):
+ count += 1
+ if re.match(pat,line) == None: # Failed to match
+ return False
+ finally:
+ fh.close()
+ return False
+
+class SpliceSiteAnnotation(IntervalAnnotation):
+ file_ext = 'gmap_splicesites'
+ """
+ Example:
+ >NM_004448.ERBB2.exon1 17:35110090..35110091 donor 6678
+ >NM_004448.ERBB2.exon2 17:35116768..35116769 acceptor 6678
+ >NM_004448.ERBB2.exon2 17:35116920..35116921 donor 1179
+ >NM_004448.ERBB2.exon3 17:35118099..35118100 acceptor 1179
+ >NM_004449.ERG.exon1 21:38955452..38955451 donor 783
+ >NM_004449.ERG.exon2 21:38878740..38878739 acceptor 783
+ >NM_004449.ERG.exon2 21:38878638..38878637 donor 360
+ >NM_004449.ERG.exon3 21:38869542..38869541 acceptor 360
+ Each line must start with a ">" character, then be followed by an
+ identifier, which may have duplicates and can have any format, with
+ the gene name or exon number shown here only as a suggestion. Then
+ there should be the chromosomal coordinates which straddle the
+ exon-intron boundary, so one coordinate is on the exon and one is on
+ the intron. (Coordinates are all 1-based, so the first character of a
+ chromosome is number 1.) Finally, there should be the splice type:
+ "donor" or "acceptor". You may optionally store the intron distance
+ at the end. GSNAP can use this intron distance, if it is longer than
+ its value for --localsplicedist, to look for long introns at that
+ splice site. The same splice site may have different intron distances
+ in the database; GSNAP will use the longest intron distance reported
+ in searching for long introns.
+ """
+ def sniff( self, filename ): # TODO
+ """
+ Determines whether the file is a gmap splice site annotation file
+ """
+ try:
+ pat = '>(\S+\.intron\d+)\s((\S+):(\d+)\.\.(\d+))\s(donor|acceptor)(\s(\d+))?$' #>label chr:position..position donor|acceptor[ intron_dist]
+ fh = open( filename )
+ count = 0
+ while True and count < 10:
+ line = fh.readline()
+ if not line:
+ break #EOF
+ line = line.strip()
+ if line: #first non-empty line
+ count += 1
+ if re.match(pat,line) == None: # Failed to match
+ return False
+ finally:
+ fh.close()
+ return False
+
+class IntronAnnotation(IntervalAnnotation):
+ file_ext = 'gmap_introns'
+ """
+ Example:
+ >NM_004448.ERBB2.intron1 17:35110090..35116769
+ >NM_004448.ERBB2.intron2 17:35116920..35118100
+ >NM_004449.ERG.intron1 21:38955452..38878739
+ >NM_004449.ERG.intron2 21:38878638..38869541
+ The coordinates are 1-based, and specify the exon coordinates
+ surrounding the intron, with the first coordinate being from the donor
+ exon and the second one being from the acceptor exon.
+ """
+ def sniff( self, filename ): # TODO
+ """
+ Determines whether the file is a gmap Intron annotation file
+ """
+ try:
+ pat = '>(\S+\.intron\d+)\s((\S+):(\d+)\.\.(\d+)(\s(.)+)?$' #>label chr:position
+ fh = open( filename )
+ count = 0
+ while True and count < 10:
+ line = fh.readline()
+ if not line:
+ break #EOF
+ line = line.strip()
+ if line: #first non-empty line
+ count += 1
+ if re.match(pat,line) == None: # Failed to match
+ return False
+ finally:
+ fh.close()
+ return False
+
+class SNPAnnotation(IntervalAnnotation):
+ file_ext = 'gmap_snps'
+ """
+ Example:
+ >rs62211261 21:14379270 CG
+ >rs62211262 21:14379281 AT
+ >rs62211263 21:14379298 WN
+ Each line must start with a ">" character, then be followed by an
+ identifier (which may have duplicates). Then there should be the
+ chromosomal coordinate of the SNP. (Coordinates are all 1-based, so
+ the first character of a chromosome is number 1.) Finally, there
+ should be the two possible alleles. (Previous versions required that
+ these be in alphabetical order: "AC", "AG", "AT", "CG", "CT", or "GT",
+ but that is no longer a requirement.) These alleles must correspond
+ to the possible nucleotides on the plus strand of the genome. If the
+ one of these two letters does not match the allele in the reference
+ sequence, that SNP will be ignored in subsequent processing as a
+ probable error.
+
+ GSNAP also supports the idea of a wildcard SNP. A wildcard SNP allows
+ all nucleotides to match at that position, not just a given reference
+ and alternate allele. It is essentially as if an "N" were recorded at
+ that genomic location, although the index files still keep track of
+ the reference allele. To indicate that a position has a wildcard SNP,
+ you can indicate the genotype as "WN", where "W" is the reference
+ allele. Another indication of a wildcard SNP is to provide two
+ separate lines at that position with the genotypes "WX" and "WY",
+ where "W" is the reference allele and "X" and "Y" are two different
+ alternate alleles.
+ """
+ def sniff( self, filename ):
+ """
+ Determines whether the file is a gmap SNP annotation file
+ """
+ try:
+ pat = '>(\S+)\s((\S+):(\d+)\s([TACGW][TACGN])$' #>label chr:position ATCG
+ fh = open( filename )
+ count = 0
+ while True and count < 10:
+ line = fh.readline()
+ if not line:
+ break #EOF
+ line = line.strip()
+ if line: #first non-empty line
+ count += 1
+ if re.match(pat,line) == None: # Failed to match
+ return False
+ finally:
+ fh.close()
+ return False
+
+
+class TallyAnnotation(IntervalAnnotation):
+ file_ext = 'gsnap_tally'
+ """
+ Output produced by gsnap_tally
+ Example:
+ >144 chr20:57268791..57268935
+ G0
+ A1(1@7|1Q-3)
+ A2(1@36,1@1|1Q2,1Q-8)
+ C2 0.889,0.912,0.889,0.889,0.933,0.912,0.912,0.889,0.889,0.889 -2.66,-2.89,-2.66,-2.66,-3.16,-2.89,-2.89,-2.66,-2.66,-2.66
+ C1 T1 0.888,0.9,0.888,0.9,0.913,0.9,0.911,0.888,0.9,0.913 -2.66,-2.78,-2.66,-2.78,-2.91,-2.78,-2.89,-2.66,-2.78,-2.91
+ """
+ def sniff( self, filename ): # TODO
+ """
+ Determines whether the file is a gmap splice site annotation file
+ """
+ try:
+ pat = '^>(\d+)\s((\S+):(\d+)\.\.(\d+))$' #>total chr:position..position
+ pat2 = '^[GATCN]\d.*$' #BaseCountDeatails
+ fh = open( filename )
+ count = 0
+ while True and count < 10:
+ line = fh.readline()
+ if not line:
+ break #EOF
+ line = line.strip()
+ if line: #first non-empty line
+ count += 1
+ if re.match(pat,line) == None and re.match(pat2,line) == None: # Failed to match
+ return False
+ finally:
+ fh.close()
+ return False
+
+class GsnapResult( Text ):
+ """
+ The default output format for gsnap. Can be used as input for gsnap_tally.
+ """
+ file_ext = 'gsnap'
+
+
diff -r 000000000000 -r 10e3476429b5 snpindex.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/snpindex.xml Fri Oct 05 13:51:49 2012 -0400
@@ -0,0 +1,136 @@
+
+ build index files for known SNPs
+
+ snpindex
+
+ snpindex --version
+ /bin/bash $shscript 2>1 1> $output
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+#!/bin/bash
+#set $ds = chr(36)
+#set $gt = chr(62)
+#set $lt = chr(60)
+#set $ad = chr(38)
+#import os.path
+#if $refGenomeSource.genomeSource == "gmapdb":
+#set $gmapdb = $refGenomeSource.gmapdb.extra_files_path
+#set $refname = $refGenomeSource.gmapdb.metadata.db_name
+#else:
+#set $gmapdb = $os.path.dirname($refGenomeSource.gmapindex.value)
+$refname = $os.path.basename($refGenomeSource.gmapindex.value)
+#end if
+#set $gmapsnpdir = $output.extra_files_path
+mkdir -p $gmapsnpdir
+#set $snpsname = $snps_name.__str__
+#set $snpsiit = '.'.join([$snpsname,'iit'])
+#set $pathsnps = $os.path.join($gmapsnpdir,$snpsname)
+#set $pathsnpsiit = $os.path.join($gmapsnpdir,$snpsiit)
+#if $dbsnp.snp_source != 'none' and $dbsnp.snps.__str__ != 'None':
+#if $dbsnp.snp_source == 'snpTable':
+#if $dbsnp.snpsex.__str__ != 'None':
+cat $dbsnp.snps | dbsnp_iit -w $dbsnp.weight -e $dbsnp.snpsex | iit_store -o $pathsnps
+#else:
+cat $dbsnp.snps | dbsnp_iit -w $dbsnp.weight | iit_store -o $pathsnps
+#end if
+#elif $dbsnp.snp_source == 'snpFile':
+cat $dbsnp.snps | iit_store -o $pathsnps
+#elif $dbsnp.snp_source == 'snpIIT':
+cat $dbsnp.snps > $pathsnpsiit
+#end if
+snpindex -D $gmapdb -d $refname -V $output.extra_files_path -v $snpsname $pathsnpsiit
+echo snpindex -D $gmapdb -d $refname -V $output.extra_files_path -v $snpsname $pathsnpsiit
+#end if
+
+
+
+
+
+
+
+
+
+**GMAP SNP Index**
+
+GMAP SNP Index (snpindex in the GMAP documentaion) creates an index for known SNPs allowing for SNP tolerant mapping and alignment when using GMAP_ (Genomic Mapping and Alignment Program for mRNA and EST sequences) and GSNAP_ (Genomic Short-read Nucleotide Alignment Program).
+
+You will want to read the README_
+
+Publication_ citation: Thomas D. Wu, Colin K. Watanabe Bioinformatics 2005 21(9):1859-1875; doi:10.1093/bioinformatics/bti310
+
+.. _GMAP: http://research-pub.gene.com/gmap/
+.. _GSNAP: http://research-pub.gene.com/gmap/
+.. _README: http://research-pub.gene.com/gmap/src/README
+.. _Publication: http://bioinformatics.oxfordjournals.org/cgi/content/full/21/9/1859
+
+
+
+
+
diff -r 000000000000 -r 10e3476429b5 tool-data/datatypes_conf.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/datatypes_conf.xml Fri Oct 05 13:51:49 2012 -0400
@@ -0,0 +1,24 @@
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
diff -r 000000000000 -r 10e3476429b5 tool-data/gmap_indices.loc.sample
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/gmap_indices.loc.sample Fri Oct 05 13:51:49 2012 -0400
@@ -0,0 +1,10 @@
+#This is a sample file distributed with Galaxy that enables tools
+#to use a directory of GMAPDB indexed sequences data files. You will need
+#to create these data files using gmap_build and then create a gmap_indices.loc file
+#similar to this one (store it in this directory) that points to
+#the directories in which those files are stored. The gmap_indices.loc
+#file has this format (white space characters are TAB characters):
+#
+#
+#hg18 hg18 hg18 (cmet atoi) 12,13,14,15 splicesites,introns snps /depot/data2/galaxy/gmap/hg18
+#hg19 hg19 hg19 (cmet atoi) 12,13,14,15 splicesites,introns,snps snps,dbsnp /depot/data2/galaxy/gmap/hg19
diff -r 000000000000 -r 10e3476429b5 tool_dependencies.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml Fri Oct 05 13:51:49 2012 -0400
@@ -0,0 +1,21 @@
+
+
+
+
+
+ wget http://research-pub.gene.com/gmap/src/gmap-gsnap-2011-11-30.tar.gz
+ ./configure --prefix=bin --with-gmapdb=../gmapdb
+ make
+
+ bin
+ $INSTALL_DIR/bin
+
+
+ $INSTALL_DIR/bin
+
+
+
+
+
+
+