diff gsnap.xml @ 5:14561eb803a5 draft

Uploaded v3.0.1b (still working on this prior to main Tool Shed release)

--- a/gsnap.xml	Wed Sep 28 10:49:02 2016 -0400
+++ b/gsnap.xml	Fri Oct 21 10:55:40 2016 -0400
@@ -4,7 +4,7 @@
       <requirement type="package" version="2013-05-09">gmap</requirement>
   </requirements>
   <version_command>gsnap --version</version_command>
-  <command>
+  <command detect_errors="exit_code"><![CDATA[
     #import os.path, re
     gsnap
     --nthreads="4" --ordered
@@ -234,8 +234,7 @@
         2> $gsnap_stderr > $gsnap_out
       #end if
     #end if
-
-  </command>
+  ]]></command>
   <inputs>
     <!-- Input data -->
     <conditional name="seq">
@@ -319,7 +318,7 @@
       </param>
       <when value="indexed">
         <param name="gmapindex" type="select" label="Select a reference genome" help="if your genome of interest is not listed - contact Galaxy team">
-          <options from_file="gmap_indices.loc">
+          <options from_data_table="gmap_indices">
             <column name="uid" index="0" />
             <column name="dbkey" index="1" />
             <column name="name" index="2" />
@@ -331,7 +330,7 @@
         </param>
 
         <param name="kmer" type="select" data_ref="gmapindex" label="kmer size" help="Defaults to highest available kmer size">
-          <options from_file="gmap_indices.loc">
+          <options from_data_table="gmap_indices">
             <column name="name" index="3"/>
             <column name="value" index="3"/>
             <filter type="param_value" ref="gmapindex" column="6"/>
@@ -364,7 +363,7 @@
           </when>
           <when value="gmapdb">
             <param name="splicemap" type="select" data_ref="gmapindex" label="Use map for splicing involving known sites or known introns" help="">
-              <options from_file="gmap_indices.loc">
+              <options from_data_table="gmap_indices">
                 <column name="name" index="4"/>
                 <column name="value" index="4"/>
                 <filter type="param_value" ref="gmapindex" column="6"/>
@@ -389,7 +388,7 @@
           </when>
           <when value="gmapdb">
             <param name="snpindex" type="select" data_ref="gmapindex" label="Use database containing known SNPs" help="">
-              <options from_file="gmap_indices.loc">
+              <options from_data_table="gmap_indices">
                 <column name="name" index="5"/>
                 <column name="value" index="5"/>
                 <filter type="param_value" ref="gmapindex" column="6"/>
@@ -810,7 +809,7 @@
   <tests>
   </tests>
 
-  <help>
+  <help><![CDATA[
 
 **What it does**
 
@@ -844,12 +843,12 @@
 paired-end read).  The same FASTA file can have a mixture of
 single-end and paired-end reads of varying lengths, if desired.
 
-Single-end reads:
+*Single-end reads*:
 
-Each FASTA entry should contain one short read per line, like this
+Each FASTA entry should contain one short read per line, like this::
 
->Header information
-AAAACATTCTCCTCCGCATAAGCCTGCGTCAGATTA
+    >Header information
+    AAAACATTCTCCTCCGCATAAGCCTGCGTCAGATTA
 
 Each short read can have a different length.  However, the entire read
 needs to be on a single line, and may not wrap around multiple lines.
@@ -857,14 +856,14 @@
 paired-end.
 
 
-Paired-end reads:
+*Paired-end reads*:
 
 Each FASTA entry should contain two short reads, one per line, like
-this
+this::
 
->Header information
-AAAACATTCTCCTCCGCATAAGCCTAGTAGATTA
-GGCGTAGGTAGAAGTAGAGGTTAAGGCGCGTCAG
+    >Header information
+    AAAACATTCTCCTCCGCATAAGCCTAGTAGATTA
+    GGCGTAGGTAGAAGTAGAGGTTAAGGCGCGTCAG
 
 By default, the program assumes that the second end is in the reverse
 complement direction compared with the first end.  If they are in the
@@ -879,8 +878,10 @@
 SAM output format
 
 Default GSNAP format
-  See the README_
-  </help>
+
+See the README_
+
+  ]]></help>
   <citations>
     <citation type="doi">10.1093/bioinformatics/btq057</citation>
   </citations>