comparison gsnap.xml @ 5:14561eb803a5 draft

Uploaded v3.0.1b (still working on this prior to main Tool Shed release)

4:a88571642c6e

  <description>Genomic Short-read Nucleotide Alignment Program</description>
  <requirements>
      <requirement type="package" version="2013-05-09">gmap</requirement>
  </requirements>
  <version_command>gsnap --version</version_command>
  <command>
    #import os.path, re
    gsnap
    --nthreads="4" --ordered
    #if $refGenomeSource.genomeSource == "gmapdb":
      --dir=$refGenomeSource.gmapdb.extra_files_path --db=$refGenomeSource.gmapdb.metadata.db_name

        2> $gsnap_stderr > $gsnap_fq
      #else
        2> $gsnap_stderr > $gsnap_out
      #end if
    #end if

  </command>
  <inputs>
    <!-- Input data -->
    <conditional name="seq">
      <param name="format" type="select" label="&lt;H2&gt;Input Sequences&lt;/H2&gt;Select the input format" help="">
        <option value="fastq">Fastq</option>

        <option value="indexed">Use a built-in index</option>
        <option value="gmapdb">Use a gmapdb from your history</option>
      </param>
      <when value="indexed">
        <param name="gmapindex" type="select" label="Select a reference genome" help="if your genome of interest is not listed - contact Galaxy team">
          <options from_file="gmap_indices.loc">
            <column name="uid" index="0" />
            <column name="dbkey" index="1" />
            <column name="name" index="2" />
            <column name="kmers" index="3" />
            <column name="maps" index="4" />

            <column name="value" index="6" />
          </options>
        </param>

        <param name="kmer" type="select" data_ref="gmapindex" label="kmer size" help="Defaults to highest available kmer size">
          <options from_file="gmap_indices.loc">
            <column name="name" index="3"/>
            <column name="value" index="3"/>
            <filter type="param_value" ref="gmapindex" column="6"/>
            <filter type="multiple_splitter" column="3" separator=","/>
            <filter type="add_value" name="" value=""/>

            <param name="splicemap" type="data" format="splicesites.iit,introns.iit" label="Select a splicesite map"
              help="built with GMAP IIT"/>
          </when>
          <when value="gmapdb">
            <param name="splicemap" type="select" data_ref="gmapindex" label="Use map for splicing involving known sites or known introns" help="">
              <options from_file="gmap_indices.loc">
                <column name="name" index="4"/>
                <column name="value" index="4"/>
                <filter type="param_value" ref="gmapindex" column="6"/>
                <filter type="multiple_splitter" column="4" separator=","/>
                <filter type="add_value" name="" value=""/>

            <param name="snpindex" type="data" format="gmapsnpindex" label="Select a snpindex"
              help="built with GMAP SNP Index"/>
          </when>
          <when value="gmapdb">
            <param name="snpindex" type="select" data_ref="gmapindex" label="Use database containing known SNPs" help="">
              <options from_file="gmap_indices.loc">
                <column name="name" index="5"/>
                <column name="value" index="5"/>
                <filter type="param_value" ref="gmapindex" column="6"/>
                <filter type="multiple_splitter" column="5" separator=","/>
                <filter type="add_value" name="" value=""/>

  </outputs>
  <tests>
  </tests>

  <help>

**What it does**

GSNAP_ (Genomic Short-read Nucleotide Alignment Program) is a short read aligner which can align both single- and paired-end reads as short as 14nt and of arbitrarily long length. It can detect short- and long-distance splicing, including interchromosomal splicing, in individual reads, using probabilistic models or a database of known splice sites. Our program also permits SNP-tolerant alignment to a reference space of all possible combinations of major and minor alleles, and can align reads from bisulfite-treated DNA for the study of methylation state. It is developed by Thomas D. Wu of Genentech, Inc.
Publication_ citation: Thomas D. Wu, Serban Nacu "Fast and SNP-tolerant detection of complex variants and splicing in short reads. Bioinformatics. 2010 Apr 1;26(7):873-81. Epub 2010 Feb 10.

For FASTA format, you should include one line per read (or end of a
paired-end read).  The same FASTA file can have a mixture of
single-end and paired-end reads of varying lengths, if desired.

Single-end reads:

Each FASTA entry should contain one short read per line, like this

>Header information
AAAACATTCTCCTCCGCATAAGCCTGCGTCAGATTA

Each short read can have a different length.  However, the entire read
needs to be on a single line, and may not wrap around multiple lines.
If it extends to a second line, GSNAP will think that the read is
paired-end.


Paired-end reads:

Each FASTA entry should contain two short reads, one per line, like
this

>Header information
AAAACATTCTCCTCCGCATAAGCCTAGTAGATTA
GGCGTAGGTAGAAGTAGAGGTTAAGGCGCGTCAG

By default, the program assumes that the second end is in the reverse
complement direction compared with the first end.  If they are in the
same direction, you may need to use the --circular-input (or -c) flag.

**Output formats in GSNAP**

SAM output format

Default GSNAP format
  See the README_
  </help>
  <citations>
    <citation type="doi">10.1093/bioinformatics/btq057</citation>
  </citations>
</tool>

5:14561eb803a5

  <description>Genomic Short-read Nucleotide Alignment Program</description>
  <requirements>
      <requirement type="package" version="2013-05-09">gmap</requirement>
  </requirements>
  <version_command>gsnap --version</version_command>
  <command detect_errors="exit_code"><![CDATA[
    #import os.path, re
    gsnap
    --nthreads="4" --ordered
    #if $refGenomeSource.genomeSource == "gmapdb":
      --dir=$refGenomeSource.gmapdb.extra_files_path --db=$refGenomeSource.gmapdb.metadata.db_name

        2> $gsnap_stderr > $gsnap_fq
      #else
        2> $gsnap_stderr > $gsnap_out
      #end if
    #end if
  ]]></command>
  <inputs>
    <!-- Input data -->
    <conditional name="seq">
      <param name="format" type="select" label="&lt;H2&gt;Input Sequences&lt;/H2&gt;Select the input format" help="">
        <option value="fastq">Fastq</option>

        <option value="indexed">Use a built-in index</option>
        <option value="gmapdb">Use a gmapdb from your history</option>
      </param>
      <when value="indexed">
        <param name="gmapindex" type="select" label="Select a reference genome" help="if your genome of interest is not listed - contact Galaxy team">
          <options from_data_table="gmap_indices">
            <column name="uid" index="0" />
            <column name="dbkey" index="1" />
            <column name="name" index="2" />
            <column name="kmers" index="3" />
            <column name="maps" index="4" />

            <column name="value" index="6" />
          </options>
        </param>

        <param name="kmer" type="select" data_ref="gmapindex" label="kmer size" help="Defaults to highest available kmer size">
          <options from_data_table="gmap_indices">
            <column name="name" index="3"/>
            <column name="value" index="3"/>
            <filter type="param_value" ref="gmapindex" column="6"/>
            <filter type="multiple_splitter" column="3" separator=","/>
            <filter type="add_value" name="" value=""/>

            <param name="splicemap" type="data" format="splicesites.iit,introns.iit" label="Select a splicesite map"
              help="built with GMAP IIT"/>
          </when>
          <when value="gmapdb">
            <param name="splicemap" type="select" data_ref="gmapindex" label="Use map for splicing involving known sites or known introns" help="">
              <options from_data_table="gmap_indices">
                <column name="name" index="4"/>
                <column name="value" index="4"/>
                <filter type="param_value" ref="gmapindex" column="6"/>
                <filter type="multiple_splitter" column="4" separator=","/>
                <filter type="add_value" name="" value=""/>

            <param name="snpindex" type="data" format="gmapsnpindex" label="Select a snpindex"
              help="built with GMAP SNP Index"/>
          </when>
          <when value="gmapdb">
            <param name="snpindex" type="select" data_ref="gmapindex" label="Use database containing known SNPs" help="">
              <options from_data_table="gmap_indices">
                <column name="name" index="5"/>
                <column name="value" index="5"/>
                <filter type="param_value" ref="gmapindex" column="6"/>
                <filter type="multiple_splitter" column="5" separator=","/>
                <filter type="add_value" name="" value=""/>

  </outputs>
  <tests>
  </tests>

  <help><![CDATA[

**What it does**

GSNAP_ (Genomic Short-read Nucleotide Alignment Program) is a short read aligner which can align both single- and paired-end reads as short as 14nt and of arbitrarily long length. It can detect short- and long-distance splicing, including interchromosomal splicing, in individual reads, using probabilistic models or a database of known splice sites. Our program also permits SNP-tolerant alignment to a reference space of all possible combinations of major and minor alleles, and can align reads from bisulfite-treated DNA for the study of methylation state. It is developed by Thomas D. Wu of Genentech, Inc.
Publication_ citation: Thomas D. Wu, Serban Nacu "Fast and SNP-tolerant detection of complex variants and splicing in short reads. Bioinformatics. 2010 Apr 1;26(7):873-81. Epub 2010 Feb 10.

For FASTA format, you should include one line per read (or end of a
paired-end read).  The same FASTA file can have a mixture of
single-end and paired-end reads of varying lengths, if desired.

*Single-end reads*:

Each FASTA entry should contain one short read per line, like this::

    >Header information
    AAAACATTCTCCTCCGCATAAGCCTGCGTCAGATTA

Each short read can have a different length.  However, the entire read
needs to be on a single line, and may not wrap around multiple lines.
If it extends to a second line, GSNAP will think that the read is
paired-end.


*Paired-end reads*:

Each FASTA entry should contain two short reads, one per line, like
this::

    >Header information
    AAAACATTCTCCTCCGCATAAGCCTAGTAGATTA
    GGCGTAGGTAGAAGTAGAGGTTAAGGCGCGTCAG

By default, the program assumes that the second end is in the reverse
complement direction compared with the first end.  If they are in the
same direction, you may need to use the --circular-input (or -c) flag.

**Output formats in GSNAP**

SAM output format

Default GSNAP format

See the README_

  ]]></help>
  <citations>
    <citation type="doi">10.1093/bioinformatics/btq057</citation>
  </citations>
</tool>