# HG changeset patch # User jeanfred # Date 1365603915 14400 # Node ID 5048c53a90f470d0b4f3234660837f412150d983 # Parent 2acc5190be4c07c5e2ca0bf63f0d6fb6036c437e Uploaded diff -r 2acc5190be4c -r 5048c53a90f4 merge_paired_reads.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/merge_paired_reads.xml Wed Apr 10 10:25:15 2013 -0400 @@ -0,0 +1,37 @@ + + + sortmerna + + Merges two fastq paired-reads files into one file. + +merge-paired-reads.sh $input_reads1 $input_reads2 output_file.txt + + + + + + + + + + + + + + + + + + + + +Merges two fastq paired-reads files into one file. + +To run merge-paired-reads:: + bash merge-paired-reads.sh file1.fastq file2.fastq outputfile.fastq + + \ No newline at end of file diff -r 2acc5190be4c -r 5048c53a90f4 sortmerna_wrapper.xml --- a/sortmerna_wrapper.xml Fri Apr 05 13:07:39 2013 -0400 +++ b/sortmerna_wrapper.xml Wed Apr 10 10:25:15 2013 -0400 @@ -1,7 +1,9 @@ - - sortmerna - Fast and accurate filtering of ribosomal RNAs in metatranscriptomic data - + + + sortmerna + + Fast and accurate filtering of ribosomal RNAs in metatranscriptomic data + sortmerna_wrapper.py --sortmerna " @@ -32,114 +34,281 @@ ${' '.join([dict([(x[0], x[2]) for x in $databases_type.input_databases.input.options.tool_data_table.data])[y] for y in $databases_type.input_databases.value])} #end if - - - - Sequencing technology of querying sequences (reads) - - - - + + + + Sequencing technology of querying sequences (reads) + + + + + + + + + + + + + + + + - - - - - + + + + + + + + + + + + + + + + + - - - - - + + + + + + + - - - - - - - - - - - - - - - - - + + + + + + + + + + + + + + + + + outputs_selected and 'accept' in outputs_selected + + + outputs_selected and 'other' in outputs_selected + + + log + + + + + + + + + + + + + + + + + + + + + + +**Overview** - - - - - - - +SortMeRNA_ is a software designed to rapidly filter ribosomal RNA fragments +from metatransriptomic data produced by next-generation sequencers. +It is capable of handling large RNA databases and sorting out all fragments +matching to the database with high accuracy and specificity. + +.. _SortMeRNA: http://bioinfo.lifl.fr/RNA/sortmerna/ + +If you use this tool, please cite Kopylova E., Noé L. and Touzet H., +`"SortMeRNA: Fast and accurate filtering of ribosomal RNAs in metatranscriptomic data"`__, +Bioinformatics (2012), doi: 10.1093/bioinformatics/bts611. + +.. __: http://bioinformatics.oxfordjournals.org/content/28/24/3211 + +------ + +**Input** + +The input is one file of reads in FASTA or FASTQ format and any number of rRNA databases to search against. +If the user has two foward-reverse paired-sequencing reads files, they may use +the script "merge_paired_reads.sh" to interleave the reads into one file, preserving their order. + +If the sequencing type for the reads is paired-ended, the user has two options under +"Sequencing type" to filter the reads and preserve their order in the file. +For a further example of each option, please refer to Section 4.2.3 in the `SortMeRNA User Manual`_. - - - - - - - - - - - - - - - - - outputs_selected and 'accept' in outputs_selected - - - outputs_selected and 'other' in outputs_selected - - - log - - - - - - - - - - - - - - - - - - - - - - -If you use this tool, please cite Kopylova E., Noé L. and Touzet H., `"SortMeRNA: Fast and accurate filtering of ribosomal RNAs in metatranscriptomic data" <http://bioinformatics.oxfordjournals.org/content/28/24/3211>`_, Bioinformatics (2012), doi: 10.1093/bioinformatics/bts611. - +.. _sortmerna user manual: http://bioinfo.lifl.fr/RNA/sortmerna/code/SortMeRNA-user-manual-v1.7.pdf + +------ + +**Output** + +The output will follow the same format (FASTA or FASTQ) as the reads. + +------ + +**rRNA databases** + +SortMeRNA is distributed with 8 representative rRNA databases, which were +all constructed from the SILVA SSU,LSU (version 111) and the RFAM 5/5.8S +(version 11.0) databases using the tool UCLUST. + ++--------------------------+------+--------------+-------+------------------------+--------+--------------------+ +| Representative database | id % | avergage id% | # seq | Origin | # seq | filtered to remove | ++==========================+======+==============+=======+========================+========+====================+ +| SILVA 16S bacteria | 85 | 91.6 | 8174 | SILVA SSU Ref NR v.111 | 244077 | 23s | ++--------------------------+------+--------------+-------+------------------------+--------+--------------------+ +| SILVA 16S archaea | 95 | 96.7 | 3845 | SILVA SSU Ref NR v.111 | 10919 | 23s | ++--------------------------+------+--------------+-------+------------------------+--------+--------------------+ +| SILVA 18S eukarya | 95 | 96.7 | 4512 | SILVA SSU Ref NR v.111 | 31862 | 26s,28s,23s | ++--------------------------+------+--------------+-------+------------------------+--------+--------------------+ +| | ++--------------------------+------+--------------+-------+------------------------+--------+--------------------+ +| SILVA 23S bacteria | 98 | 99.4 | 3055 | SILVA LSU Ref v.111 | 19580 | 16s,26s,28s | ++--------------------------+------+--------------+-------+------------------------+--------+--------------------+ +| SILVA 23s archaea | 98 | 99.5 | 164 | SILVA LSU Ref v.111 | 405 | 16s,26s,28s | ++--------------------------+------+--------------+-------+------------------------+--------+--------------------+ +| SILVA 28S eukarya | 98 | 99.1 | 4578 | SILVA LSU Ref v.111 | 9321 | 18s | ++--------------------------+------+--------------+-------+------------------------+--------+--------------------+ +| | ++--------------------------+------+--------------+-------+------------------------+--------+--------------------+ +| Rfam 5S archaea/bacteria | 98 | 99.2 | 59513 | RFAM | 116760 | | ++--------------------------+------+--------------+-------+------------------------+--------+--------------------+ +| Rfam 5.8S eukarya | 98 | 98.9 | 13034 | RFAM | 225185 | | ++--------------------------+------+--------------+-------+------------------------+--------+--------------------+ + + +id % : + members of the cluster must have identity at least 'id %' identity with the representative sequence + +average id % : + average identity of a cluster member to the representative sequence + +The user may also choose to use their own rRNA databases. + +.. class:: warningmark + +Note that your personal databases are indexed each time, and that +this may take some time depending on the size of the given database. + +------ + +**SortMeRNA parameter list** + +For indexing (buildtrie): + +This program builds a Burst trie on an input rRNA database file in fasta format +and stores the material in binary files under the folder '/automata':: + + ./buildtrie --db [path to rrnas database file name {.fasta}] {OPTIONS} + +The list of OPTIONS can be left blank, the default values will be used:: + + -L length of the sliding window (the seed) + (default: 18) + -F search only the forward strand + -R search only the reverse-complementary strand + (default: both strands are searched) + + -h help + + + + +For sorting (sortmerna): + +To run SortMeRNA, type in any order after 'sortmerna':: + + --I [illumina reads file name {fasta/fastq}] + + --454 [roche 454 reads file name {fasta/fastq}] + + -n number of databases to use (must precede --db) + + --db [rrnas database name(s)] + + One database, + ex 1. -n 1 --db /path1/database1.fasta + + Multiple databases, + ex 2. -n 2 --db /path2/database2.fasta /path3/database3.fasta + + {OPTIONS} + +The list of OPTIONS can be left blank, the default values will be used:: + + --accept [accepted reads file name] + --other [rejected reads file name] + (default: no output file is created) + + --bydbs output the accepted reads by database + (default: concatenated file of reads) + + --log [overall statistics file name] + (default: no statistics file created) + + --paired-in put both paired-end reads into --accept file + --paired-out put both paired-end reads into --other file + (default: if one read is accepted and the other is not, + separate the reads into --accept and --other files) + + -r ratio of the number of hits on the read / read length + (default Illumina: 0.25, Roche 454: 0.15) + + -F search only the forward strand + -R search only the reverse-complementary strand + (default: both strands are searched) + + -a number of threads to use + (default: 1) + + -m (m x 4096 bytes) for loading the reads into memory + ex. '-m 4' means 4*4096 = 16384 bytes will be allocated for the reads + note: maximum -m is 1020039 + (default: m = 262144 = 1GB) + + -v verbose + (default: deactivated) + + -h help + + --version version number + + diff -r 2acc5190be4c -r 5048c53a90f4 test-data/merged-paired-reads_output.fastq --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/merged-paired-reads_output.fastq Wed Apr 10 10:25:15 2013 -0400 @@ -0,0 +1,50 @@ +@PHOSPHORE_0118:4:1101:5073:2473#ATCACG/1 +CTCGCGCCACTGGCTGGCTCTCCCCTCTCTCTCTCTCTCTCCCCTCTCTCTCCCCGAGTACACCCGCGCGGGC ++PHOSPHORE_0118:4:1101:5073:2473#ATCACG/1 +___cccccggggghhhhf_YbcgecZYa^Y^ceXccacXIXaafX`_]VMHVbdhSTFKU_Z]b]WFW_aZ__ +@PHOSPHORE_0118:4:1101:1143:2236#ATCACG/1 +CGCGCGCACCATGCCCGTGCTCGACTGCTCGCCGCCCGCGCCGCGCCACGCCTCGCCGTTCACCTTGACCTCCACGCGCAGGCC ++PHOSPHORE_0118:4:1101:1143:2236#ATCACG/1 +__beeeecggcgfhhhhhhhhhhfhhhhhhhhhhhgececcccccccacaccccaccccac`bbbcbbbcbbc[`_a[aLT[aa +@PHOSPHORE_0118:4:1101:17780:2432#ATCACG/1 +GCGGTCTGGAACCACCTGATCCCATCCCGAACTCAGCCGTGAAACAGACCAGCGCCGATGGTAGTGTGGCTTCTGCCCGT ++PHOSPHORE_0118:4:1101:17780:2432#ATCACG/1 +bbbeeeeegggggiiiiiiihiiihiiiiiiihiidhhigfhihiihgiiiiiggeccaccbbb_b`baccab`]_ba[T +@PHOSPHORE_0118:4:1101:1397:2156#ATCACG/1 +ATGCGCTTGAGGTAGCCAAGGGCACGCAGTTCACACCGTATGGCGGCGATGCGAGGCGGCGGCAGGAGG ++PHOSPHORE_0118:4:1101:1397:2156#ATCACG/1 +bbbeeeeegggggiiiiiiiiihfhiheghihgihiiihiiiiihifc^acac^_cEHVZaccaac^__ +@PHOSPHORE_0118:4:1101:7859:3729#ATCACG/1 +GCATCGCCGCCCTCGCCCTCGCCCCCGCCGCCCTCGCCCT ++PHOSPHORE_0118:4:1101:7859:3729#ATCACG/1 +___c`cc`Yeee[ePY_`UY^_eGL_F_`dUU\F\^Q\a_ +@PHOSPHORE_0118:4:1101:1633:2146#ATCACG/1 +TGACCAATGTTCTTCATAACGTCCCCGATAGACATGCCAACATTCGGTCCGTTGCGAAGATAGTCATCGCCGTCATAGTC ++PHOSPHORE_0118:4:1101:1633:2146#ATCACG/1 +_bbecdecgggggihhiiiihghhhiihiichdfghiffghfghiifiifhhhiiggaaaddddbdd`bccaQ\a`bc_b +@PHOSPHORE_0118:4:1101:7007:4197#ATCACG/1 +CCCCACTCACCACGCACGGCACCGCACGGCACTCTCACGGTTTCTCTCTCTCTCTCCCATCCTTCTCACTCCTTTCTCTCTCTCCCTATCTCTCTCTCTC ++PHOSPHORE_0118:4:1101:7007:4197#ATCACG/1 +bbbeeeeeggggghiiiiihfhifhhiihiagfhiiiiig^dceeeedcddddcccccRZ``bbcbcbbR_bb`b`bb`bbb`bbcbR]b_]]`bb_b_b +@PHOSPHORE_0118:4:1101:1719:2154#ATCACG/1 +GCATGCCAAACGTGGAGGCGGTGGGCGCGACGCCGGTGGGGAACTTGGACTTGTACATGGCCGGCCGCTGCGTCACCATCGA ++PHOSPHORE_0118:4:1101:1719:2154#ATCACG/1 +bbbeeeeeggggegifhiiii^fgh\edgffeeccc\acccWV_ccccbccccbbdccccccccaaacaZ]acaa^bccccb +@PHOSPHORE_0118:4:1101:7113:4916#ATCACG/1 +AGCCTGACGATAACCTACTTTCACACTGGTTGCAGCACTATCATCGGCGCAAAGTCGTTTCACGGTCCTGTTCGGGATGGGAAGGGGTGGGACCGACTTGC ++PHOSPHORE_0118:4:1101:7113:4916#ATCACG/1 +bbbeeeeegggggiiiiiiiiiihiiiiigiiiiiiiiiiiiiiiiiiiihiiggggeeeeddccccccccccccccccccbbccccHXaacccc]acacb +@PHOSPHORE_0118:4:1101:1730:2193#ATCACG/1 +GTTCGATTAGTCTTTCGCCCCTATACCCAAATTTGACGATCGATTTGCACGTCAGAATCGCTAC ++PHOSPHORE_0118:4:1101:1730:2193#ATCACG/1 +baaeeeeeggggghhifhiiihfgbghhhiihihfhihfhihdfghhiiifhiihdbfgddged +@PHOSPHORE_0118:4:1101:11597:5204#ATCACG/1 +GCCGAAGAAGGACGTGGGAATCTGCGATAAGCCTGGTGGAGTCGATAACCGGACGTTGAGACCAGGATTTCCGAATGGGGAAACCCCGCACGACGTGTCGT ++PHOSPHORE_0118:4:1101:11597:5204#ATCACG/1 +bbbeeeeegggggifgiiiiiiiiiihiihiiiiiicfhgheghiiihihggcecccccccccccccccccccccccccccaacccaccc__[_a[a^[_Q + +@PHOSPHORE_0118:4:1101:13427:6518#ATCACG/1 +GCGCTCGAGGAGGACGTGGCGCCCGAGGCTGCCGAGGCTG ++PHOSPHORE_0118:4:1101:13427:6518#ATCACG/1 +Z__cccc`ecg^_fe^[^^^Y_ffc]_`[eZ_c_W\]]b` + diff -r 2acc5190be4c -r 5048c53a90f4 tool-data/rRNA_databases.loc.sample --- a/tool-data/rRNA_databases.loc.sample Fri Apr 05 13:07:39 2013 -0400 +++ b/tool-data/rRNA_databases.loc.sample Wed Apr 10 10:25:15 2013 -0400 @@ -10,17 +10,17 @@ #So, for example, if your database is rfam-5.8s and the path to your base name #is /data/rRNA_databases/rfam-5.8s, then the rRNA_databases.loc entry would look like this: # -#rfam-5.8s Database Rfam 5.8s /data/rRNA_databases/rfam-5.8s +#rfam-5.8s Rfam 5.8S eukarya /data/rRNA_databases/rfam-5.8s # #Since SortMeRNA comes bundled with eight ribosomal databases, which are ready #for use after the tool installation, this sample file is in fact an actual file #to save the user the trouble of setting it. # -rfam-5.8s Database Rfam 5.8s $SORTMERNADIR/rRNA_databases/rfam-5.8s-database-id98.fasta -rfam-5s Database Rfam 5s $SORTMERNADIR/rRNA_databases/rfam-5s-database-id98.fasta -silva-arc-16s Database Silva-Arc 16s $SORTMERNADIR/rRNA_databases/silva-arc-16s-database-id95.fasta -silva-arc-23s Database Silva-Arc 23s $SORTMERNADIR/rRNA_databases/silva-arc-23s-database-id98.fasta -silva-bac-16s Database Silva-Bac 16s $SORTMERNADIR/rRNA_databases/silva-bac-16s-database-id85.fasta -silva-bac-23s Database Silva-Bac 23s $SORTMERNADIR/rRNA_databases/silva-bac-23s-database-id98.fasta -silva-euk-18s Databse Silva-Euk 18s $SORTMERNADIR/rRNA_databases/silva-euk-18s-database-id95.fasta -silva-euk-28s Database Silva-Euk 28s $SORTMERNADIR/rRNA_databases/silva-euk-28s-database-id98.fasta +rfam-5.8s Rfam 5.8S eukarya $SORTMERNADIR/rRNA_databases/rfam-5.8s-database-id98.fasta +rfam-5s Rfam 5S archaea/bacteria $SORTMERNADIR/rRNA_databases/rfam-5s-database-id98.fasta +silva-arc-16s SILVA 16S archaea $SORTMERNADIR/rRNA_databases/silva-arc-16s-database-id95.fasta +silva-arc-23s SILVA 16S bacteria $SORTMERNADIR/rRNA_databases/silva-arc-23s-database-id98.fasta +silva-bac-16s SILVA 16S bacteria $SORTMERNADIR/rRNA_databases/silva-bac-16s-database-id85.fasta +silva-bac-23s SILVA 23S bacteria $SORTMERNADIR/rRNA_databases/silva-bac-23s-database-id98.fasta +silva-euk-18s SILVA 18S eukarya $SORTMERNADIR/rRNA_databases/silva-euk-18s-database-id95.fasta +silva-euk-28s SILVA 28S eukarya $SORTMERNADIR/rRNA_databases/silva-euk-28s-database-id98.fasta diff -r 2acc5190be4c -r 5048c53a90f4 tool_dependencies.xml --- a/tool_dependencies.xml Fri Apr 05 13:07:39 2013 -0400 +++ b/tool_dependencies.xml Wed Apr 10 10:25:15 2013 -0400 @@ -15,6 +15,10 @@ buildtrie $INSTALL_DIR/bin + + scripts/merge-paired-reads.sh + $INSTALL_DIR/bin + rRNA_databases $INSTALL_DIR/rRNA_databases @@ -32,7 +36,7 @@ -SortMeRNA requires g++ 4.3 and later. +SortMeRNA requires g++ 4.3 or later. Installation may take a moment since ribosomal databases have to be indexed.