Mercurial > repos > jankanis > blast2html2
comparison test-data/blast xml example4.html @ 59:f611cf649c90
update tests
| author | Jan Kanis <jan.code@jankanis.nl> |
|---|---|
| date | Tue, 27 May 2014 12:50:52 +0200 |
| parents | 3bb5da68305e |
| children | fa8a93bdefd7 |
comparison
equal
deleted
inserted
replaced
| 58:39df29f647e8 | 59:f611cf649c90 |
|---|---|
| 124 padding-left: .2em; | 124 padding-left: .2em; |
| 125 padding-right: .2em; | 125 padding-right: .2em; |
| 126 max-width: 50em; | 126 max-width: 50em; |
| 127 text-align: left; | 127 text-align: left; |
| 128 height: 2.8em; | 128 height: 2.8em; |
| 129 overflow-y: hidden; | 129 overflow: hidden; |
| 130 } | 130 } |
| 131 | 131 |
| 132 div.legend { | 132 div.legend { |
| 133 max-width: 40em; | 133 max-width: 40em; |
| 134 } | 134 } |
| 499 </div> | 499 </div> |
| 500 <div style="clear: left"></div> | 500 <div style="clear: left"></div> |
| 501 </div> | 501 </div> |
| 502 | 502 |
| 503 <a class=matchresult | 503 <a class=matchresult |
| 504 href="#hit1" | 504 href="#hit1-1" |
| 505 onmouseover='document.getElementById("defline1").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' | 505 onmouseover='document.getElementById("defline1").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' |
| 506 onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | 506 onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"' |
| 507 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> | 507 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> |
| 508 <div class="matchrow graphicrow"> | 508 <div class="matchrow graphicrow"> |
| 509 <div class="matchitem graphicitem" | 509 <div class="matchitem graphicitem" |
| 510 style="background-color: black; width: 100.0%"></div> | 510 style="background-color: black; width: 100.0%"></div> |
| 511 </div> | 511 </div> |
| 512 </a> | 512 </a> |
| 513 | 513 |
| 514 <a class=matchresult | 514 <a class=matchresult |
| 515 href="#hit2" | 515 href="#hit1-2" |
| 516 onmouseover='document.getElementById("defline1").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' | 516 onmouseover='document.getElementById("defline1").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' |
| 517 onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | 517 onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"' |
| 518 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> | 518 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> |
| 519 <div class="matchrow graphicrow"> | 519 <div class="matchrow graphicrow"> |
| 520 <div class="matchitem graphicitem" | 520 <div class="matchitem graphicitem" |
| 545 <th>E value</th> | 545 <th>E value</th> |
| 546 <th>Ident</th> | 546 <th>Ident</th> |
| 547 <th>Accession</th> | 547 <th>Accession</th> |
| 548 </tr> | 548 </tr> |
| 549 <tr> | 549 <tr> |
| 550 <td><div><a href="#hit1" | 550 <td><div><a href="#hit1-1" |
| 551 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" | 551 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" |
| 552 id="description1"> | 552 id="description1-1"> |
| 553 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 | 553 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 |
| 554 </a></div></td> | 554 </a></div></td> |
| 555 <td>40.1</td> | 555 <td>40.1</td> |
| 556 <td>40.1</td> | 556 <td>40.1</td> |
| 557 <td>100%</td> | 557 <td>100%</td> |
| 558 <td>1.513e-07</td> | 558 <td>1.513e-07</td> |
| 559 <td>100%</td> | 559 <td>100%</td> |
| 560 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">5</a></td> | 560 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">5</a></td> |
| 561 </tr> | 561 </tr> |
| 562 <tr> | 562 <tr> |
| 563 <td><div><a href="#hit2" | 563 <td><div><a href="#hit1-2" |
| 564 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" | 564 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" |
| 565 id="description2"> | 565 id="description1-2"> |
| 566 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 | 566 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 |
| 567 </a></div></td> | 567 </a></div></td> |
| 568 <td>40.1</td> | 568 <td>40.1</td> |
| 569 <td>40.1</td> | 569 <td>40.1</td> |
| 570 <td>100%</td> | 570 <td>100%</td> |
| 581 | 581 |
| 582 <section class=alignments> | 582 <section class=alignments> |
| 583 <h2>Alignments</h2> | 583 <h2>Alignments</h2> |
| 584 | 584 |
| 585 <div class=grey><div class=white> | 585 <div class=grey><div class=white> |
| 586 <div class=alignment id=hit1> | 586 <div class=alignment id=hit1-1> |
| 587 | 587 |
| 588 <div class=linkheader> | 588 <div class=linkheader> |
| 589 <div class=right><a href="#description1">Descriptions</a></div> | 589 <div class=right><a href="#description1-1">Descriptions</a></div> |
| 590 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> | 590 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
| 591 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | 591 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> |
| 592 </div> | 592 </div> |
| 593 | 593 |
| 594 <div class=title> | 594 <div class=title> |
| 599 <span class=b>Number of Matches:</span> 1 | 599 <span class=b>Number of Matches:</span> 1 |
| 600 </p> | 600 </p> |
| 601 </div> | 601 </div> |
| 602 | 602 |
| 603 | 603 |
| 604 <div class=hotspot> | 604 <div class=hotspot id=hotspot1-1-1> |
| 605 <p class=range> | 605 <p class=range> |
| 606 <span class=range>Range 1: 2119 to 2138</span> | 606 <span class=range>Range 1: 2119 to 2138</span> |
| 607 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=2119&to=2138">GenBank</a> | 607 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=2119&to=2138">GenBank</a> |
| 608 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=2119&to=2138">Graphics</a> | 608 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=2119&to=2138">Graphics</a> |
| 609 </p> | 609 </p> |
| 626 Subject 2119 AGCGCGCAAACTAGGATAAA 2138</pre> | 626 Subject 2119 AGCGCGCAAACTAGGATAAA 2138</pre> |
| 627 </div> | 627 </div> |
| 628 | 628 |
| 629 </div> | 629 </div> |
| 630 | 630 |
| 631 <div class=alignment id=hit2> | 631 <div class=alignment id=hit1-2> |
| 632 | 632 |
| 633 <div class=linkheader> | 633 <div class=linkheader> |
| 634 <div class=right><a href="#description2">Descriptions</a></div> | 634 <div class=right><a href="#description1-2">Descriptions</a></div> |
| 635 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> | 635 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
| 636 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | 636 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> |
| 637 </div> | 637 </div> |
| 638 | 638 |
| 639 <div class=title> | 639 <div class=title> |
| 644 <span class=b>Number of Matches:</span> 1 | 644 <span class=b>Number of Matches:</span> 1 |
| 645 </p> | 645 </p> |
| 646 </div> | 646 </div> |
| 647 | 647 |
| 648 | 648 |
| 649 <div class=hotspot> | 649 <div class=hotspot id=hotspot1-2-1> |
| 650 <p class=range> | 650 <p class=range> |
| 651 <span class=range>Range 1: 200 to 219</span> | 651 <span class=range>Range 1: 200 to 219</span> |
| 652 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=200&to=219">GenBank</a> | 652 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=200&to=219">GenBank</a> |
| 653 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=200&to=219">Graphics</a> | 653 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=200&to=219">Graphics</a> |
| 654 </p> | 654 </p> |
| 781 </div> | 781 </div> |
| 782 <div style="clear: left"></div> | 782 <div style="clear: left"></div> |
| 783 </div> | 783 </div> |
| 784 | 784 |
| 785 <a class=matchresult | 785 <a class=matchresult |
| 786 href="#hit1" | 786 href="#hit3-1" |
| 787 onmouseover='document.getElementById("defline3").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' | 787 onmouseover='document.getElementById("defline3").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' |
| 788 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | 788 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' |
| 789 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> | 789 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> |
| 790 <div class="matchrow graphicrow"> | 790 <div class="matchrow graphicrow"> |
| 791 <div class="matchitem graphicitem" | 791 <div class="matchitem graphicitem" |
| 792 style="background-color: black; width: 100.0%"></div> | 792 style="background-color: black; width: 100.0%"></div> |
| 793 </div> | 793 </div> |
| 794 </a> | 794 </a> |
| 795 | 795 |
| 796 <a class=matchresult | 796 <a class=matchresult |
| 797 href="#hit2" | 797 href="#hit3-2" |
| 798 onmouseover='document.getElementById("defline3").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' | 798 onmouseover='document.getElementById("defline3").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' |
| 799 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | 799 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' |
| 800 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> | 800 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> |
| 801 <div class="matchrow graphicrow"> | 801 <div class="matchrow graphicrow"> |
| 802 <div class="matchitem graphicitem" | 802 <div class="matchitem graphicitem" |
| 803 style="background-color: black; width: 100.0%"></div> | 803 style="background-color: black; width: 100.0%"></div> |
| 804 </div> | 804 </div> |
| 805 </a> | 805 </a> |
| 806 | 806 |
| 807 <a class=matchresult | 807 <a class=matchresult |
| 808 href="#hit3" | 808 href="#hit3-3" |
| 809 onmouseover='document.getElementById("defline3").innerHTML="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3\u0027UTR/plant_junction_region.|-9105899556052450000"' | 809 onmouseover='document.getElementById("defline3").innerHTML="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3\u0027UTR/plant_junction_region.|-9105899556052450000"' |
| 810 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | 810 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' |
| 811 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000"> | 811 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000"> |
| 812 <div class="matchrow graphicrow"> | 812 <div class="matchrow graphicrow"> |
| 813 <div class="matchitem graphicitem" | 813 <div class="matchitem graphicitem" |
| 840 <th>E value</th> | 840 <th>E value</th> |
| 841 <th>Ident</th> | 841 <th>Ident</th> |
| 842 <th>Accession</th> | 842 <th>Accession</th> |
| 843 </tr> | 843 </tr> |
| 844 <tr> | 844 <tr> |
| 845 <td><div><a href="#hit1" | 845 <td><div><a href="#hit3-1" |
| 846 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" | 846 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" |
| 847 id="description1"> | 847 id="description3-1"> |
| 848 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 | 848 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 |
| 849 </a></div></td> | 849 </a></div></td> |
| 850 <td>40.1</td> | 850 <td>40.1</td> |
| 851 <td>40.1</td> | 851 <td>40.1</td> |
| 852 <td>100%</td> | 852 <td>100%</td> |
| 853 <td>1.513e-07</td> | 853 <td>1.513e-07</td> |
| 854 <td>100%</td> | 854 <td>100%</td> |
| 855 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">5</a></td> | 855 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">5</a></td> |
| 856 </tr> | 856 </tr> |
| 857 <tr> | 857 <tr> |
| 858 <td><div><a href="#hit2" | 858 <td><div><a href="#hit3-2" |
| 859 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" | 859 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" |
| 860 id="description2"> | 860 id="description3-2"> |
| 861 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 | 861 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 |
| 862 </a></div></td> | 862 </a></div></td> |
| 863 <td>40.1</td> | 863 <td>40.1</td> |
| 864 <td>40.1</td> | 864 <td>40.1</td> |
| 865 <td>100%</td> | 865 <td>100%</td> |
| 866 <td>1.513e-07</td> | 866 <td>1.513e-07</td> |
| 867 <td>100%</td> | 867 <td>100%</td> |
| 868 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">2</a></td> | 868 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">2</a></td> |
| 869 </tr> | 869 </tr> |
| 870 <tr> | 870 <tr> |
| 871 <td><div><a href="#hit3" | 871 <td><div><a href="#hit3-3" |
| 872 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000" | 872 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000" |
| 873 id="description3"> | 873 id="description3-3"> |
| 874 AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000 | 874 AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000 |
| 875 </a></div></td> | 875 </a></div></td> |
| 876 <td>34.2</td> | 876 <td>34.2</td> |
| 877 <td>34.2</td> | 877 <td>34.2</td> |
| 878 <td>85%</td> | 878 <td>85%</td> |
| 889 | 889 |
| 890 <section class=alignments> | 890 <section class=alignments> |
| 891 <h2>Alignments</h2> | 891 <h2>Alignments</h2> |
| 892 | 892 |
| 893 <div class=grey><div class=white> | 893 <div class=grey><div class=white> |
| 894 <div class=alignment id=hit1> | 894 <div class=alignment id=hit3-1> |
| 895 | 895 |
| 896 <div class=linkheader> | 896 <div class=linkheader> |
| 897 <div class=right><a href="#description1">Descriptions</a></div> | 897 <div class=right><a href="#description3-1">Descriptions</a></div> |
| 898 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> | 898 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
| 899 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | 899 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> |
| 900 </div> | 900 </div> |
| 901 | 901 |
| 902 <div class=title> | 902 <div class=title> |
| 907 <span class=b>Number of Matches:</span> 1 | 907 <span class=b>Number of Matches:</span> 1 |
| 908 </p> | 908 </p> |
| 909 </div> | 909 </div> |
| 910 | 910 |
| 911 | 911 |
| 912 <div class=hotspot> | 912 <div class=hotspot id=hotspot3-1-1> |
| 913 <p class=range> | 913 <p class=range> |
| 914 <span class=range>Range 1: 2143 to 2162</span> | 914 <span class=range>Range 1: 2143 to 2162</span> |
| 915 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=2143&to=2162">GenBank</a> | 915 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=2143&to=2162">GenBank</a> |
| 916 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=2143&to=2162">Graphics</a> | 916 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=2143&to=2162">Graphics</a> |
| 917 </p> | 917 </p> |
| 934 Subject 2143 CGCGCGCGGTGTCATCTATG 2162</pre> | 934 Subject 2143 CGCGCGCGGTGTCATCTATG 2162</pre> |
| 935 </div> | 935 </div> |
| 936 | 936 |
| 937 </div> | 937 </div> |
| 938 | 938 |
| 939 <div class=alignment id=hit2> | 939 <div class=alignment id=hit3-2> |
| 940 | 940 |
| 941 <div class=linkheader> | 941 <div class=linkheader> |
| 942 <div class=right><a href="#description2">Descriptions</a></div> | 942 <div class=right><a href="#description3-2">Descriptions</a></div> |
| 943 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> | 943 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
| 944 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | 944 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> |
| 945 </div> | 945 </div> |
| 946 | 946 |
| 947 <div class=title> | 947 <div class=title> |
| 952 <span class=b>Number of Matches:</span> 1 | 952 <span class=b>Number of Matches:</span> 1 |
| 953 </p> | 953 </p> |
| 954 </div> | 954 </div> |
| 955 | 955 |
| 956 | 956 |
| 957 <div class=hotspot> | 957 <div class=hotspot id=hotspot3-2-1> |
| 958 <p class=range> | 958 <p class=range> |
| 959 <span class=range>Range 1: 224 to 243</span> | 959 <span class=range>Range 1: 224 to 243</span> |
| 960 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=224&to=243">GenBank</a> | 960 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=224&to=243">GenBank</a> |
| 961 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=224&to=243">Graphics</a> | 961 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=224&to=243">Graphics</a> |
| 962 </p> | 962 </p> |
| 979 Subject 224 CGCGCGCGGTGTCATCTATG 243</pre> | 979 Subject 224 CGCGCGCGGTGTCATCTATG 243</pre> |
| 980 </div> | 980 </div> |
| 981 | 981 |
| 982 </div> | 982 </div> |
| 983 | 983 |
| 984 <div class=alignment id=hit3> | 984 <div class=alignment id=hit3-3> |
| 985 | 985 |
| 986 <div class=linkheader> | 986 <div class=linkheader> |
| 987 <div class=right><a href="#description3">Descriptions</a></div> | 987 <div class=right><a href="#description3-3">Descriptions</a></div> |
| 988 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> | 988 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
| 989 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | 989 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> |
| 990 </div> | 990 </div> |
| 991 | 991 |
| 992 <div class=title> | 992 <div class=title> |
| 997 <span class=b>Number of Matches:</span> 1 | 997 <span class=b>Number of Matches:</span> 1 |
| 998 </p> | 998 </p> |
| 999 </div> | 999 </div> |
| 1000 | 1000 |
| 1001 | 1001 |
| 1002 <div class=hotspot> | 1002 <div class=hotspot id=hotspot3-3-1> |
| 1003 <p class=range> | 1003 <p class=range> |
| 1004 <span class=range>Range 1: 2 to 18</span> | 1004 <span class=range>Range 1: 2 to 18</span> |
| 1005 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=2&to=18">GenBank</a> | 1005 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=2&to=18">GenBank</a> |
| 1006 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=2&to=18">Graphics</a> | 1006 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=2&to=18">Graphics</a> |
| 1007 </p> | 1007 </p> |
| 1157 </div> | 1157 </div> |
| 1158 <div style="clear: left"></div> | 1158 <div style="clear: left"></div> |
| 1159 </div> | 1159 </div> |
| 1160 | 1160 |
| 1161 <a class=matchresult | 1161 <a class=matchresult |
| 1162 href="#hit1" | 1162 href="#hit6-1" |
| 1163 onmouseover='document.getElementById("defline6").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' | 1163 onmouseover='document.getElementById("defline6").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' |
| 1164 onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | 1164 onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"' |
| 1165 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> | 1165 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> |
| 1166 <div class="matchrow graphicrow"> | 1166 <div class="matchrow graphicrow"> |
| 1167 <div class="matchitem graphicitem" | 1167 <div class="matchitem graphicitem" |
| 1170 style="background-color: transparent; width: 12.0%"></div> | 1170 style="background-color: transparent; width: 12.0%"></div> |
| 1171 </div> | 1171 </div> |
| 1172 </a> | 1172 </a> |
| 1173 | 1173 |
| 1174 <a class=matchresult | 1174 <a class=matchresult |
| 1175 href="#hit2" | 1175 href="#hit6-2" |
| 1176 onmouseover='document.getElementById("defline6").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' | 1176 onmouseover='document.getElementById("defline6").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' |
| 1177 onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | 1177 onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"' |
| 1178 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> | 1178 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> |
| 1179 <div class="matchrow graphicrow"> | 1179 <div class="matchrow graphicrow"> |
| 1180 <div class="matchitem graphicitem" | 1180 <div class="matchitem graphicitem" |
| 1207 <th>E value</th> | 1207 <th>E value</th> |
| 1208 <th>Ident</th> | 1208 <th>Ident</th> |
| 1209 <th>Accession</th> | 1209 <th>Accession</th> |
| 1210 </tr> | 1210 </tr> |
| 1211 <tr> | 1211 <tr> |
| 1212 <td><div><a href="#hit1" | 1212 <td><div><a href="#hit6-1" |
| 1213 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" | 1213 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" |
| 1214 id="description1"> | 1214 id="description6-1"> |
| 1215 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 | 1215 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 |
| 1216 </a></div></td> | 1216 </a></div></td> |
| 1217 <td>36.2</td> | 1217 <td>36.2</td> |
| 1218 <td>36.2</td> | 1218 <td>36.2</td> |
| 1219 <td>88%</td> | 1219 <td>88%</td> |
| 1220 <td>3.148e-06</td> | 1220 <td>3.148e-06</td> |
| 1221 <td>95%</td> | 1221 <td>95%</td> |
| 1222 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">7</a></td> | 1222 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">7</a></td> |
| 1223 </tr> | 1223 </tr> |
| 1224 <tr> | 1224 <tr> |
| 1225 <td><div><a href="#hit2" | 1225 <td><div><a href="#hit6-2" |
| 1226 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" | 1226 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" |
| 1227 id="description2"> | 1227 id="description6-2"> |
| 1228 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 | 1228 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 |
| 1229 </a></div></td> | 1229 </a></div></td> |
| 1230 <td>36.2</td> | 1230 <td>36.2</td> |
| 1231 <td>36.2</td> | 1231 <td>36.2</td> |
| 1232 <td>88%</td> | 1232 <td>88%</td> |
| 1243 | 1243 |
| 1244 <section class=alignments> | 1244 <section class=alignments> |
| 1245 <h2>Alignments</h2> | 1245 <h2>Alignments</h2> |
| 1246 | 1246 |
| 1247 <div class=grey><div class=white> | 1247 <div class=grey><div class=white> |
| 1248 <div class=alignment id=hit1> | 1248 <div class=alignment id=hit6-1> |
| 1249 | 1249 |
| 1250 <div class=linkheader> | 1250 <div class=linkheader> |
| 1251 <div class=right><a href="#description1">Descriptions</a></div> | 1251 <div class=right><a href="#description6-1">Descriptions</a></div> |
| 1252 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> | 1252 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
| 1253 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | 1253 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> |
| 1254 </div> | 1254 </div> |
| 1255 | 1255 |
| 1256 <div class=title> | 1256 <div class=title> |
| 1261 <span class=b>Number of Matches:</span> 1 | 1261 <span class=b>Number of Matches:</span> 1 |
| 1262 </p> | 1262 </p> |
| 1263 </div> | 1263 </div> |
| 1264 | 1264 |
| 1265 | 1265 |
| 1266 <div class=hotspot> | 1266 <div class=hotspot id=hotspot6-1-1> |
| 1267 <p class=range> | 1267 <p class=range> |
| 1268 <span class=range>Range 1: 2344 to 2365</span> | 1268 <span class=range>Range 1: 2344 to 2365</span> |
| 1269 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=2344&to=2365">GenBank</a> | 1269 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=2344&to=2365">GenBank</a> |
| 1270 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=2344&to=2365">Graphics</a> | 1270 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=2344&to=2365">Graphics</a> |
| 1271 </p> | 1271 </p> |
| 1288 Subject 2344 ACATGAACAGCGCCCTGACCAC 2365</pre> | 1288 Subject 2344 ACATGAACAGCGCCCTGACCAC 2365</pre> |
| 1289 </div> | 1289 </div> |
| 1290 | 1290 |
| 1291 </div> | 1291 </div> |
| 1292 | 1292 |
| 1293 <div class=alignment id=hit2> | 1293 <div class=alignment id=hit6-2> |
| 1294 | 1294 |
| 1295 <div class=linkheader> | 1295 <div class=linkheader> |
| 1296 <div class=right><a href="#description2">Descriptions</a></div> | 1296 <div class=right><a href="#description6-2">Descriptions</a></div> |
| 1297 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> | 1297 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
| 1298 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | 1298 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> |
| 1299 </div> | 1299 </div> |
| 1300 | 1300 |
| 1301 <div class=title> | 1301 <div class=title> |
| 1306 <span class=b>Number of Matches:</span> 1 | 1306 <span class=b>Number of Matches:</span> 1 |
| 1307 </p> | 1307 </p> |
| 1308 </div> | 1308 </div> |
| 1309 | 1309 |
| 1310 | 1310 |
| 1311 <div class=hotspot> | 1311 <div class=hotspot id=hotspot6-2-1> |
| 1312 <p class=range> | 1312 <p class=range> |
| 1313 <span class=range>Range 1: 1541 to 1562</span> | 1313 <span class=range>Range 1: 1541 to 1562</span> |
| 1314 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=1541&to=1562">GenBank</a> | 1314 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=1541&to=1562">GenBank</a> |
| 1315 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=1541&to=1562">Graphics</a> | 1315 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=1541&to=1562">Graphics</a> |
| 1316 </p> | 1316 </p> |
| 1418 </div> | 1418 </div> |
| 1419 <div style="clear: left"></div> | 1419 <div style="clear: left"></div> |
| 1420 </div> | 1420 </div> |
| 1421 | 1421 |
| 1422 <a class=matchresult | 1422 <a class=matchresult |
| 1423 href="#hit1" | 1423 href="#hit7-1" |
| 1424 onmouseover='document.getElementById("defline7").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' | 1424 onmouseover='document.getElementById("defline7").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' |
| 1425 onmouseout='document.getElementById("defline7").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | 1425 onmouseout='document.getElementById("defline7").innerHTML="Mouse-over to show defline and scores, click to show alignments"' |
| 1426 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> | 1426 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> |
| 1427 <div class="matchrow graphicrow"> | 1427 <div class="matchrow graphicrow"> |
| 1428 <div class="matchitem graphicitem" | 1428 <div class="matchitem graphicitem" |
| 1429 style="background-color: green; width: 100.0%"></div> | 1429 style="background-color: green; width: 100.0%"></div> |
| 1430 </div> | 1430 </div> |
| 1431 </a> | 1431 </a> |
| 1432 | 1432 |
| 1433 <a class=matchresult | 1433 <a class=matchresult |
| 1434 href="#hit2" | 1434 href="#hit7-2" |
| 1435 onmouseover='document.getElementById("defline7").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' | 1435 onmouseover='document.getElementById("defline7").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' |
| 1436 onmouseout='document.getElementById("defline7").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | 1436 onmouseout='document.getElementById("defline7").innerHTML="Mouse-over to show defline and scores, click to show alignments"' |
| 1437 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> | 1437 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> |
| 1438 <div class="matchrow graphicrow"> | 1438 <div class="matchrow graphicrow"> |
| 1439 <div class="matchitem graphicitem" | 1439 <div class="matchitem graphicitem" |
| 1464 <th>E value</th> | 1464 <th>E value</th> |
| 1465 <th>Ident</th> | 1465 <th>Ident</th> |
| 1466 <th>Accession</th> | 1466 <th>Accession</th> |
| 1467 </tr> | 1467 </tr> |
| 1468 <tr> | 1468 <tr> |
| 1469 <td><div><a href="#hit1" | 1469 <td><div><a href="#hit7-1" |
| 1470 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" | 1470 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" |
| 1471 id="description1"> | 1471 id="description7-1"> |
| 1472 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 | 1472 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 |
| 1473 </a></div></td> | 1473 </a></div></td> |
| 1474 <td>67.9</td> | 1474 <td>67.9</td> |
| 1475 <td>67.9</td> | 1475 <td>67.9</td> |
| 1476 <td>100%</td> | 1476 <td>100%</td> |
| 1477 <td>3.564e-15</td> | 1477 <td>3.564e-15</td> |
| 1478 <td>86%</td> | 1478 <td>86%</td> |
| 1479 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">7</a></td> | 1479 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">7</a></td> |
| 1480 </tr> | 1480 </tr> |
| 1481 <tr> | 1481 <tr> |
| 1482 <td><div><a href="#hit2" | 1482 <td><div><a href="#hit7-2" |
| 1483 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" | 1483 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" |
| 1484 id="description2"> | 1484 id="description7-2"> |
| 1485 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 | 1485 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 |
| 1486 </a></div></td> | 1486 </a></div></td> |
| 1487 <td>67.9</td> | 1487 <td>67.9</td> |
| 1488 <td>67.9</td> | 1488 <td>67.9</td> |
| 1489 <td>100%</td> | 1489 <td>100%</td> |
| 1500 | 1500 |
| 1501 <section class=alignments> | 1501 <section class=alignments> |
| 1502 <h2>Alignments</h2> | 1502 <h2>Alignments</h2> |
| 1503 | 1503 |
| 1504 <div class=grey><div class=white> | 1504 <div class=grey><div class=white> |
| 1505 <div class=alignment id=hit1> | 1505 <div class=alignment id=hit7-1> |
| 1506 | 1506 |
| 1507 <div class=linkheader> | 1507 <div class=linkheader> |
| 1508 <div class=right><a href="#description1">Descriptions</a></div> | 1508 <div class=right><a href="#description7-1">Descriptions</a></div> |
| 1509 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> | 1509 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
| 1510 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | 1510 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> |
| 1511 </div> | 1511 </div> |
| 1512 | 1512 |
| 1513 <div class=title> | 1513 <div class=title> |
| 1518 <span class=b>Number of Matches:</span> 1 | 1518 <span class=b>Number of Matches:</span> 1 |
| 1519 </p> | 1519 </p> |
| 1520 </div> | 1520 </div> |
| 1521 | 1521 |
| 1522 | 1522 |
| 1523 <div class=hotspot> | 1523 <div class=hotspot id=hotspot7-1-1> |
| 1524 <p class=range> | 1524 <p class=range> |
| 1525 <span class=range>Range 1: 2319 to 2392</span> | 1525 <span class=range>Range 1: 2319 to 2392</span> |
| 1526 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=2319&to=2392">GenBank</a> | 1526 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=2319&to=2392">GenBank</a> |
| 1527 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=2319&to=2392">Graphics</a> | 1527 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=2319&to=2392">Graphics</a> |
| 1528 </p> | 1528 </p> |
| 1545 Subject 2319 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTCTTCGCCGTCCAGAA 2392</pre> | 1545 Subject 2319 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTCTTCGCCGTCCAGAA 2392</pre> |
| 1546 </div> | 1546 </div> |
| 1547 | 1547 |
| 1548 </div> | 1548 </div> |
| 1549 | 1549 |
| 1550 <div class=alignment id=hit2> | 1550 <div class=alignment id=hit7-2> |
| 1551 | 1551 |
| 1552 <div class=linkheader> | 1552 <div class=linkheader> |
| 1553 <div class=right><a href="#description2">Descriptions</a></div> | 1553 <div class=right><a href="#description7-2">Descriptions</a></div> |
| 1554 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> | 1554 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign">GenBank</a> |
| 1555 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> | 1555 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign">Graphics</a> |
| 1556 </div> | 1556 </div> |
| 1557 | 1557 |
| 1558 <div class=title> | 1558 <div class=title> |
| 1563 <span class=b>Number of Matches:</span> 1 | 1563 <span class=b>Number of Matches:</span> 1 |
| 1564 </p> | 1564 </p> |
| 1565 </div> | 1565 </div> |
| 1566 | 1566 |
| 1567 | 1567 |
| 1568 <div class=hotspot> | 1568 <div class=hotspot id=hotspot7-2-1> |
| 1569 <p class=range> | 1569 <p class=range> |
| 1570 <span class=range>Range 1: 1516 to 1589</span> | 1570 <span class=range>Range 1: 1516 to 1589</span> |
| 1571 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=1516&to=1589">GenBank</a> | 1571 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&log$=nuclalign&from=1516&to=1589">GenBank</a> |
| 1572 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=1516&to=1589">Graphics</a> | 1572 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&log$=nuclalign&from=1516&to=1589">Graphics</a> |
| 1573 </p> | 1573 </p> |
