Mercurial > repos > jankanis > blast2html2
comparison test-data/blast xml example4.xml @ 32:ce8f29efc0a1
fix tests
| author | Jan Kanis <jan.code@jankanis.nl> |
|---|---|
| date | Thu, 15 May 2014 17:22:02 +0200 |
| parents | test-data/Galaxy8-[blastn-short_EUginius_primers_probes.fasta_vs__EUginius_].blastxml@420d0508dcd6 |
| children | 0ef071bba164 |
comparison
equal
deleted
inserted
replaced
| 31:344cd76f6fd2 | 32:ce8f29efc0a1 |
|---|---|
| 1 <?xml version="1.0"?> | |
| 2 <!DOCTYPE BlastOutput PUBLIC "-//NCBI//NCBI BlastOutput/EN" "http://www.ncbi.nlm.nih.gov/dtd/NCBI_BlastOutput.dtd"> | |
| 3 <BlastOutput> | |
| 4 <BlastOutput_program>blastn</BlastOutput_program> | |
| 5 <BlastOutput_version>BLASTN 2.2.29+</BlastOutput_version> | |
| 6 <BlastOutput_reference>Stephen F. Altschul, Thomas L. Madden, Alejandro A. Sch&auml;ffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402.</BlastOutput_reference> | |
| 7 <BlastOutput_db>/opt/galaxy/blastdbs/EUginius_plasmid_insert</BlastOutput_db> | |
| 8 <BlastOutput_query-ID>Query_1</BlastOutput_query-ID> | |
| 9 <BlastOutput_query-def>Forward_Primer|NOST-Spec_(Genetic_ID)</BlastOutput_query-def> | |
| 10 <BlastOutput_query-len>20</BlastOutput_query-len> | |
| 11 <BlastOutput_param> | |
| 12 <Parameters> | |
| 13 <Parameters_expect>0.001</Parameters_expect> | |
| 14 <Parameters_sc-match>1</Parameters_sc-match> | |
| 15 <Parameters_sc-mismatch>-3</Parameters_sc-mismatch> | |
| 16 <Parameters_gap-open>5</Parameters_gap-open> | |
| 17 <Parameters_gap-extend>2</Parameters_gap-extend> | |
| 18 <Parameters_filter>L;m;</Parameters_filter> | |
| 19 </Parameters> | |
| 20 </BlastOutput_param> | |
| 21 <BlastOutput_iterations> | |
| 22 <Iteration> | |
| 23 <Iteration_iter-num>1</Iteration_iter-num> | |
| 24 <Iteration_query-ID>Query_1</Iteration_query-ID> | |
| 25 <Iteration_query-def>Forward_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def> | |
| 26 <Iteration_query-len>20</Iteration_query-len> | |
| 27 <Iteration_hits> | |
| 28 <Hit> | |
| 29 <Hit_num>1</Hit_num> | |
| 30 <Hit_id>gnl|BL_ORD_ID|5</Hit_id> | |
| 31 <Hit_def>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</Hit_def> | |
| 32 <Hit_accession>5</Hit_accession> | |
| 33 <Hit_len>2457</Hit_len> | |
| 34 <Hit_hsps> | |
| 35 <Hsp> | |
| 36 <Hsp_num>1</Hsp_num> | |
| 37 <Hsp_bit-score>40.14</Hsp_bit-score> | |
| 38 <Hsp_score>20</Hsp_score> | |
| 39 <Hsp_evalue>1.51296e-07</Hsp_evalue> | |
| 40 <Hsp_query-from>1</Hsp_query-from> | |
| 41 <Hsp_query-to>20</Hsp_query-to> | |
| 42 <Hsp_hit-from>2119</Hsp_hit-from> | |
| 43 <Hsp_hit-to>2138</Hsp_hit-to> | |
| 44 <Hsp_query-frame>1</Hsp_query-frame> | |
| 45 <Hsp_hit-frame>1</Hsp_hit-frame> | |
| 46 <Hsp_identity>20</Hsp_identity> | |
| 47 <Hsp_positive>20</Hsp_positive> | |
| 48 <Hsp_gaps>0</Hsp_gaps> | |
| 49 <Hsp_align-len>20</Hsp_align-len> | |
| 50 <Hsp_qseq>AGCGCGCAAACTAGGATAAA</Hsp_qseq> | |
| 51 <Hsp_hseq>AGCGCGCAAACTAGGATAAA</Hsp_hseq> | |
| 52 <Hsp_midline>||||||||||||||||||||</Hsp_midline> | |
| 53 </Hsp> | |
| 54 </Hit_hsps> | |
| 55 </Hit> | |
| 56 <Hit> | |
| 57 <Hit_num>2</Hit_num> | |
| 58 <Hit_id>gnl|BL_ORD_ID|2</Hit_id> | |
| 59 <Hit_def>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</Hit_def> | |
| 60 <Hit_accession>2</Hit_accession> | |
| 61 <Hit_len>323</Hit_len> | |
| 62 <Hit_hsps> | |
| 63 <Hsp> | |
| 64 <Hsp_num>1</Hsp_num> | |
| 65 <Hsp_bit-score>40.14</Hsp_bit-score> | |
| 66 <Hsp_score>20</Hsp_score> | |
| 67 <Hsp_evalue>1.51296e-07</Hsp_evalue> | |
| 68 <Hsp_query-from>1</Hsp_query-from> | |
| 69 <Hsp_query-to>20</Hsp_query-to> | |
| 70 <Hsp_hit-from>200</Hsp_hit-from> | |
| 71 <Hsp_hit-to>219</Hsp_hit-to> | |
| 72 <Hsp_query-frame>1</Hsp_query-frame> | |
| 73 <Hsp_hit-frame>1</Hsp_hit-frame> | |
| 74 <Hsp_identity>20</Hsp_identity> | |
| 75 <Hsp_positive>20</Hsp_positive> | |
| 76 <Hsp_gaps>0</Hsp_gaps> | |
| 77 <Hsp_align-len>20</Hsp_align-len> | |
| 78 <Hsp_qseq>AGCGCGCAAACTAGGATAAA</Hsp_qseq> | |
| 79 <Hsp_hseq>AGCGCGCAAACTAGGATAAA</Hsp_hseq> | |
| 80 <Hsp_midline>||||||||||||||||||||</Hsp_midline> | |
| 81 </Hsp> | |
| 82 </Hit_hsps> | |
| 83 </Hit> | |
| 84 </Iteration_hits> | |
| 85 <Iteration_stat> | |
| 86 <Statistics> | |
| 87 <Statistics_db-num>8</Statistics_db-num> | |
| 88 <Statistics_db-len>15339</Statistics_db-len> | |
| 89 <Statistics_hsp-len>8</Statistics_hsp-len> | |
| 90 <Statistics_eff-space>183300</Statistics_eff-space> | |
| 91 <Statistics_kappa>0.710602795216363</Statistics_kappa> | |
| 92 <Statistics_lambda>1.37406312246009</Statistics_lambda> | |
| 93 <Statistics_entropy>1.30724660390929</Statistics_entropy> | |
| 94 </Statistics> | |
| 95 </Iteration_stat> | |
| 96 </Iteration> | |
| 97 <Iteration> | |
| 98 <Iteration_iter-num>2</Iteration_iter-num> | |
| 99 <Iteration_query-ID>Query_2</Iteration_query-ID> | |
| 100 <Iteration_query-def>Reverse_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def> | |
| 101 <Iteration_query-len>20</Iteration_query-len> | |
| 102 <Iteration_hits> | |
| 103 </Iteration_hits> | |
| 104 <Iteration_stat> | |
| 105 <Statistics> | |
| 106 <Statistics_db-num>8</Statistics_db-num> | |
| 107 <Statistics_db-len>15339</Statistics_db-len> | |
| 108 <Statistics_hsp-len>8</Statistics_hsp-len> | |
| 109 <Statistics_eff-space>183300</Statistics_eff-space> | |
| 110 <Statistics_kappa>0.710602795216363</Statistics_kappa> | |
| 111 <Statistics_lambda>1.37406312246009</Statistics_lambda> | |
| 112 <Statistics_entropy>1.30724660390929</Statistics_entropy> | |
| 113 </Statistics> | |
| 114 </Iteration_stat> | |
| 115 <Iteration_message>No hits found</Iteration_message> | |
| 116 </Iteration> | |
| 117 <Iteration> | |
| 118 <Iteration_iter-num>3</Iteration_iter-num> | |
| 119 <Iteration_query-ID>Query_3</Iteration_query-ID> | |
| 120 <Iteration_query-def>Probe|NOST-Spec_(Genetic_ID)</Iteration_query-def> | |
| 121 <Iteration_query-len>20</Iteration_query-len> | |
| 122 <Iteration_hits> | |
| 123 <Hit> | |
| 124 <Hit_num>1</Hit_num> | |
| 125 <Hit_id>gnl|BL_ORD_ID|5</Hit_id> | |
| 126 <Hit_def>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</Hit_def> | |
| 127 <Hit_accession>5</Hit_accession> | |
| 128 <Hit_len>2457</Hit_len> | |
| 129 <Hit_hsps> | |
| 130 <Hsp> | |
| 131 <Hsp_num>1</Hsp_num> | |
| 132 <Hsp_bit-score>40.14</Hsp_bit-score> | |
| 133 <Hsp_score>20</Hsp_score> | |
| 134 <Hsp_evalue>1.51296e-07</Hsp_evalue> | |
| 135 <Hsp_query-from>1</Hsp_query-from> | |
| 136 <Hsp_query-to>20</Hsp_query-to> | |
| 137 <Hsp_hit-from>2143</Hsp_hit-from> | |
| 138 <Hsp_hit-to>2162</Hsp_hit-to> | |
| 139 <Hsp_query-frame>1</Hsp_query-frame> | |
| 140 <Hsp_hit-frame>1</Hsp_hit-frame> | |
| 141 <Hsp_identity>20</Hsp_identity> | |
| 142 <Hsp_positive>20</Hsp_positive> | |
| 143 <Hsp_gaps>0</Hsp_gaps> | |
| 144 <Hsp_align-len>20</Hsp_align-len> | |
| 145 <Hsp_qseq>CGCGCGCGGTGTCATCTATG</Hsp_qseq> | |
| 146 <Hsp_hseq>CGCGCGCGGTGTCATCTATG</Hsp_hseq> | |
| 147 <Hsp_midline>||||||||||||||||||||</Hsp_midline> | |
| 148 </Hsp> | |
| 149 </Hit_hsps> | |
| 150 </Hit> | |
| 151 <Hit> | |
| 152 <Hit_num>2</Hit_num> | |
| 153 <Hit_id>gnl|BL_ORD_ID|2</Hit_id> | |
| 154 <Hit_def>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</Hit_def> | |
| 155 <Hit_accession>2</Hit_accession> | |
| 156 <Hit_len>323</Hit_len> | |
| 157 <Hit_hsps> | |
| 158 <Hsp> | |
| 159 <Hsp_num>1</Hsp_num> | |
| 160 <Hsp_bit-score>40.14</Hsp_bit-score> | |
| 161 <Hsp_score>20</Hsp_score> | |
| 162 <Hsp_evalue>1.51296e-07</Hsp_evalue> | |
| 163 <Hsp_query-from>1</Hsp_query-from> | |
| 164 <Hsp_query-to>20</Hsp_query-to> | |
| 165 <Hsp_hit-from>224</Hsp_hit-from> | |
| 166 <Hsp_hit-to>243</Hsp_hit-to> | |
| 167 <Hsp_query-frame>1</Hsp_query-frame> | |
| 168 <Hsp_hit-frame>1</Hsp_hit-frame> | |
| 169 <Hsp_identity>20</Hsp_identity> | |
| 170 <Hsp_positive>20</Hsp_positive> | |
| 171 <Hsp_gaps>0</Hsp_gaps> | |
| 172 <Hsp_align-len>20</Hsp_align-len> | |
| 173 <Hsp_qseq>CGCGCGCGGTGTCATCTATG</Hsp_qseq> | |
| 174 <Hsp_hseq>CGCGCGCGGTGTCATCTATG</Hsp_hseq> | |
| 175 <Hsp_midline>||||||||||||||||||||</Hsp_midline> | |
| 176 </Hsp> | |
| 177 </Hit_hsps> | |
| 178 </Hit> | |
| 179 <Hit> | |
| 180 <Hit_num>3</Hit_num> | |
| 181 <Hit_id>gnl|BL_ORD_ID|1</Hit_id> | |
| 182 <Hit_def>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000</Hit_def> | |
| 183 <Hit_accession>1</Hit_accession> | |
| 184 <Hit_len>1045</Hit_len> | |
| 185 <Hit_hsps> | |
| 186 <Hsp> | |
| 187 <Hsp_num>1</Hsp_num> | |
| 188 <Hsp_bit-score>34.1929</Hsp_bit-score> | |
| 189 <Hsp_score>17</Hsp_score> | |
| 190 <Hsp_evalue>9.33411e-06</Hsp_evalue> | |
| 191 <Hsp_query-from>4</Hsp_query-from> | |
| 192 <Hsp_query-to>20</Hsp_query-to> | |
| 193 <Hsp_hit-from>2</Hsp_hit-from> | |
| 194 <Hsp_hit-to>18</Hsp_hit-to> | |
| 195 <Hsp_query-frame>1</Hsp_query-frame> | |
| 196 <Hsp_hit-frame>1</Hsp_hit-frame> | |
| 197 <Hsp_identity>17</Hsp_identity> | |
| 198 <Hsp_positive>17</Hsp_positive> | |
| 199 <Hsp_gaps>0</Hsp_gaps> | |
| 200 <Hsp_align-len>17</Hsp_align-len> | |
| 201 <Hsp_qseq>GCGCGGTGTCATCTATG</Hsp_qseq> | |
| 202 <Hsp_hseq>GCGCGGTGTCATCTATG</Hsp_hseq> | |
| 203 <Hsp_midline>|||||||||||||||||</Hsp_midline> | |
| 204 </Hsp> | |
| 205 </Hit_hsps> | |
| 206 </Hit> | |
| 207 </Iteration_hits> | |
| 208 <Iteration_stat> | |
| 209 <Statistics> | |
| 210 <Statistics_db-num>8</Statistics_db-num> | |
| 211 <Statistics_db-len>15339</Statistics_db-len> | |
| 212 <Statistics_hsp-len>8</Statistics_hsp-len> | |
| 213 <Statistics_eff-space>183300</Statistics_eff-space> | |
| 214 <Statistics_kappa>0.710602795216363</Statistics_kappa> | |
| 215 <Statistics_lambda>1.37406312246009</Statistics_lambda> | |
| 216 <Statistics_entropy>1.30724660390929</Statistics_entropy> | |
| 217 </Statistics> | |
| 218 </Iteration_stat> | |
| 219 </Iteration> | |
| 220 <Iteration> | |
| 221 <Iteration_iter-num>4</Iteration_iter-num> | |
| 222 <Iteration_query-ID>Query_4</Iteration_query-ID> | |
| 223 <Iteration_query-def>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def> | |
| 224 <Iteration_query-len>24</Iteration_query-len> | |
| 225 <Iteration_hits> | |
| 226 </Iteration_hits> | |
| 227 <Iteration_stat> | |
| 228 <Statistics> | |
| 229 <Statistics_db-num>8</Statistics_db-num> | |
| 230 <Statistics_db-len>15339</Statistics_db-len> | |
| 231 <Statistics_hsp-len>9</Statistics_hsp-len> | |
| 232 <Statistics_eff-space>229005</Statistics_eff-space> | |
| 233 <Statistics_kappa>0.710602795216363</Statistics_kappa> | |
| 234 <Statistics_lambda>1.37406312246009</Statistics_lambda> | |
| 235 <Statistics_entropy>1.30724660390929</Statistics_entropy> | |
| 236 </Statistics> | |
| 237 </Iteration_stat> | |
| 238 <Iteration_message>No hits found</Iteration_message> | |
| 239 </Iteration> | |
| 240 <Iteration> | |
| 241 <Iteration_iter-num>5</Iteration_iter-num> | |
| 242 <Iteration_query-ID>Query_5</Iteration_query-ID> | |
| 243 <Iteration_query-def>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def> | |
| 244 <Iteration_query-len>20</Iteration_query-len> | |
| 245 <Iteration_hits> | |
| 246 </Iteration_hits> | |
| 247 <Iteration_stat> | |
| 248 <Statistics> | |
| 249 <Statistics_db-num>8</Statistics_db-num> | |
| 250 <Statistics_db-len>15339</Statistics_db-len> | |
| 251 <Statistics_hsp-len>8</Statistics_hsp-len> | |
| 252 <Statistics_eff-space>183300</Statistics_eff-space> | |
| 253 <Statistics_kappa>0.710602795216363</Statistics_kappa> | |
| 254 <Statistics_lambda>1.37406312246009</Statistics_lambda> | |
| 255 <Statistics_entropy>1.30724660390929</Statistics_entropy> | |
| 256 </Statistics> | |
| 257 </Iteration_stat> | |
| 258 <Iteration_message>No hits found</Iteration_message> | |
| 259 </Iteration> | |
| 260 <Iteration> | |
| 261 <Iteration_iter-num>6</Iteration_iter-num> | |
| 262 <Iteration_query-ID>Query_6</Iteration_query-ID> | |
| 263 <Iteration_query-def>Probe|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def> | |
| 264 <Iteration_query-len>25</Iteration_query-len> | |
| 265 <Iteration_hits> | |
| 266 <Hit> | |
| 267 <Hit_num>1</Hit_num> | |
| 268 <Hit_id>gnl|BL_ORD_ID|7</Hit_id> | |
| 269 <Hit_def>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</Hit_def> | |
| 270 <Hit_accession>7</Hit_accession> | |
| 271 <Hit_len>4983</Hit_len> | |
| 272 <Hit_hsps> | |
| 273 <Hsp> | |
| 274 <Hsp_num>1</Hsp_num> | |
| 275 <Hsp_bit-score>36.1753</Hsp_bit-score> | |
| 276 <Hsp_score>18</Hsp_score> | |
| 277 <Hsp_evalue>3.14801e-06</Hsp_evalue> | |
| 278 <Hsp_query-from>1</Hsp_query-from> | |
| 279 <Hsp_query-to>22</Hsp_query-to> | |
| 280 <Hsp_hit-from>2344</Hsp_hit-from> | |
| 281 <Hsp_hit-to>2365</Hsp_hit-to> | |
| 282 <Hsp_query-frame>1</Hsp_query-frame> | |
| 283 <Hsp_hit-frame>1</Hsp_hit-frame> | |
| 284 <Hsp_identity>21</Hsp_identity> | |
| 285 <Hsp_positive>21</Hsp_positive> | |
| 286 <Hsp_gaps>0</Hsp_gaps> | |
| 287 <Hsp_align-len>22</Hsp_align-len> | |
| 288 <Hsp_qseq>ACATGAACAGCGCCTTGACCAC</Hsp_qseq> | |
| 289 <Hsp_hseq>ACATGAACAGCGCCCTGACCAC</Hsp_hseq> | |
| 290 <Hsp_midline>|||||||||||||| |||||||</Hsp_midline> | |
| 291 </Hsp> | |
| 292 </Hit_hsps> | |
| 293 </Hit> | |
| 294 <Hit> | |
| 295 <Hit_num>2</Hit_num> | |
| 296 <Hit_id>gnl|BL_ORD_ID|6</Hit_id> | |
| 297 <Hit_def>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</Hit_def> | |
| 298 <Hit_accession>6</Hit_accession> | |
| 299 <Hit_len>4180</Hit_len> | |
| 300 <Hit_hsps> | |
| 301 <Hsp> | |
| 302 <Hsp_num>1</Hsp_num> | |
| 303 <Hsp_bit-score>36.1753</Hsp_bit-score> | |
| 304 <Hsp_score>18</Hsp_score> | |
| 305 <Hsp_evalue>3.14801e-06</Hsp_evalue> | |
| 306 <Hsp_query-from>1</Hsp_query-from> | |
| 307 <Hsp_query-to>22</Hsp_query-to> | |
| 308 <Hsp_hit-from>1541</Hsp_hit-from> | |
| 309 <Hsp_hit-to>1562</Hsp_hit-to> | |
| 310 <Hsp_query-frame>1</Hsp_query-frame> | |
| 311 <Hsp_hit-frame>1</Hsp_hit-frame> | |
| 312 <Hsp_identity>21</Hsp_identity> | |
| 313 <Hsp_positive>21</Hsp_positive> | |
| 314 <Hsp_gaps>0</Hsp_gaps> | |
| 315 <Hsp_align-len>22</Hsp_align-len> | |
| 316 <Hsp_qseq>ACATGAACAGCGCCTTGACCAC</Hsp_qseq> | |
| 317 <Hsp_hseq>ACATGAACAGCGCCCTGACCAC</Hsp_hseq> | |
| 318 <Hsp_midline>|||||||||||||| |||||||</Hsp_midline> | |
| 319 </Hsp> | |
| 320 </Hit_hsps> | |
| 321 </Hit> | |
| 322 </Iteration_hits> | |
| 323 <Iteration_stat> | |
| 324 <Statistics> | |
| 325 <Statistics_db-num>8</Statistics_db-num> | |
| 326 <Statistics_db-len>15339</Statistics_db-len> | |
| 327 <Statistics_hsp-len>9</Statistics_hsp-len> | |
| 328 <Statistics_eff-space>244272</Statistics_eff-space> | |
| 329 <Statistics_kappa>0.710602795216363</Statistics_kappa> | |
| 330 <Statistics_lambda>1.37406312246009</Statistics_lambda> | |
| 331 <Statistics_entropy>1.30724660390929</Statistics_entropy> | |
| 332 </Statistics> | |
| 333 </Iteration_stat> | |
| 334 </Iteration> | |
| 335 <Iteration> | |
| 336 <Iteration_iter-num>7</Iteration_iter-num> | |
| 337 <Iteration_query-ID>Query_7</Iteration_query-ID> | |
| 338 <Iteration_query-def>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def> | |
| 339 <Iteration_query-len>74</Iteration_query-len> | |
| 340 <Iteration_hits> | |
| 341 <Hit> | |
| 342 <Hit_num>1</Hit_num> | |
| 343 <Hit_id>gnl|BL_ORD_ID|7</Hit_id> | |
| 344 <Hit_def>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</Hit_def> | |
| 345 <Hit_accession>7</Hit_accession> | |
| 346 <Hit_len>4983</Hit_len> | |
| 347 <Hit_hsps> | |
| 348 <Hsp> | |
| 349 <Hsp_num>1</Hsp_num> | |
| 350 <Hsp_bit-score>67.8929</Hsp_bit-score> | |
| 351 <Hsp_score>34</Hsp_score> | |
| 352 <Hsp_evalue>3.56369e-15</Hsp_evalue> | |
| 353 <Hsp_query-from>1</Hsp_query-from> | |
| 354 <Hsp_query-to>74</Hsp_query-to> | |
| 355 <Hsp_hit-from>2319</Hsp_hit-from> | |
| 356 <Hsp_hit-to>2392</Hsp_hit-to> | |
| 357 <Hsp_query-frame>1</Hsp_query-frame> | |
| 358 <Hsp_hit-frame>1</Hsp_hit-frame> | |
| 359 <Hsp_identity>64</Hsp_identity> | |
| 360 <Hsp_positive>64</Hsp_positive> | |
| 361 <Hsp_gaps>0</Hsp_gaps> | |
| 362 <Hsp_align-len>74</Hsp_align-len> | |
| 363 <Hsp_qseq>GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTGTTCGCAGTCCAGAA</Hsp_qseq> | |
| 364 <Hsp_hseq>GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTCTTCGCCGTCCAGAA</Hsp_hseq> | |
| 365 <Hsp_midline>||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | ||||| ||||||||</Hsp_midline> | |
| 366 </Hsp> | |
| 367 </Hit_hsps> | |
| 368 </Hit> | |
| 369 <Hit> | |
| 370 <Hit_num>2</Hit_num> | |
| 371 <Hit_id>gnl|BL_ORD_ID|6</Hit_id> | |
| 372 <Hit_def>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</Hit_def> | |
| 373 <Hit_accession>6</Hit_accession> | |
| 374 <Hit_len>4180</Hit_len> | |
| 375 <Hit_hsps> | |
| 376 <Hsp> | |
| 377 <Hsp_num>1</Hsp_num> | |
| 378 <Hsp_bit-score>67.8929</Hsp_bit-score> | |
| 379 <Hsp_score>34</Hsp_score> | |
| 380 <Hsp_evalue>3.56369e-15</Hsp_evalue> | |
| 381 <Hsp_query-from>1</Hsp_query-from> | |
| 382 <Hsp_query-to>74</Hsp_query-to> | |
| 383 <Hsp_hit-from>1516</Hsp_hit-from> | |
| 384 <Hsp_hit-to>1589</Hsp_hit-to> | |
| 385 <Hsp_query-frame>1</Hsp_query-frame> | |
| 386 <Hsp_hit-frame>1</Hsp_hit-frame> | |
| 387 <Hsp_identity>64</Hsp_identity> | |
| 388 <Hsp_positive>64</Hsp_positive> | |
| 389 <Hsp_gaps>0</Hsp_gaps> | |
| 390 <Hsp_align-len>74</Hsp_align-len> | |
| 391 <Hsp_qseq>GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTGTTCGCAGTCCAGAA</Hsp_qseq> | |
| 392 <Hsp_hseq>GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTCTTCGCCGTCCAGAA</Hsp_hseq> | |
| 393 <Hsp_midline>||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | ||||| ||||||||</Hsp_midline> | |
| 394 </Hsp> | |
| 395 </Hit_hsps> | |
| 396 </Hit> | |
| 397 </Iteration_hits> | |
| 398 <Iteration_stat> | |
| 399 <Statistics> | |
| 400 <Statistics_db-num>8</Statistics_db-num> | |
| 401 <Statistics_db-len>15339</Statistics_db-len> | |
| 402 <Statistics_hsp-len>10</Statistics_hsp-len> | |
| 403 <Statistics_eff-space>976576</Statistics_eff-space> | |
| 404 <Statistics_kappa>0.710602795216363</Statistics_kappa> | |
| 405 <Statistics_lambda>1.37406312246009</Statistics_lambda> | |
| 406 <Statistics_entropy>1.30724660390929</Statistics_entropy> | |
| 407 </Statistics> | |
| 408 </Iteration_stat> | |
| 409 </Iteration> | |
| 410 </BlastOutput_iterations> | |
| 411 </BlastOutput> | |
| 412 |
