Mercurial > repos > jankanis > blast2html2
annotate test-data/blast xml example3.html @ 43:0d5d90291ce2
another attempt at getting dependencies right
| author | Jan Kanis <jan.code@jankanis.nl> |
|---|---|
| date | Tue, 20 May 2014 14:56:10 +0200 |
| parents | 3bb5da68305e |
| children | f611cf649c90 |
| rev | line source |
|---|---|
| 32 | 1 <!DOCTYPE html> |
| 2 <html> | |
| 3 <head> | |
| 4 <meta charset="UTF-8"> | |
|
33
3bb5da68305e
add test update script, add url to github page
Jan Kanis <jan.code@jankanis.nl>
parents:
32
diff
changeset
|
5 <meta name=generator content="blast2html; see https://github.com/thehyve/blast2html/"> |
| 32 | 6 |
| 7 <title>Blast output</title> | |
| 8 | |
| 9 <style> | |
| 10 body { | |
| 11 color: #333333; | |
| 12 font-family: Arial,Sans-Serif; | |
| 13 } | |
| 14 | |
| 15 :link { | |
| 16 color: #336699; | |
| 17 } | |
| 18 | |
| 19 .right { | |
| 20 float: right; | |
| 21 } | |
| 22 | |
| 23 /* Galaxy with html sanitization enabled strips the header of this html page. If so, show the user a warning.*/ | |
| 24 #strip_html_warning { | |
| 25 display: none; | |
| 26 } | |
| 27 | |
| 28 #content { | |
| 29 margin: 0 2em; | |
| 30 padding: 0.5em; | |
| 31 border: 1px solid #888888; | |
| 32 background-color: #d3dff5; | |
| 33 } | |
| 34 | |
| 35 h1, h2, h3, h4, h5, h6 { | |
| 36 color: #2A6979; | |
| 37 font-family: arial,verdana,sans-serif; | |
| 38 letter-spacing: -1px; | |
| 39 margin: 1.2em 0 0.3em; | |
| 40 } | |
| 41 | |
| 42 h1 { | |
| 43 border-bottom: 1px solid #CCCCCC; | |
| 44 font-size: 150%; | |
| 45 padding-bottom: 0.1em; | |
| 46 } | |
| 47 | |
| 48 h2 { | |
| 49 font-size: 120%; | |
| 50 font-weight: bold; | |
| 51 } | |
| 52 | |
| 53 h4.darkHeader { | |
| 54 color: #4D4D4D; | |
| 55 letter-spacing: 0; | |
| 56 font-weight: bold; | |
| 57 } | |
| 58 | |
| 59 #nodata { | |
| 60 font-weight: bold; | |
| 61 } | |
| 62 | |
| 63 .index { | |
| 64 margin-bottom: 3em; | |
| 65 } | |
| 66 .index div.indexentry { | |
| 67 margin: 1.2em 1.6em; | |
| 68 font-weight: bold; | |
| 69 font-size: 100%; | |
| 70 } | |
| 71 | |
| 72 .headerdata { | |
| 73 font-size: 90%; | |
| 74 } | |
| 75 .headerdata .param { | |
| 76 font-weight: bold; | |
| 77 text-align: right; | |
| 78 padding: 0 1em; | |
| 79 } | |
| 80 | |
| 81 .grey { | |
| 82 background-color: #eeeeee; | |
| 83 border: 1px solid #cccccc; | |
| 84 padding: 1em; | |
| 85 } | |
| 86 | |
| 87 .white { | |
| 88 background-color: white; | |
| 89 border: 1px solid #cccccc; | |
| 90 padding: 1.5em 2%; | |
| 91 } | |
| 92 | |
| 93 .graphicrow { | |
| 94 clear: left; | |
| 95 width: 100%; | |
| 96 } | |
| 97 | |
| 98 .graphicitem { | |
| 99 float: left; | |
| 100 } | |
| 101 | |
| 102 | |
| 103 | |
| 104 .graphics .grey { | |
| 105 text-align: center; | |
| 106 } | |
| 107 | |
| 108 .graphic { | |
| 109 background-color: white; | |
| 110 border: 2px solid black; | |
| 111 padding: 1.5em; | |
| 112 margin: auto; | |
| 113 } | |
| 114 | |
| 115 .centered, .defline, div.legend, div.tablewrapper { | |
| 116 margin-left: auto; | |
| 117 margin-right: auto; | |
| 118 } | |
| 119 | |
| 120 .defline { | |
| 121 background-color: white; | |
| 122 border: 1px solid black; | |
| 123 margin: .5em auto; | |
| 124 padding-left: .2em; | |
| 125 padding-right: .2em; | |
| 126 max-width: 50em; | |
| 127 text-align: left; | |
| 128 height: 2.8em; | |
| 129 overflow-y: hidden; | |
| 130 } | |
| 131 | |
| 132 div.legend { | |
| 133 max-width: 40em; | |
| 134 } | |
| 135 div.legend div { | |
| 136 width: 100%; | |
| 137 color: white; | |
| 138 font-weight: bold; | |
| 139 border-spacing: 0; | |
| 140 } | |
| 141 div.legend div .graphicitem { | |
| 142 width: 20%; | |
| 143 padding: 0; | |
| 144 margin: 0; | |
| 145 border: none; | |
| 146 } | |
| 147 | |
| 148 div.tablewrapper { | |
| 149 width: 50%; | |
| 150 min-width: 60em; | |
| 151 } | |
| 152 | |
| 153 /* For small widths we give the graphic 100% */ | |
| 154 @media (max-width: 72.5em) { | |
| 155 div.tablewrapper { | |
| 156 width: 100%; | |
| 157 min-width: 0px; | |
| 158 } | |
| 159 } | |
| 160 | |
| 161 .scale { | |
| 162 width: 100%; | |
| 163 margin: .5em 0; | |
| 164 font-weight: bold; | |
| 165 } | |
| 166 .scale div { | |
| 167 color: red; | |
| 168 text-align: left; | |
| 169 } | |
| 170 .scale .graphicrow { | |
| 171 margin: .5em 0 .5em 0; | |
| 172 color: white; | |
| 173 } | |
| 174 .scale .graphicitem { | |
| 175 position: relative; | |
| 176 } | |
| 177 .scale .graphicitem div { | |
| 178 margin: 0 1px; | |
| 179 padding: 0 2px; | |
| 180 text-align: right; | |
| 181 background-color: red; | |
| 182 color: white; | |
| 183 } | |
| 184 .scale .graphicitem:first-child div { | |
| 185 margin-left: 0px; | |
| 186 } | |
| 187 .scale .graphicitem:last-child div { | |
| 188 margin-right: 0px; | |
| 189 } | |
| 190 .scale .graphicitem .lastlabel { | |
| 191 position: absolute; | |
| 192 top: 0px; | |
| 193 left: 100%; | |
| 194 background-color: transparent; | |
| 195 color: red; | |
| 196 } | |
| 197 | |
| 198 a.matchresult { | |
| 199 display: block; | |
| 200 margin: 0; | |
| 201 padding: 0; | |
| 202 } | |
| 203 div.matchrow { | |
| 204 margin-top: 4px; | |
| 205 } | |
| 206 div.matchrow, div.matchitem { | |
| 207 height: 4px; | |
| 208 } | |
| 209 | |
| 210 | |
| 211 table.descriptiontable { | |
| 212 font-size: 85%; | |
| 213 border: 1px solid #97b0c8; | |
| 214 border-spacing: 0; | |
| 215 color: #222222; | |
| 216 line-height: 1.3em; | |
| 217 background-color: white; | |
| 218 } | |
| 219 table.descriptiontable col:first-child { | |
| 220 width: 100%; | |
| 221 } | |
| 222 table.descriptiontable tr:hover { | |
| 223 background-color: #D5DEE3; | |
| 224 } | |
| 225 table.descriptiontable th { | |
| 226 color: #14376C; | |
| 227 font-weight: normal; | |
| 228 background-color: #F0F0F0; | |
| 229 background: linear-gradient(#FFFFFF, #F0F0F0); | |
| 230 border-bottom: 1px solid #D4DFE9; | |
| 231 border-right: 1px solid #CFCFCF; | |
| 232 border-left: 0px solid black; | |
| 233 border-top: 0px solid black; | |
| 234 } | |
| 235 table.descriptiontable td { | |
| 236 overflow: hidden; | |
| 237 text-align: center; | |
| 238 padding: .4em .8em; | |
| 239 } | |
| 240 table.descriptiontable td div { | |
| 241 width: 1em; | |
| 242 overflow: visible; | |
| 243 white-space: nowrap; | |
| 244 text-align: left; | |
| 245 } | |
| 246 | |
| 247 | |
| 248 | |
| 249 .alignments .white { | |
| 250 padding: 1.5em 1em; | |
| 251 } | |
| 252 | |
| 253 .alignment { | |
| 254 border-top: 1px solid black; | |
| 255 padding-left: 1em; | |
| 256 padding-right: 1em; | |
| 257 } | |
| 258 | |
| 259 div.linkheader { | |
| 260 padding-top: .2em; | |
| 261 font-size: 85%; | |
| 262 color: #14376C; | |
| 263 } | |
| 264 div.linkheader a.linkheader { | |
| 265 margin-right: 1em; | |
| 266 } | |
| 267 div.linkheader .right a { | |
| 268 text-decoration: none; | |
| 269 } | |
| 270 | |
| 271 .title .hittitle { | |
| 272 color: #222222; | |
| 273 margin-bottom: .3em; | |
| 274 } | |
| 275 .title .titleinfo { | |
| 276 font-size: 80%; | |
| 277 margin-top: 0; | |
| 278 margin-bottom: .3em; | |
| 279 } | |
| 280 .title .titleinfo .b { | |
| 281 color: #606060; | |
| 282 font-weight: bold; | |
| 283 font-size: 90%; | |
| 284 } | |
| 285 | |
| 286 .moretitles { | |
| 287 margin: 1.2em; | |
| 288 } | |
| 289 .moretitles .titleinfo { | |
| 290 margin: 0; | |
| 291 padding: 0; | |
| 292 } | |
| 293 .moretitles .hittitle { | |
| 294 margin: .4em 0 .2em 0; | |
| 295 padding: 0; | |
| 296 } | |
| 297 | |
| 298 a.showmoretitles { | |
| 299 font-size: 75%; | |
| 300 color: #336699; | |
| 301 font-weight: bold; | |
| 302 margin-top: 0; | |
| 303 } | |
| 304 a.showmoretitles:hover { | |
| 305 } | |
| 306 | |
| 307 .hotspot { | |
| 308 color: #606060; | |
| 309 font-family: verdana, arial, sans-serif; | |
| 310 margin-bottom: 2.5em; | |
| 311 } | |
| 312 | |
| 313 .hotspot p.range { | |
| 314 font-size: 70%; | |
| 315 margin-top: 0; | |
| 316 margin-top: 1em; | |
| 317 margin-bottom: .2em; | |
| 318 } | |
| 319 .hotspot p.range span.range { | |
| 320 font-weight: bold; | |
| 321 } | |
| 322 .hotspot p.range a.range { | |
| 323 margin-left: .5em; | |
| 324 } | |
| 325 | |
| 326 table.hotspotstable { | |
| 327 border-top: 1px solid; | |
| 328 border-bottom: 1px solid; | |
| 329 text-align: left; | |
| 330 border-collapse: collapse; | |
| 331 } | |
| 332 table.hotspotstable th, table.hotspotstable td { | |
| 333 padding: .1em 1em; | |
| 334 } | |
| 335 table.hotspotstable th { | |
| 336 font-size: 70%; | |
| 337 } | |
| 338 table.hotspotstable td { | |
| 339 min-width: 7em; | |
| 340 color: #222222; | |
| 341 font-size: 80%; | |
| 342 } | |
| 343 | |
| 344 pre.alignmentgraphic { | |
| 345 color: #222222; | |
| 346 } | |
| 347 | |
| 348 footer { | |
| 349 text-align: center; | |
| 350 color: #cccccc; | |
| 351 font-size: 70%; | |
| 352 margin-top: 1em; | |
| 353 } | |
| 354 footer :link { | |
| 355 color: #5588cc; | |
| 356 } | |
| 357 | |
| 358 </style> | |
| 359 | |
| 360 <script type="text/javascript"> | |
| 361 function toggle_visibility(id) { | |
| 362 var e = document.getElementById(id); | |
| 363 if(e.style.display != 'block') | |
| 364 e.style.display = 'block'; | |
| 365 else | |
| 366 e.style.display = 'none'; | |
| 367 } | |
| 368 </script> | |
| 369 | |
| 370 </head> | |
| 371 | |
| 372 | |
| 373 <body> | |
| 374 | |
| 375 <div id="strip_html_warning"> | |
| 376 <!-- This div should be hidden by the header css block. Galaxy | |
| 377 strips all css, breaking this page but making this warning | |
| 378 visible. This warning contains some ugly old skool tabular html | |
| 379 layout that is not stripped. --> | |
| 380 <table bgcolor="#FFE5C9"><tr><td><font color="red"><b> | |
| 381 <font size=5><center>This html page seems to have been stripped by Galaxy.</center></font> | |
| 382 Disable Galaxy's html sanitization feature to view the full page (see <font face=monospace>sanitize_all_html</font> in your galaxy's universe_wsgi.ini), or download this page instead of viewing it in Galaxy. | |
| 383 </b></font></td></tr></table> | |
| 384 </div> | |
| 385 | |
| 386 <div id=content> | |
| 387 | |
| 388 | |
| 389 <section class=index> | |
| 390 <h1>Queries</h1> | |
| 391 | |
| 392 <div class=indexentry><a href="#match1"> | |
| 393 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 394 (20 letters, 0 hits) | |
| 395 </a></div> | |
| 396 <div class=indexentry><a href="#match2"> | |
| 397 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 398 (20 letters, 0 hits) | |
| 399 </a></div> | |
| 400 <div class=indexentry><a href="#match3"> | |
| 401 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 402 (20 letters, 1 hits) | |
| 403 </a></div> | |
| 404 <div class=indexentry><a href="#match4"> | |
| 405 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 406 (20 letters, 0 hits) | |
| 407 </a></div> | |
| 408 <div class=indexentry><a href="#match5"> | |
| 409 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 410 (20 letters, 0 hits) | |
| 411 </a></div> | |
| 412 <div class=indexentry><a href="#match6"> | |
| 413 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 414 (20 letters, 1 hits) | |
| 415 </a></div> | |
| 416 <div class=indexentry><a href="#match7"> | |
| 417 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 418 (20 letters, 0 hits) | |
| 419 </a></div> | |
| 420 <div class=indexentry><a href="#match8"> | |
| 421 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 422 (20 letters, 0 hits) | |
| 423 </a></div> | |
| 424 <div class=indexentry><a href="#match9"> | |
| 425 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 426 (20 letters, 0 hits) | |
| 427 </a></div> | |
| 428 <div class=indexentry><a href="#match10"> | |
| 429 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 430 (20 letters, 0 hits) | |
| 431 </a></div> | |
| 432 <div class=indexentry><a href="#match11"> | |
| 433 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 434 (20 letters, 0 hits) | |
| 435 </a></div> | |
| 436 <div class=indexentry><a href="#match12"> | |
| 437 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 438 (20 letters, 0 hits) | |
| 439 </a></div> | |
| 440 <div class=indexentry><a href="#match13"> | |
| 441 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 442 (20 letters, 0 hits) | |
| 443 </a></div> | |
| 444 <div class=indexentry><a href="#match14"> | |
| 445 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 446 (20 letters, 0 hits) | |
| 447 </a></div> | |
| 448 <div class=indexentry><a href="#match15"> | |
| 449 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 450 (20 letters, 0 hits) | |
| 451 </a></div> | |
| 452 <div class=indexentry><a href="#match16"> | |
| 453 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 454 (20 letters, 0 hits) | |
| 455 </a></div> | |
| 456 <div class=indexentry><a href="#match17"> | |
| 457 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 458 (20 letters, 0 hits) | |
| 459 </a></div> | |
| 460 <div class=indexentry><a href="#match18"> | |
| 461 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 462 (20 letters, 1 hits) | |
| 463 </a></div> | |
| 464 <div class=indexentry><a href="#match19"> | |
| 465 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 466 (20 letters, 1 hits) | |
| 467 </a></div> | |
| 468 <div class=indexentry><a href="#match20"> | |
| 469 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 470 (20 letters, 0 hits) | |
| 471 </a></div> | |
| 472 <div class=indexentry><a href="#match21"> | |
| 473 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 474 (20 letters, 0 hits) | |
| 475 </a></div> | |
| 476 <div class=indexentry><a href="#match22"> | |
| 477 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 478 (20 letters, 1 hits) | |
| 479 </a></div> | |
| 480 <div class=indexentry><a href="#match23"> | |
| 481 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 482 (20 letters, 0 hits) | |
| 483 </a></div> | |
| 484 <div class=indexentry><a href="#match24"> | |
| 485 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 486 (20 letters, 0 hits) | |
| 487 </a></div> | |
| 488 <div class=indexentry><a href="#match25"> | |
| 489 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 490 (24 letters, 0 hits) | |
| 491 </a></div> | |
| 492 <div class=indexentry><a href="#match26"> | |
| 493 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 494 (24 letters, 0 hits) | |
| 495 </a></div> | |
| 496 <div class=indexentry><a href="#match27"> | |
| 497 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 498 (24 letters, 0 hits) | |
| 499 </a></div> | |
| 500 <div class=indexentry><a href="#match28"> | |
| 501 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 502 (24 letters, 0 hits) | |
| 503 </a></div> | |
| 504 <div class=indexentry><a href="#match29"> | |
| 505 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 506 (24 letters, 0 hits) | |
| 507 </a></div> | |
| 508 <div class=indexentry><a href="#match30"> | |
| 509 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 510 (24 letters, 0 hits) | |
| 511 </a></div> | |
| 512 <div class=indexentry><a href="#match31"> | |
| 513 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 514 (24 letters, 0 hits) | |
| 515 </a></div> | |
| 516 <div class=indexentry><a href="#match32"> | |
| 517 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 518 (24 letters, 0 hits) | |
| 519 </a></div> | |
| 520 <div class=indexentry><a href="#match33"> | |
| 521 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 522 (20 letters, 0 hits) | |
| 523 </a></div> | |
| 524 <div class=indexentry><a href="#match34"> | |
| 525 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 526 (20 letters, 0 hits) | |
| 527 </a></div> | |
| 528 <div class=indexentry><a href="#match35"> | |
| 529 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 530 (20 letters, 0 hits) | |
| 531 </a></div> | |
| 532 <div class=indexentry><a href="#match36"> | |
| 533 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 534 (20 letters, 0 hits) | |
| 535 </a></div> | |
| 536 <div class=indexentry><a href="#match37"> | |
| 537 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 538 (20 letters, 0 hits) | |
| 539 </a></div> | |
| 540 <div class=indexentry><a href="#match38"> | |
| 541 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 542 (20 letters, 0 hits) | |
| 543 </a></div> | |
| 544 <div class=indexentry><a href="#match39"> | |
| 545 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 546 (20 letters, 0 hits) | |
| 547 </a></div> | |
| 548 <div class=indexentry><a href="#match40"> | |
| 549 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 550 (20 letters, 0 hits) | |
| 551 </a></div> | |
| 552 <div class=indexentry><a href="#match41"> | |
| 553 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 554 (25 letters, 0 hits) | |
| 555 </a></div> | |
| 556 <div class=indexentry><a href="#match42"> | |
| 557 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 558 (25 letters, 0 hits) | |
| 559 </a></div> | |
| 560 <div class=indexentry><a href="#match43"> | |
| 561 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 562 (25 letters, 0 hits) | |
| 563 </a></div> | |
| 564 <div class=indexentry><a href="#match44"> | |
| 565 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 566 (25 letters, 0 hits) | |
| 567 </a></div> | |
| 568 <div class=indexentry><a href="#match45"> | |
| 569 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 570 (25 letters, 0 hits) | |
| 571 </a></div> | |
| 572 <div class=indexentry><a href="#match46"> | |
| 573 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 574 (25 letters, 0 hits) | |
| 575 </a></div> | |
| 576 <div class=indexentry><a href="#match47"> | |
| 577 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 578 (25 letters, 1 hits) | |
| 579 </a></div> | |
| 580 <div class=indexentry><a href="#match48"> | |
| 581 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 582 (25 letters, 1 hits) | |
| 583 </a></div> | |
| 584 <div class=indexentry><a href="#match49"> | |
| 585 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 586 (74 letters, 0 hits) | |
| 587 </a></div> | |
| 588 <div class=indexentry><a href="#match50"> | |
| 589 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 590 (74 letters, 0 hits) | |
| 591 </a></div> | |
| 592 <div class=indexentry><a href="#match51"> | |
| 593 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 594 (74 letters, 0 hits) | |
| 595 </a></div> | |
| 596 <div class=indexentry><a href="#match52"> | |
| 597 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 598 (74 letters, 0 hits) | |
| 599 </a></div> | |
| 600 <div class=indexentry><a href="#match53"> | |
| 601 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 602 (74 letters, 0 hits) | |
| 603 </a></div> | |
| 604 <div class=indexentry><a href="#match54"> | |
| 605 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 606 (74 letters, 0 hits) | |
| 607 </a></div> | |
| 608 <div class=indexentry><a href="#match55"> | |
| 609 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 610 (74 letters, 1 hits) | |
| 611 </a></div> | |
| 612 <div class=indexentry><a href="#match56"> | |
| 613 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 614 (74 letters, 1 hits) | |
| 615 </a></div> | |
| 616 | |
| 617 </section> | |
| 618 | |
| 619 | |
| 620 <section class=match id=match1> | |
| 621 | |
| 622 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 623 | |
| 624 <section class=header> | |
| 625 | |
| 626 <table class=headerdata> | |
| 627 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 628 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 629 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 630 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 631 <tr><td class=param>Database:</td><td></td></tr> | |
| 632 </table> | |
| 633 | |
| 634 </section> | |
| 635 | |
| 636 <section> | |
| 637 <h2>No Hits</h2> | |
| 638 <div class=grey> | |
| 639 <table class=headerdata> | |
| 640 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 641 </table> | |
| 642 </div> | |
| 643 </section> | |
| 644 </section> | |
| 645 | |
| 646 <section class=match id=match2> | |
| 647 | |
| 648 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 649 | |
| 650 <section class=header> | |
| 651 | |
| 652 <table class=headerdata> | |
| 653 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 654 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 655 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 656 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 657 <tr><td class=param>Database:</td><td></td></tr> | |
| 658 </table> | |
| 659 | |
| 660 </section> | |
| 661 | |
| 662 <section> | |
| 663 <h2>No Hits</h2> | |
| 664 <div class=grey> | |
| 665 <table class=headerdata> | |
| 666 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 667 </table> | |
| 668 </div> | |
| 669 </section> | |
| 670 </section> | |
| 671 | |
| 672 <section class=match id=match3> | |
| 673 | |
| 674 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 675 | |
| 676 <section class=header> | |
| 677 | |
| 678 <table class=headerdata> | |
| 679 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 680 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 681 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 682 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 683 <tr><td class=param>Database:</td><td></td></tr> | |
| 684 </table> | |
| 685 | |
| 686 </section> | |
| 687 | |
| 688 | |
| 689 <section class=graphics> | |
| 690 <h2>Graphic Summary</h2> | |
| 691 | |
| 692 <div class=grey> | |
| 693 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> | |
| 694 | |
| 695 <div class=defline id=defline3> | |
| 696 Mouse-over to show defline and scores, click to show alignments | |
| 697 </div> | |
| 698 | |
| 699 <div class=graphic> | |
| 700 <h4 class=darkHeader>Color key for alignment scores</h4> | |
| 701 <div class=legend><div class=graphicrow> | |
| 702 <div class=graphicitem style="background-color: black"><40</div> | |
| 703 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 704 <div class=graphicitem style="background-color: green">50–80</div> | |
| 705 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 706 <div class=graphicitem style="background-color: red">200≤</div> | |
| 707 </div></div> | |
| 708 <div style="clear: left"></div> | |
| 709 | |
| 710 <div class=tablewrapper> | |
| 711 | |
| 712 <div class=scale> | |
| 713 <div>query:</div> | |
| 714 <div class=graphicrow> | |
| 715 <div> | |
| 716 <div class=graphicitem style="width: 10.0%"> | |
| 717 <div>2</div> | |
| 718 </div> | |
| 719 <div class=graphicitem style="width: 10.0%"> | |
| 720 <div>4</div> | |
| 721 </div> | |
| 722 <div class=graphicitem style="width: 10.0%"> | |
| 723 <div>6</div> | |
| 724 </div> | |
| 725 <div class=graphicitem style="width: 10.0%"> | |
| 726 <div>8</div> | |
| 727 </div> | |
| 728 <div class=graphicitem style="width: 10.0%"> | |
| 729 <div>10</div> | |
| 730 </div> | |
| 731 <div class=graphicitem style="width: 10.0%"> | |
| 732 <div>12</div> | |
| 733 </div> | |
| 734 <div class=graphicitem style="width: 10.0%"> | |
| 735 <div>14</div> | |
| 736 </div> | |
| 737 <div class=graphicitem style="width: 10.0%"> | |
| 738 <div>16</div> | |
| 739 </div> | |
| 740 <div class=graphicitem style="width: 10.0%"> | |
| 741 <div>18</div> | |
| 742 </div> | |
| 743 <div class=graphicitem style="width: 10.0%"> | |
| 744 <div>20</div> | |
| 745 </div> | |
| 746 </div> | |
| 747 </div> | |
| 748 <div style="clear: left"></div> | |
| 749 </div> | |
| 750 | |
| 751 <a class=matchresult | |
| 752 href="#hit1" | |
| 753 onmouseover='document.getElementById("defline3").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' | |
| 754 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 755 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> | |
| 756 <div class="matchrow graphicrow"> | |
| 757 <div class="matchitem graphicitem" | |
| 758 style="background-color: black; width: 100.0%"></div> | |
| 759 </div> | |
| 760 </a> | |
| 761 | |
| 762 </div> | |
| 763 </div> | |
| 764 </div> | |
| 765 </section> | |
| 766 | |
| 767 | |
| 768 | |
| 769 <section class=descriptions> | |
| 770 <h2>Descriptions</h2> | |
| 771 | |
| 772 <div class=grey><div class=white> | |
| 773 <h4 class=darkHeader>Sequences producing significant alignments:</h4> | |
| 774 | |
| 775 <table class=descriptiontable> | |
| 776 <col/><col/><col/><col/><col/><col/><col/> | |
| 777 <tr> | |
| 778 <th>Description</th> | |
| 779 <th>Max score</th> | |
| 780 <th>Total score</th> | |
| 781 <th>Query cover</th> | |
| 782 <th>E value</th> | |
| 783 <th>Ident</th> | |
| 784 <th>Accession</th> | |
| 785 </tr> | |
| 786 <tr> | |
| 787 <td><div><a href="#hit1" | |
| 788 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" | |
| 789 id="description1"> | |
| 790 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 | |
| 791 </a></div></td> | |
| 792 <td>37.4</td> | |
| 793 <td>37.4</td> | |
| 794 <td>100%</td> | |
| 795 <td>7.011e-08</td> | |
| 796 <td>100%</td> | |
| 797 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign">Subject_3</a></td> | |
| 798 </tr> | |
| 799 </table> | |
| 800 | |
| 801 </div></div> | |
| 802 </section> | |
| 803 | |
| 804 | |
| 805 | |
| 806 <section class=alignments> | |
| 807 <h2>Alignments</h2> | |
| 808 | |
| 809 <div class=grey><div class=white> | |
| 810 <div class=alignment id=hit1> | |
| 811 | |
| 812 <div class=linkheader> | |
| 813 <div class=right><a href="#description1">Descriptions</a></div> | |
| 814 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign">GenBank</a> | |
| 815 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=graph&log$=nuclalign">Graphics</a> | |
| 816 </div> | |
| 817 | |
| 818 <div class=title> | |
| 819 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> | |
| 820 <p class=titleinfo> | |
| 821 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign">Subject_3</a> | |
| 822 <span class=b>Length:</span> 323 | |
| 823 <span class=b>Number of Matches:</span> 1 | |
| 824 </p> | |
| 825 </div> | |
| 826 | |
| 827 | |
| 828 <div class=hotspot> | |
| 829 <p class=range> | |
| 830 <span class=range>Range 1: 200 to 219</span> | |
| 831 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign&from=200&to=219">GenBank</a> | |
| 832 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=graph&log$=nuclalign&from=200&to=219">Graphics</a> | |
| 833 </p> | |
| 834 | |
| 835 <table class=hotspotstable> | |
| 836 <tr> | |
| 837 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 838 </tr> | |
| 839 <tr> | |
| 840 <td>37.4 bits(40)</td> | |
| 841 <td>0.0</td> | |
| 842 <td>20/20(100%)</td> | |
| 843 <td>0/20(0%)</td> | |
| 844 <td>Plus/Plus</td> | |
| 845 </tr> | |
| 846 </table> | |
| 847 | |
| 848 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 | |
| 849 |||||||||||||||||||| | |
| 850 Subject 200 AGCGCGCAAACTAGGATAAA 219</pre> | |
| 851 </div> | |
| 852 | |
| 853 </div> | |
| 854 | |
| 855 </div></div> | |
| 856 </section> | |
| 857 </section> | |
| 858 | |
| 859 <section class=match id=match4> | |
| 860 | |
| 861 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 862 | |
| 863 <section class=header> | |
| 864 | |
| 865 <table class=headerdata> | |
| 866 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 867 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 868 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 869 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 870 <tr><td class=param>Database:</td><td></td></tr> | |
| 871 </table> | |
| 872 | |
| 873 </section> | |
| 874 | |
| 875 <section> | |
| 876 <h2>No Hits</h2> | |
| 877 <div class=grey> | |
| 878 <table class=headerdata> | |
| 879 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 880 </table> | |
| 881 </div> | |
| 882 </section> | |
| 883 </section> | |
| 884 | |
| 885 <section class=match id=match5> | |
| 886 | |
| 887 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 888 | |
| 889 <section class=header> | |
| 890 | |
| 891 <table class=headerdata> | |
| 892 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 893 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 894 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 895 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 896 <tr><td class=param>Database:</td><td></td></tr> | |
| 897 </table> | |
| 898 | |
| 899 </section> | |
| 900 | |
| 901 <section> | |
| 902 <h2>No Hits</h2> | |
| 903 <div class=grey> | |
| 904 <table class=headerdata> | |
| 905 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 906 </table> | |
| 907 </div> | |
| 908 </section> | |
| 909 </section> | |
| 910 | |
| 911 <section class=match id=match6> | |
| 912 | |
| 913 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 914 | |
| 915 <section class=header> | |
| 916 | |
| 917 <table class=headerdata> | |
| 918 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 919 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 920 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 921 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 922 <tr><td class=param>Database:</td><td></td></tr> | |
| 923 </table> | |
| 924 | |
| 925 </section> | |
| 926 | |
| 927 | |
| 928 <section class=graphics> | |
| 929 <h2>Graphic Summary</h2> | |
| 930 | |
| 931 <div class=grey> | |
| 932 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> | |
| 933 | |
| 934 <div class=defline id=defline6> | |
| 935 Mouse-over to show defline and scores, click to show alignments | |
| 936 </div> | |
| 937 | |
| 938 <div class=graphic> | |
| 939 <h4 class=darkHeader>Color key for alignment scores</h4> | |
| 940 <div class=legend><div class=graphicrow> | |
| 941 <div class=graphicitem style="background-color: black"><40</div> | |
| 942 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 943 <div class=graphicitem style="background-color: green">50–80</div> | |
| 944 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 945 <div class=graphicitem style="background-color: red">200≤</div> | |
| 946 </div></div> | |
| 947 <div style="clear: left"></div> | |
| 948 | |
| 949 <div class=tablewrapper> | |
| 950 | |
| 951 <div class=scale> | |
| 952 <div>query:</div> | |
| 953 <div class=graphicrow> | |
| 954 <div> | |
| 955 <div class=graphicitem style="width: 10.0%"> | |
| 956 <div>2</div> | |
| 957 </div> | |
| 958 <div class=graphicitem style="width: 10.0%"> | |
| 959 <div>4</div> | |
| 960 </div> | |
| 961 <div class=graphicitem style="width: 10.0%"> | |
| 962 <div>6</div> | |
| 963 </div> | |
| 964 <div class=graphicitem style="width: 10.0%"> | |
| 965 <div>8</div> | |
| 966 </div> | |
| 967 <div class=graphicitem style="width: 10.0%"> | |
| 968 <div>10</div> | |
| 969 </div> | |
| 970 <div class=graphicitem style="width: 10.0%"> | |
| 971 <div>12</div> | |
| 972 </div> | |
| 973 <div class=graphicitem style="width: 10.0%"> | |
| 974 <div>14</div> | |
| 975 </div> | |
| 976 <div class=graphicitem style="width: 10.0%"> | |
| 977 <div>16</div> | |
| 978 </div> | |
| 979 <div class=graphicitem style="width: 10.0%"> | |
| 980 <div>18</div> | |
| 981 </div> | |
| 982 <div class=graphicitem style="width: 10.0%"> | |
| 983 <div>20</div> | |
| 984 </div> | |
| 985 </div> | |
| 986 </div> | |
| 987 <div style="clear: left"></div> | |
| 988 </div> | |
| 989 | |
| 990 <a class=matchresult | |
| 991 href="#hit1" | |
| 992 onmouseover='document.getElementById("defline6").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' | |
| 993 onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 994 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> | |
| 995 <div class="matchrow graphicrow"> | |
| 996 <div class="matchitem graphicitem" | |
| 997 style="background-color: black; width: 100.0%"></div> | |
| 998 </div> | |
| 999 </a> | |
| 1000 | |
| 1001 </div> | |
| 1002 </div> | |
| 1003 </div> | |
| 1004 </section> | |
| 1005 | |
| 1006 | |
| 1007 | |
| 1008 <section class=descriptions> | |
| 1009 <h2>Descriptions</h2> | |
| 1010 | |
| 1011 <div class=grey><div class=white> | |
| 1012 <h4 class=darkHeader>Sequences producing significant alignments:</h4> | |
| 1013 | |
| 1014 <table class=descriptiontable> | |
| 1015 <col/><col/><col/><col/><col/><col/><col/> | |
| 1016 <tr> | |
| 1017 <th>Description</th> | |
| 1018 <th>Max score</th> | |
| 1019 <th>Total score</th> | |
| 1020 <th>Query cover</th> | |
| 1021 <th>E value</th> | |
| 1022 <th>Ident</th> | |
| 1023 <th>Accession</th> | |
| 1024 </tr> | |
| 1025 <tr> | |
| 1026 <td><div><a href="#hit1" | |
| 1027 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" | |
| 1028 id="description1"> | |
| 1029 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 | |
| 1030 </a></div></td> | |
| 1031 <td>37.4</td> | |
| 1032 <td>37.4</td> | |
| 1033 <td>100%</td> | |
| 1034 <td>7.011e-08</td> | |
| 1035 <td>100%</td> | |
| 1036 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign">Subject_6</a></td> | |
| 1037 </tr> | |
| 1038 </table> | |
| 1039 | |
| 1040 </div></div> | |
| 1041 </section> | |
| 1042 | |
| 1043 | |
| 1044 | |
| 1045 <section class=alignments> | |
| 1046 <h2>Alignments</h2> | |
| 1047 | |
| 1048 <div class=grey><div class=white> | |
| 1049 <div class=alignment id=hit1> | |
| 1050 | |
| 1051 <div class=linkheader> | |
| 1052 <div class=right><a href="#description1">Descriptions</a></div> | |
| 1053 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign">GenBank</a> | |
| 1054 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=graph&log$=nuclalign">Graphics</a> | |
| 1055 </div> | |
| 1056 | |
| 1057 <div class=title> | |
| 1058 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> | |
| 1059 <p class=titleinfo> | |
| 1060 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign">Subject_6</a> | |
| 1061 <span class=b>Length:</span> 2457 | |
| 1062 <span class=b>Number of Matches:</span> 1 | |
| 1063 </p> | |
| 1064 </div> | |
| 1065 | |
| 1066 | |
| 1067 <div class=hotspot> | |
| 1068 <p class=range> | |
| 1069 <span class=range>Range 1: 2119 to 2138</span> | |
| 1070 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign&from=2119&to=2138">GenBank</a> | |
| 1071 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=graph&log$=nuclalign&from=2119&to=2138">Graphics</a> | |
| 1072 </p> | |
| 1073 | |
| 1074 <table class=hotspotstable> | |
| 1075 <tr> | |
| 1076 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1077 </tr> | |
| 1078 <tr> | |
| 1079 <td>37.4 bits(40)</td> | |
| 1080 <td>0.0</td> | |
| 1081 <td>20/20(100%)</td> | |
| 1082 <td>0/20(0%)</td> | |
| 1083 <td>Plus/Plus</td> | |
| 1084 </tr> | |
| 1085 </table> | |
| 1086 | |
| 1087 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 | |
| 1088 |||||||||||||||||||| | |
| 1089 Subject 2119 AGCGCGCAAACTAGGATAAA 2138</pre> | |
| 1090 </div> | |
| 1091 | |
| 1092 </div> | |
| 1093 | |
| 1094 </div></div> | |
| 1095 </section> | |
| 1096 </section> | |
| 1097 | |
| 1098 <section class=match id=match7> | |
| 1099 | |
| 1100 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1101 | |
| 1102 <section class=header> | |
| 1103 | |
| 1104 <table class=headerdata> | |
| 1105 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1106 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1107 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1108 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1109 <tr><td class=param>Database:</td><td></td></tr> | |
| 1110 </table> | |
| 1111 | |
| 1112 </section> | |
| 1113 | |
| 1114 <section> | |
| 1115 <h2>No Hits</h2> | |
| 1116 <div class=grey> | |
| 1117 <table class=headerdata> | |
| 1118 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1119 </table> | |
| 1120 </div> | |
| 1121 </section> | |
| 1122 </section> | |
| 1123 | |
| 1124 <section class=match id=match8> | |
| 1125 | |
| 1126 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1127 | |
| 1128 <section class=header> | |
| 1129 | |
| 1130 <table class=headerdata> | |
| 1131 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1132 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1133 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1134 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1135 <tr><td class=param>Database:</td><td></td></tr> | |
| 1136 </table> | |
| 1137 | |
| 1138 </section> | |
| 1139 | |
| 1140 <section> | |
| 1141 <h2>No Hits</h2> | |
| 1142 <div class=grey> | |
| 1143 <table class=headerdata> | |
| 1144 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1145 </table> | |
| 1146 </div> | |
| 1147 </section> | |
| 1148 </section> | |
| 1149 | |
| 1150 <section class=match id=match9> | |
| 1151 | |
| 1152 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1153 | |
| 1154 <section class=header> | |
| 1155 | |
| 1156 <table class=headerdata> | |
| 1157 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1158 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1159 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1160 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1161 <tr><td class=param>Database:</td><td></td></tr> | |
| 1162 </table> | |
| 1163 | |
| 1164 </section> | |
| 1165 | |
| 1166 <section> | |
| 1167 <h2>No Hits</h2> | |
| 1168 <div class=grey> | |
| 1169 <table class=headerdata> | |
| 1170 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1171 </table> | |
| 1172 </div> | |
| 1173 </section> | |
| 1174 </section> | |
| 1175 | |
| 1176 <section class=match id=match10> | |
| 1177 | |
| 1178 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1179 | |
| 1180 <section class=header> | |
| 1181 | |
| 1182 <table class=headerdata> | |
| 1183 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1184 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1185 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1186 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1187 <tr><td class=param>Database:</td><td></td></tr> | |
| 1188 </table> | |
| 1189 | |
| 1190 </section> | |
| 1191 | |
| 1192 <section> | |
| 1193 <h2>No Hits</h2> | |
| 1194 <div class=grey> | |
| 1195 <table class=headerdata> | |
| 1196 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1197 </table> | |
| 1198 </div> | |
| 1199 </section> | |
| 1200 </section> | |
| 1201 | |
| 1202 <section class=match id=match11> | |
| 1203 | |
| 1204 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1205 | |
| 1206 <section class=header> | |
| 1207 | |
| 1208 <table class=headerdata> | |
| 1209 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1210 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1211 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1212 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1213 <tr><td class=param>Database:</td><td></td></tr> | |
| 1214 </table> | |
| 1215 | |
| 1216 </section> | |
| 1217 | |
| 1218 <section> | |
| 1219 <h2>No Hits</h2> | |
| 1220 <div class=grey> | |
| 1221 <table class=headerdata> | |
| 1222 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1223 </table> | |
| 1224 </div> | |
| 1225 </section> | |
| 1226 </section> | |
| 1227 | |
| 1228 <section class=match id=match12> | |
| 1229 | |
| 1230 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1231 | |
| 1232 <section class=header> | |
| 1233 | |
| 1234 <table class=headerdata> | |
| 1235 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1236 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1237 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1238 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1239 <tr><td class=param>Database:</td><td></td></tr> | |
| 1240 </table> | |
| 1241 | |
| 1242 </section> | |
| 1243 | |
| 1244 <section> | |
| 1245 <h2>No Hits</h2> | |
| 1246 <div class=grey> | |
| 1247 <table class=headerdata> | |
| 1248 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1249 </table> | |
| 1250 </div> | |
| 1251 </section> | |
| 1252 </section> | |
| 1253 | |
| 1254 <section class=match id=match13> | |
| 1255 | |
| 1256 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1257 | |
| 1258 <section class=header> | |
| 1259 | |
| 1260 <table class=headerdata> | |
| 1261 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1262 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1263 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1264 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1265 <tr><td class=param>Database:</td><td></td></tr> | |
| 1266 </table> | |
| 1267 | |
| 1268 </section> | |
| 1269 | |
| 1270 <section> | |
| 1271 <h2>No Hits</h2> | |
| 1272 <div class=grey> | |
| 1273 <table class=headerdata> | |
| 1274 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1275 </table> | |
| 1276 </div> | |
| 1277 </section> | |
| 1278 </section> | |
| 1279 | |
| 1280 <section class=match id=match14> | |
| 1281 | |
| 1282 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1283 | |
| 1284 <section class=header> | |
| 1285 | |
| 1286 <table class=headerdata> | |
| 1287 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1288 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1289 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1290 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1291 <tr><td class=param>Database:</td><td></td></tr> | |
| 1292 </table> | |
| 1293 | |
| 1294 </section> | |
| 1295 | |
| 1296 <section> | |
| 1297 <h2>No Hits</h2> | |
| 1298 <div class=grey> | |
| 1299 <table class=headerdata> | |
| 1300 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1301 </table> | |
| 1302 </div> | |
| 1303 </section> | |
| 1304 </section> | |
| 1305 | |
| 1306 <section class=match id=match15> | |
| 1307 | |
| 1308 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1309 | |
| 1310 <section class=header> | |
| 1311 | |
| 1312 <table class=headerdata> | |
| 1313 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1314 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1315 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1316 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1317 <tr><td class=param>Database:</td><td></td></tr> | |
| 1318 </table> | |
| 1319 | |
| 1320 </section> | |
| 1321 | |
| 1322 <section> | |
| 1323 <h2>No Hits</h2> | |
| 1324 <div class=grey> | |
| 1325 <table class=headerdata> | |
| 1326 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1327 </table> | |
| 1328 </div> | |
| 1329 </section> | |
| 1330 </section> | |
| 1331 | |
| 1332 <section class=match id=match16> | |
| 1333 | |
| 1334 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1335 | |
| 1336 <section class=header> | |
| 1337 | |
| 1338 <table class=headerdata> | |
| 1339 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1340 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1341 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1342 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1343 <tr><td class=param>Database:</td><td></td></tr> | |
| 1344 </table> | |
| 1345 | |
| 1346 </section> | |
| 1347 | |
| 1348 <section> | |
| 1349 <h2>No Hits</h2> | |
| 1350 <div class=grey> | |
| 1351 <table class=headerdata> | |
| 1352 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1353 </table> | |
| 1354 </div> | |
| 1355 </section> | |
| 1356 </section> | |
| 1357 | |
| 1358 <section class=match id=match17> | |
| 1359 | |
| 1360 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1361 | |
| 1362 <section class=header> | |
| 1363 | |
| 1364 <table class=headerdata> | |
| 1365 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1366 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1367 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1368 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1369 <tr><td class=param>Database:</td><td></td></tr> | |
| 1370 </table> | |
| 1371 | |
| 1372 </section> | |
| 1373 | |
| 1374 <section> | |
| 1375 <h2>No Hits</h2> | |
| 1376 <div class=grey> | |
| 1377 <table class=headerdata> | |
| 1378 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1379 </table> | |
| 1380 </div> | |
| 1381 </section> | |
| 1382 </section> | |
| 1383 | |
| 1384 <section class=match id=match18> | |
| 1385 | |
| 1386 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1387 | |
| 1388 <section class=header> | |
| 1389 | |
| 1390 <table class=headerdata> | |
| 1391 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1392 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1393 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1394 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1395 <tr><td class=param>Database:</td><td></td></tr> | |
| 1396 </table> | |
| 1397 | |
| 1398 </section> | |
| 1399 | |
| 1400 | |
| 1401 <section class=graphics> | |
| 1402 <h2>Graphic Summary</h2> | |
| 1403 | |
| 1404 <div class=grey> | |
| 1405 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> | |
| 1406 | |
| 1407 <div class=defline id=defline18> | |
| 1408 Mouse-over to show defline and scores, click to show alignments | |
| 1409 </div> | |
| 1410 | |
| 1411 <div class=graphic> | |
| 1412 <h4 class=darkHeader>Color key for alignment scores</h4> | |
| 1413 <div class=legend><div class=graphicrow> | |
| 1414 <div class=graphicitem style="background-color: black"><40</div> | |
| 1415 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 1416 <div class=graphicitem style="background-color: green">50–80</div> | |
| 1417 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 1418 <div class=graphicitem style="background-color: red">200≤</div> | |
| 1419 </div></div> | |
| 1420 <div style="clear: left"></div> | |
| 1421 | |
| 1422 <div class=tablewrapper> | |
| 1423 | |
| 1424 <div class=scale> | |
| 1425 <div>query:</div> | |
| 1426 <div class=graphicrow> | |
| 1427 <div> | |
| 1428 <div class=graphicitem style="width: 10.0%"> | |
| 1429 <div>2</div> | |
| 1430 </div> | |
| 1431 <div class=graphicitem style="width: 10.0%"> | |
| 1432 <div>4</div> | |
| 1433 </div> | |
| 1434 <div class=graphicitem style="width: 10.0%"> | |
| 1435 <div>6</div> | |
| 1436 </div> | |
| 1437 <div class=graphicitem style="width: 10.0%"> | |
| 1438 <div>8</div> | |
| 1439 </div> | |
| 1440 <div class=graphicitem style="width: 10.0%"> | |
| 1441 <div>10</div> | |
| 1442 </div> | |
| 1443 <div class=graphicitem style="width: 10.0%"> | |
| 1444 <div>12</div> | |
| 1445 </div> | |
| 1446 <div class=graphicitem style="width: 10.0%"> | |
| 1447 <div>14</div> | |
| 1448 </div> | |
| 1449 <div class=graphicitem style="width: 10.0%"> | |
| 1450 <div>16</div> | |
| 1451 </div> | |
| 1452 <div class=graphicitem style="width: 10.0%"> | |
| 1453 <div>18</div> | |
| 1454 </div> | |
| 1455 <div class=graphicitem style="width: 10.0%"> | |
| 1456 <div>20</div> | |
| 1457 </div> | |
| 1458 </div> | |
| 1459 </div> | |
| 1460 <div style="clear: left"></div> | |
| 1461 </div> | |
| 1462 | |
| 1463 <a class=matchresult | |
| 1464 href="#hit1" | |
| 1465 onmouseover='document.getElementById("defline18").innerHTML="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3\u0027UTR/plant_junction_region.|-9105899556052450000"' | |
| 1466 onmouseout='document.getElementById("defline18").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 1467 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000"> | |
| 1468 <div class="matchrow graphicrow"> | |
| 1469 <div class="matchitem graphicitem" | |
| 1470 style="background-color: transparent; width: 15.0%"></div> | |
| 1471 <div class="matchitem graphicitem" | |
| 1472 style="background-color: black; width: 85.0%"></div> | |
| 1473 </div> | |
| 1474 </a> | |
| 1475 | |
| 1476 </div> | |
| 1477 </div> | |
| 1478 </div> | |
| 1479 </section> | |
| 1480 | |
| 1481 | |
| 1482 | |
| 1483 <section class=descriptions> | |
| 1484 <h2>Descriptions</h2> | |
| 1485 | |
| 1486 <div class=grey><div class=white> | |
| 1487 <h4 class=darkHeader>Sequences producing significant alignments:</h4> | |
| 1488 | |
| 1489 <table class=descriptiontable> | |
| 1490 <col/><col/><col/><col/><col/><col/><col/> | |
| 1491 <tr> | |
| 1492 <th>Description</th> | |
| 1493 <th>Max score</th> | |
| 1494 <th>Total score</th> | |
| 1495 <th>Query cover</th> | |
| 1496 <th>E value</th> | |
| 1497 <th>Ident</th> | |
| 1498 <th>Accession</th> | |
| 1499 </tr> | |
| 1500 <tr> | |
| 1501 <td><div><a href="#hit1" | |
| 1502 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000" | |
| 1503 id="description1"> | |
| 1504 AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000 | |
| 1505 </a></div></td> | |
| 1506 <td>31.9</td> | |
| 1507 <td>31.9</td> | |
| 1508 <td>85%</td> | |
| 1509 <td>2.981e-06</td> | |
| 1510 <td>100%</td> | |
| 1511 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=genbank&log$=nuclalign">Subject_2</a></td> | |
| 1512 </tr> | |
| 1513 </table> | |
| 1514 | |
| 1515 </div></div> | |
| 1516 </section> | |
| 1517 | |
| 1518 | |
| 1519 | |
| 1520 <section class=alignments> | |
| 1521 <h2>Alignments</h2> | |
| 1522 | |
| 1523 <div class=grey><div class=white> | |
| 1524 <div class=alignment id=hit1> | |
| 1525 | |
| 1526 <div class=linkheader> | |
| 1527 <div class=right><a href="#description1">Descriptions</a></div> | |
| 1528 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=genbank&log$=nuclalign">GenBank</a> | |
| 1529 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=graph&log$=nuclalign">Graphics</a> | |
| 1530 </div> | |
| 1531 | |
| 1532 <div class=title> | |
| 1533 <p class=hittitle>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000</p> | |
| 1534 <p class=titleinfo> | |
| 1535 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=genbank&log$=nuclalign">Subject_2</a> | |
| 1536 <span class=b>Length:</span> 1045 | |
| 1537 <span class=b>Number of Matches:</span> 1 | |
| 1538 </p> | |
| 1539 </div> | |
| 1540 | |
| 1541 | |
| 1542 <div class=hotspot> | |
| 1543 <p class=range> | |
| 1544 <span class=range>Range 1: 2 to 18</span> | |
| 1545 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=genbank&log$=nuclalign&from=2&to=18">GenBank</a> | |
| 1546 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=graph&log$=nuclalign&from=2&to=18">Graphics</a> | |
| 1547 </p> | |
| 1548 | |
| 1549 <table class=hotspotstable> | |
| 1550 <tr> | |
| 1551 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1552 </tr> | |
| 1553 <tr> | |
| 1554 <td>31.9 bits(34)</td> | |
| 1555 <td>0.0</td> | |
| 1556 <td>17/17(100%)</td> | |
| 1557 <td>0/17(0%)</td> | |
| 1558 <td>Plus/Plus</td> | |
| 1559 </tr> | |
| 1560 </table> | |
| 1561 | |
| 1562 <pre class=alignmentgraphic>Query 4 GCGCGGTGTCATCTATG 20 | |
| 1563 ||||||||||||||||| | |
| 1564 Subject 2 GCGCGGTGTCATCTATG 18</pre> | |
| 1565 </div> | |
| 1566 | |
| 1567 </div> | |
| 1568 | |
| 1569 </div></div> | |
| 1570 </section> | |
| 1571 </section> | |
| 1572 | |
| 1573 <section class=match id=match19> | |
| 1574 | |
| 1575 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1576 | |
| 1577 <section class=header> | |
| 1578 | |
| 1579 <table class=headerdata> | |
| 1580 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1581 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1582 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1583 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1584 <tr><td class=param>Database:</td><td></td></tr> | |
| 1585 </table> | |
| 1586 | |
| 1587 </section> | |
| 1588 | |
| 1589 | |
| 1590 <section class=graphics> | |
| 1591 <h2>Graphic Summary</h2> | |
| 1592 | |
| 1593 <div class=grey> | |
| 1594 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> | |
| 1595 | |
| 1596 <div class=defline id=defline19> | |
| 1597 Mouse-over to show defline and scores, click to show alignments | |
| 1598 </div> | |
| 1599 | |
| 1600 <div class=graphic> | |
| 1601 <h4 class=darkHeader>Color key for alignment scores</h4> | |
| 1602 <div class=legend><div class=graphicrow> | |
| 1603 <div class=graphicitem style="background-color: black"><40</div> | |
| 1604 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 1605 <div class=graphicitem style="background-color: green">50–80</div> | |
| 1606 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 1607 <div class=graphicitem style="background-color: red">200≤</div> | |
| 1608 </div></div> | |
| 1609 <div style="clear: left"></div> | |
| 1610 | |
| 1611 <div class=tablewrapper> | |
| 1612 | |
| 1613 <div class=scale> | |
| 1614 <div>query:</div> | |
| 1615 <div class=graphicrow> | |
| 1616 <div> | |
| 1617 <div class=graphicitem style="width: 10.0%"> | |
| 1618 <div>2</div> | |
| 1619 </div> | |
| 1620 <div class=graphicitem style="width: 10.0%"> | |
| 1621 <div>4</div> | |
| 1622 </div> | |
| 1623 <div class=graphicitem style="width: 10.0%"> | |
| 1624 <div>6</div> | |
| 1625 </div> | |
| 1626 <div class=graphicitem style="width: 10.0%"> | |
| 1627 <div>8</div> | |
| 1628 </div> | |
| 1629 <div class=graphicitem style="width: 10.0%"> | |
| 1630 <div>10</div> | |
| 1631 </div> | |
| 1632 <div class=graphicitem style="width: 10.0%"> | |
| 1633 <div>12</div> | |
| 1634 </div> | |
| 1635 <div class=graphicitem style="width: 10.0%"> | |
| 1636 <div>14</div> | |
| 1637 </div> | |
| 1638 <div class=graphicitem style="width: 10.0%"> | |
| 1639 <div>16</div> | |
| 1640 </div> | |
| 1641 <div class=graphicitem style="width: 10.0%"> | |
| 1642 <div>18</div> | |
| 1643 </div> | |
| 1644 <div class=graphicitem style="width: 10.0%"> | |
| 1645 <div>20</div> | |
| 1646 </div> | |
| 1647 </div> | |
| 1648 </div> | |
| 1649 <div style="clear: left"></div> | |
| 1650 </div> | |
| 1651 | |
| 1652 <a class=matchresult | |
| 1653 href="#hit1" | |
| 1654 onmouseover='document.getElementById("defline19").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' | |
| 1655 onmouseout='document.getElementById("defline19").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 1656 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> | |
| 1657 <div class="matchrow graphicrow"> | |
| 1658 <div class="matchitem graphicitem" | |
| 1659 style="background-color: black; width: 100.0%"></div> | |
| 1660 </div> | |
| 1661 </a> | |
| 1662 | |
| 1663 </div> | |
| 1664 </div> | |
| 1665 </div> | |
| 1666 </section> | |
| 1667 | |
| 1668 | |
| 1669 | |
| 1670 <section class=descriptions> | |
| 1671 <h2>Descriptions</h2> | |
| 1672 | |
| 1673 <div class=grey><div class=white> | |
| 1674 <h4 class=darkHeader>Sequences producing significant alignments:</h4> | |
| 1675 | |
| 1676 <table class=descriptiontable> | |
| 1677 <col/><col/><col/><col/><col/><col/><col/> | |
| 1678 <tr> | |
| 1679 <th>Description</th> | |
| 1680 <th>Max score</th> | |
| 1681 <th>Total score</th> | |
| 1682 <th>Query cover</th> | |
| 1683 <th>E value</th> | |
| 1684 <th>Ident</th> | |
| 1685 <th>Accession</th> | |
| 1686 </tr> | |
| 1687 <tr> | |
| 1688 <td><div><a href="#hit1" | |
| 1689 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" | |
| 1690 id="description1"> | |
| 1691 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 | |
| 1692 </a></div></td> | |
| 1693 <td>37.4</td> | |
| 1694 <td>37.4</td> | |
| 1695 <td>100%</td> | |
| 1696 <td>7.011e-08</td> | |
| 1697 <td>100%</td> | |
| 1698 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign">Subject_3</a></td> | |
| 1699 </tr> | |
| 1700 </table> | |
| 1701 | |
| 1702 </div></div> | |
| 1703 </section> | |
| 1704 | |
| 1705 | |
| 1706 | |
| 1707 <section class=alignments> | |
| 1708 <h2>Alignments</h2> | |
| 1709 | |
| 1710 <div class=grey><div class=white> | |
| 1711 <div class=alignment id=hit1> | |
| 1712 | |
| 1713 <div class=linkheader> | |
| 1714 <div class=right><a href="#description1">Descriptions</a></div> | |
| 1715 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign">GenBank</a> | |
| 1716 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=graph&log$=nuclalign">Graphics</a> | |
| 1717 </div> | |
| 1718 | |
| 1719 <div class=title> | |
| 1720 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> | |
| 1721 <p class=titleinfo> | |
| 1722 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign">Subject_3</a> | |
| 1723 <span class=b>Length:</span> 323 | |
| 1724 <span class=b>Number of Matches:</span> 1 | |
| 1725 </p> | |
| 1726 </div> | |
| 1727 | |
| 1728 | |
| 1729 <div class=hotspot> | |
| 1730 <p class=range> | |
| 1731 <span class=range>Range 1: 224 to 243</span> | |
| 1732 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign&from=224&to=243">GenBank</a> | |
| 1733 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=graph&log$=nuclalign&from=224&to=243">Graphics</a> | |
| 1734 </p> | |
| 1735 | |
| 1736 <table class=hotspotstable> | |
| 1737 <tr> | |
| 1738 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1739 </tr> | |
| 1740 <tr> | |
| 1741 <td>37.4 bits(40)</td> | |
| 1742 <td>0.0</td> | |
| 1743 <td>20/20(100%)</td> | |
| 1744 <td>0/20(0%)</td> | |
| 1745 <td>Plus/Plus</td> | |
| 1746 </tr> | |
| 1747 </table> | |
| 1748 | |
| 1749 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 | |
| 1750 |||||||||||||||||||| | |
| 1751 Subject 224 CGCGCGCGGTGTCATCTATG 243</pre> | |
| 1752 </div> | |
| 1753 | |
| 1754 </div> | |
| 1755 | |
| 1756 </div></div> | |
| 1757 </section> | |
| 1758 </section> | |
| 1759 | |
| 1760 <section class=match id=match20> | |
| 1761 | |
| 1762 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1763 | |
| 1764 <section class=header> | |
| 1765 | |
| 1766 <table class=headerdata> | |
| 1767 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1768 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1769 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1770 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1771 <tr><td class=param>Database:</td><td></td></tr> | |
| 1772 </table> | |
| 1773 | |
| 1774 </section> | |
| 1775 | |
| 1776 <section> | |
| 1777 <h2>No Hits</h2> | |
| 1778 <div class=grey> | |
| 1779 <table class=headerdata> | |
| 1780 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1781 </table> | |
| 1782 </div> | |
| 1783 </section> | |
| 1784 </section> | |
| 1785 | |
| 1786 <section class=match id=match21> | |
| 1787 | |
| 1788 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1789 | |
| 1790 <section class=header> | |
| 1791 | |
| 1792 <table class=headerdata> | |
| 1793 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1794 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1795 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1796 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1797 <tr><td class=param>Database:</td><td></td></tr> | |
| 1798 </table> | |
| 1799 | |
| 1800 </section> | |
| 1801 | |
| 1802 <section> | |
| 1803 <h2>No Hits</h2> | |
| 1804 <div class=grey> | |
| 1805 <table class=headerdata> | |
| 1806 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1807 </table> | |
| 1808 </div> | |
| 1809 </section> | |
| 1810 </section> | |
| 1811 | |
| 1812 <section class=match id=match22> | |
| 1813 | |
| 1814 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1815 | |
| 1816 <section class=header> | |
| 1817 | |
| 1818 <table class=headerdata> | |
| 1819 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1820 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1821 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1822 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1823 <tr><td class=param>Database:</td><td></td></tr> | |
| 1824 </table> | |
| 1825 | |
| 1826 </section> | |
| 1827 | |
| 1828 | |
| 1829 <section class=graphics> | |
| 1830 <h2>Graphic Summary</h2> | |
| 1831 | |
| 1832 <div class=grey> | |
| 1833 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> | |
| 1834 | |
| 1835 <div class=defline id=defline22> | |
| 1836 Mouse-over to show defline and scores, click to show alignments | |
| 1837 </div> | |
| 1838 | |
| 1839 <div class=graphic> | |
| 1840 <h4 class=darkHeader>Color key for alignment scores</h4> | |
| 1841 <div class=legend><div class=graphicrow> | |
| 1842 <div class=graphicitem style="background-color: black"><40</div> | |
| 1843 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 1844 <div class=graphicitem style="background-color: green">50–80</div> | |
| 1845 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 1846 <div class=graphicitem style="background-color: red">200≤</div> | |
| 1847 </div></div> | |
| 1848 <div style="clear: left"></div> | |
| 1849 | |
| 1850 <div class=tablewrapper> | |
| 1851 | |
| 1852 <div class=scale> | |
| 1853 <div>query:</div> | |
| 1854 <div class=graphicrow> | |
| 1855 <div> | |
| 1856 <div class=graphicitem style="width: 10.0%"> | |
| 1857 <div>2</div> | |
| 1858 </div> | |
| 1859 <div class=graphicitem style="width: 10.0%"> | |
| 1860 <div>4</div> | |
| 1861 </div> | |
| 1862 <div class=graphicitem style="width: 10.0%"> | |
| 1863 <div>6</div> | |
| 1864 </div> | |
| 1865 <div class=graphicitem style="width: 10.0%"> | |
| 1866 <div>8</div> | |
| 1867 </div> | |
| 1868 <div class=graphicitem style="width: 10.0%"> | |
| 1869 <div>10</div> | |
| 1870 </div> | |
| 1871 <div class=graphicitem style="width: 10.0%"> | |
| 1872 <div>12</div> | |
| 1873 </div> | |
| 1874 <div class=graphicitem style="width: 10.0%"> | |
| 1875 <div>14</div> | |
| 1876 </div> | |
| 1877 <div class=graphicitem style="width: 10.0%"> | |
| 1878 <div>16</div> | |
| 1879 </div> | |
| 1880 <div class=graphicitem style="width: 10.0%"> | |
| 1881 <div>18</div> | |
| 1882 </div> | |
| 1883 <div class=graphicitem style="width: 10.0%"> | |
| 1884 <div>20</div> | |
| 1885 </div> | |
| 1886 </div> | |
| 1887 </div> | |
| 1888 <div style="clear: left"></div> | |
| 1889 </div> | |
| 1890 | |
| 1891 <a class=matchresult | |
| 1892 href="#hit1" | |
| 1893 onmouseover='document.getElementById("defline22").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' | |
| 1894 onmouseout='document.getElementById("defline22").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 1895 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> | |
| 1896 <div class="matchrow graphicrow"> | |
| 1897 <div class="matchitem graphicitem" | |
| 1898 style="background-color: black; width: 100.0%"></div> | |
| 1899 </div> | |
| 1900 </a> | |
| 1901 | |
| 1902 </div> | |
| 1903 </div> | |
| 1904 </div> | |
| 1905 </section> | |
| 1906 | |
| 1907 | |
| 1908 | |
| 1909 <section class=descriptions> | |
| 1910 <h2>Descriptions</h2> | |
| 1911 | |
| 1912 <div class=grey><div class=white> | |
| 1913 <h4 class=darkHeader>Sequences producing significant alignments:</h4> | |
| 1914 | |
| 1915 <table class=descriptiontable> | |
| 1916 <col/><col/><col/><col/><col/><col/><col/> | |
| 1917 <tr> | |
| 1918 <th>Description</th> | |
| 1919 <th>Max score</th> | |
| 1920 <th>Total score</th> | |
| 1921 <th>Query cover</th> | |
| 1922 <th>E value</th> | |
| 1923 <th>Ident</th> | |
| 1924 <th>Accession</th> | |
| 1925 </tr> | |
| 1926 <tr> | |
| 1927 <td><div><a href="#hit1" | |
| 1928 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" | |
| 1929 id="description1"> | |
| 1930 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 | |
| 1931 </a></div></td> | |
| 1932 <td>37.4</td> | |
| 1933 <td>37.4</td> | |
| 1934 <td>100%</td> | |
| 1935 <td>7.011e-08</td> | |
| 1936 <td>100%</td> | |
| 1937 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign">Subject_6</a></td> | |
| 1938 </tr> | |
| 1939 </table> | |
| 1940 | |
| 1941 </div></div> | |
| 1942 </section> | |
| 1943 | |
| 1944 | |
| 1945 | |
| 1946 <section class=alignments> | |
| 1947 <h2>Alignments</h2> | |
| 1948 | |
| 1949 <div class=grey><div class=white> | |
| 1950 <div class=alignment id=hit1> | |
| 1951 | |
| 1952 <div class=linkheader> | |
| 1953 <div class=right><a href="#description1">Descriptions</a></div> | |
| 1954 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign">GenBank</a> | |
| 1955 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=graph&log$=nuclalign">Graphics</a> | |
| 1956 </div> | |
| 1957 | |
| 1958 <div class=title> | |
| 1959 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> | |
| 1960 <p class=titleinfo> | |
| 1961 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign">Subject_6</a> | |
| 1962 <span class=b>Length:</span> 2457 | |
| 1963 <span class=b>Number of Matches:</span> 1 | |
| 1964 </p> | |
| 1965 </div> | |
| 1966 | |
| 1967 | |
| 1968 <div class=hotspot> | |
| 1969 <p class=range> | |
| 1970 <span class=range>Range 1: 2143 to 2162</span> | |
| 1971 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign&from=2143&to=2162">GenBank</a> | |
| 1972 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=graph&log$=nuclalign&from=2143&to=2162">Graphics</a> | |
| 1973 </p> | |
| 1974 | |
| 1975 <table class=hotspotstable> | |
| 1976 <tr> | |
| 1977 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1978 </tr> | |
| 1979 <tr> | |
| 1980 <td>37.4 bits(40)</td> | |
| 1981 <td>0.0</td> | |
| 1982 <td>20/20(100%)</td> | |
| 1983 <td>0/20(0%)</td> | |
| 1984 <td>Plus/Plus</td> | |
| 1985 </tr> | |
| 1986 </table> | |
| 1987 | |
| 1988 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 | |
| 1989 |||||||||||||||||||| | |
| 1990 Subject 2143 CGCGCGCGGTGTCATCTATG 2162</pre> | |
| 1991 </div> | |
| 1992 | |
| 1993 </div> | |
| 1994 | |
| 1995 </div></div> | |
| 1996 </section> | |
| 1997 </section> | |
| 1998 | |
| 1999 <section class=match id=match23> | |
| 2000 | |
| 2001 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 2002 | |
| 2003 <section class=header> | |
| 2004 | |
| 2005 <table class=headerdata> | |
| 2006 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2007 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2008 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2009 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2010 <tr><td class=param>Database:</td><td></td></tr> | |
| 2011 </table> | |
| 2012 | |
| 2013 </section> | |
| 2014 | |
| 2015 <section> | |
| 2016 <h2>No Hits</h2> | |
| 2017 <div class=grey> | |
| 2018 <table class=headerdata> | |
| 2019 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2020 </table> | |
| 2021 </div> | |
| 2022 </section> | |
| 2023 </section> | |
| 2024 | |
| 2025 <section class=match id=match24> | |
| 2026 | |
| 2027 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 2028 | |
| 2029 <section class=header> | |
| 2030 | |
| 2031 <table class=headerdata> | |
| 2032 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2033 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2034 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2035 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2036 <tr><td class=param>Database:</td><td></td></tr> | |
| 2037 </table> | |
| 2038 | |
| 2039 </section> | |
| 2040 | |
| 2041 <section> | |
| 2042 <h2>No Hits</h2> | |
| 2043 <div class=grey> | |
| 2044 <table class=headerdata> | |
| 2045 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2046 </table> | |
| 2047 </div> | |
| 2048 </section> | |
| 2049 </section> | |
| 2050 | |
| 2051 <section class=match id=match25> | |
| 2052 | |
| 2053 <h1>Nucleotide Sequence (24 letters)</h1> | |
| 2054 | |
| 2055 <section class=header> | |
| 2056 | |
| 2057 <table class=headerdata> | |
| 2058 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2059 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2060 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2061 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2062 <tr><td class=param>Database:</td><td></td></tr> | |
| 2063 </table> | |
| 2064 | |
| 2065 </section> | |
| 2066 | |
| 2067 <section> | |
| 2068 <h2>No Hits</h2> | |
| 2069 <div class=grey> | |
| 2070 <table class=headerdata> | |
| 2071 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2072 </table> | |
| 2073 </div> | |
| 2074 </section> | |
| 2075 </section> | |
| 2076 | |
| 2077 <section class=match id=match26> | |
| 2078 | |
| 2079 <h1>Nucleotide Sequence (24 letters)</h1> | |
| 2080 | |
| 2081 <section class=header> | |
| 2082 | |
| 2083 <table class=headerdata> | |
| 2084 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2085 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2086 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2087 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2088 <tr><td class=param>Database:</td><td></td></tr> | |
| 2089 </table> | |
| 2090 | |
| 2091 </section> | |
| 2092 | |
| 2093 <section> | |
| 2094 <h2>No Hits</h2> | |
| 2095 <div class=grey> | |
| 2096 <table class=headerdata> | |
| 2097 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2098 </table> | |
| 2099 </div> | |
| 2100 </section> | |
| 2101 </section> | |
| 2102 | |
| 2103 <section class=match id=match27> | |
| 2104 | |
| 2105 <h1>Nucleotide Sequence (24 letters)</h1> | |
| 2106 | |
| 2107 <section class=header> | |
| 2108 | |
| 2109 <table class=headerdata> | |
| 2110 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2111 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2112 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2113 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2114 <tr><td class=param>Database:</td><td></td></tr> | |
| 2115 </table> | |
| 2116 | |
| 2117 </section> | |
| 2118 | |
| 2119 <section> | |
| 2120 <h2>No Hits</h2> | |
| 2121 <div class=grey> | |
| 2122 <table class=headerdata> | |
| 2123 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2124 </table> | |
| 2125 </div> | |
| 2126 </section> | |
| 2127 </section> | |
| 2128 | |
| 2129 <section class=match id=match28> | |
| 2130 | |
| 2131 <h1>Nucleotide Sequence (24 letters)</h1> | |
| 2132 | |
| 2133 <section class=header> | |
| 2134 | |
| 2135 <table class=headerdata> | |
| 2136 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2137 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2138 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2139 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2140 <tr><td class=param>Database:</td><td></td></tr> | |
| 2141 </table> | |
| 2142 | |
| 2143 </section> | |
| 2144 | |
| 2145 <section> | |
| 2146 <h2>No Hits</h2> | |
| 2147 <div class=grey> | |
| 2148 <table class=headerdata> | |
| 2149 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2150 </table> | |
| 2151 </div> | |
| 2152 </section> | |
| 2153 </section> | |
| 2154 | |
| 2155 <section class=match id=match29> | |
| 2156 | |
| 2157 <h1>Nucleotide Sequence (24 letters)</h1> | |
| 2158 | |
| 2159 <section class=header> | |
| 2160 | |
| 2161 <table class=headerdata> | |
| 2162 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2163 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2164 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2165 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2166 <tr><td class=param>Database:</td><td></td></tr> | |
| 2167 </table> | |
| 2168 | |
| 2169 </section> | |
| 2170 | |
| 2171 <section> | |
| 2172 <h2>No Hits</h2> | |
| 2173 <div class=grey> | |
| 2174 <table class=headerdata> | |
| 2175 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2176 </table> | |
| 2177 </div> | |
| 2178 </section> | |
| 2179 </section> | |
| 2180 | |
| 2181 <section class=match id=match30> | |
| 2182 | |
| 2183 <h1>Nucleotide Sequence (24 letters)</h1> | |
| 2184 | |
| 2185 <section class=header> | |
| 2186 | |
| 2187 <table class=headerdata> | |
| 2188 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2189 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2190 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2191 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2192 <tr><td class=param>Database:</td><td></td></tr> | |
| 2193 </table> | |
| 2194 | |
| 2195 </section> | |
| 2196 | |
| 2197 <section> | |
| 2198 <h2>No Hits</h2> | |
| 2199 <div class=grey> | |
| 2200 <table class=headerdata> | |
| 2201 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2202 </table> | |
| 2203 </div> | |
| 2204 </section> | |
| 2205 </section> | |
| 2206 | |
| 2207 <section class=match id=match31> | |
| 2208 | |
| 2209 <h1>Nucleotide Sequence (24 letters)</h1> | |
| 2210 | |
| 2211 <section class=header> | |
| 2212 | |
| 2213 <table class=headerdata> | |
| 2214 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2215 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2216 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2217 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2218 <tr><td class=param>Database:</td><td></td></tr> | |
| 2219 </table> | |
| 2220 | |
| 2221 </section> | |
| 2222 | |
| 2223 <section> | |
| 2224 <h2>No Hits</h2> | |
| 2225 <div class=grey> | |
| 2226 <table class=headerdata> | |
| 2227 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2228 </table> | |
| 2229 </div> | |
| 2230 </section> | |
| 2231 </section> | |
| 2232 | |
| 2233 <section class=match id=match32> | |
| 2234 | |
| 2235 <h1>Nucleotide Sequence (24 letters)</h1> | |
| 2236 | |
| 2237 <section class=header> | |
| 2238 | |
| 2239 <table class=headerdata> | |
| 2240 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2241 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2242 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2243 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2244 <tr><td class=param>Database:</td><td></td></tr> | |
| 2245 </table> | |
| 2246 | |
| 2247 </section> | |
| 2248 | |
| 2249 <section> | |
| 2250 <h2>No Hits</h2> | |
| 2251 <div class=grey> | |
| 2252 <table class=headerdata> | |
| 2253 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2254 </table> | |
| 2255 </div> | |
| 2256 </section> | |
| 2257 </section> | |
| 2258 | |
| 2259 <section class=match id=match33> | |
| 2260 | |
| 2261 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 2262 | |
| 2263 <section class=header> | |
| 2264 | |
| 2265 <table class=headerdata> | |
| 2266 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2267 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2268 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2269 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2270 <tr><td class=param>Database:</td><td></td></tr> | |
| 2271 </table> | |
| 2272 | |
| 2273 </section> | |
| 2274 | |
| 2275 <section> | |
| 2276 <h2>No Hits</h2> | |
| 2277 <div class=grey> | |
| 2278 <table class=headerdata> | |
| 2279 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2280 </table> | |
| 2281 </div> | |
| 2282 </section> | |
| 2283 </section> | |
| 2284 | |
| 2285 <section class=match id=match34> | |
| 2286 | |
| 2287 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 2288 | |
| 2289 <section class=header> | |
| 2290 | |
| 2291 <table class=headerdata> | |
| 2292 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2293 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2294 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2295 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2296 <tr><td class=param>Database:</td><td></td></tr> | |
| 2297 </table> | |
| 2298 | |
| 2299 </section> | |
| 2300 | |
| 2301 <section> | |
| 2302 <h2>No Hits</h2> | |
| 2303 <div class=grey> | |
| 2304 <table class=headerdata> | |
| 2305 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2306 </table> | |
| 2307 </div> | |
| 2308 </section> | |
| 2309 </section> | |
| 2310 | |
| 2311 <section class=match id=match35> | |
| 2312 | |
| 2313 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 2314 | |
| 2315 <section class=header> | |
| 2316 | |
| 2317 <table class=headerdata> | |
| 2318 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2319 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2320 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2321 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2322 <tr><td class=param>Database:</td><td></td></tr> | |
| 2323 </table> | |
| 2324 | |
| 2325 </section> | |
| 2326 | |
| 2327 <section> | |
| 2328 <h2>No Hits</h2> | |
| 2329 <div class=grey> | |
| 2330 <table class=headerdata> | |
| 2331 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2332 </table> | |
| 2333 </div> | |
| 2334 </section> | |
| 2335 </section> | |
| 2336 | |
| 2337 <section class=match id=match36> | |
| 2338 | |
| 2339 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 2340 | |
| 2341 <section class=header> | |
| 2342 | |
| 2343 <table class=headerdata> | |
| 2344 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2345 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2346 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2347 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2348 <tr><td class=param>Database:</td><td></td></tr> | |
| 2349 </table> | |
| 2350 | |
| 2351 </section> | |
| 2352 | |
| 2353 <section> | |
| 2354 <h2>No Hits</h2> | |
| 2355 <div class=grey> | |
| 2356 <table class=headerdata> | |
| 2357 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2358 </table> | |
| 2359 </div> | |
| 2360 </section> | |
| 2361 </section> | |
| 2362 | |
| 2363 <section class=match id=match37> | |
| 2364 | |
| 2365 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 2366 | |
| 2367 <section class=header> | |
| 2368 | |
| 2369 <table class=headerdata> | |
| 2370 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2371 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2372 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2373 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2374 <tr><td class=param>Database:</td><td></td></tr> | |
| 2375 </table> | |
| 2376 | |
| 2377 </section> | |
| 2378 | |
| 2379 <section> | |
| 2380 <h2>No Hits</h2> | |
| 2381 <div class=grey> | |
| 2382 <table class=headerdata> | |
| 2383 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2384 </table> | |
| 2385 </div> | |
| 2386 </section> | |
| 2387 </section> | |
| 2388 | |
| 2389 <section class=match id=match38> | |
| 2390 | |
| 2391 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 2392 | |
| 2393 <section class=header> | |
| 2394 | |
| 2395 <table class=headerdata> | |
| 2396 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2397 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2398 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2399 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2400 <tr><td class=param>Database:</td><td></td></tr> | |
| 2401 </table> | |
| 2402 | |
| 2403 </section> | |
| 2404 | |
| 2405 <section> | |
| 2406 <h2>No Hits</h2> | |
| 2407 <div class=grey> | |
| 2408 <table class=headerdata> | |
| 2409 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2410 </table> | |
| 2411 </div> | |
| 2412 </section> | |
| 2413 </section> | |
| 2414 | |
| 2415 <section class=match id=match39> | |
| 2416 | |
| 2417 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 2418 | |
| 2419 <section class=header> | |
| 2420 | |
| 2421 <table class=headerdata> | |
| 2422 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2423 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2424 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2425 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2426 <tr><td class=param>Database:</td><td></td></tr> | |
| 2427 </table> | |
| 2428 | |
| 2429 </section> | |
| 2430 | |
| 2431 <section> | |
| 2432 <h2>No Hits</h2> | |
| 2433 <div class=grey> | |
| 2434 <table class=headerdata> | |
| 2435 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2436 </table> | |
| 2437 </div> | |
| 2438 </section> | |
| 2439 </section> | |
| 2440 | |
| 2441 <section class=match id=match40> | |
| 2442 | |
| 2443 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 2444 | |
| 2445 <section class=header> | |
| 2446 | |
| 2447 <table class=headerdata> | |
| 2448 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2449 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2450 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2451 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2452 <tr><td class=param>Database:</td><td></td></tr> | |
| 2453 </table> | |
| 2454 | |
| 2455 </section> | |
| 2456 | |
| 2457 <section> | |
| 2458 <h2>No Hits</h2> | |
| 2459 <div class=grey> | |
| 2460 <table class=headerdata> | |
| 2461 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2462 </table> | |
| 2463 </div> | |
| 2464 </section> | |
| 2465 </section> | |
| 2466 | |
| 2467 <section class=match id=match41> | |
| 2468 | |
| 2469 <h1>Nucleotide Sequence (25 letters)</h1> | |
| 2470 | |
| 2471 <section class=header> | |
| 2472 | |
| 2473 <table class=headerdata> | |
| 2474 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2475 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2476 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2477 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2478 <tr><td class=param>Database:</td><td></td></tr> | |
| 2479 </table> | |
| 2480 | |
| 2481 </section> | |
| 2482 | |
| 2483 <section> | |
| 2484 <h2>No Hits</h2> | |
| 2485 <div class=grey> | |
| 2486 <table class=headerdata> | |
| 2487 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2488 </table> | |
| 2489 </div> | |
| 2490 </section> | |
| 2491 </section> | |
| 2492 | |
| 2493 <section class=match id=match42> | |
| 2494 | |
| 2495 <h1>Nucleotide Sequence (25 letters)</h1> | |
| 2496 | |
| 2497 <section class=header> | |
| 2498 | |
| 2499 <table class=headerdata> | |
| 2500 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2501 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2502 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2503 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2504 <tr><td class=param>Database:</td><td></td></tr> | |
| 2505 </table> | |
| 2506 | |
| 2507 </section> | |
| 2508 | |
| 2509 <section> | |
| 2510 <h2>No Hits</h2> | |
| 2511 <div class=grey> | |
| 2512 <table class=headerdata> | |
| 2513 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2514 </table> | |
| 2515 </div> | |
| 2516 </section> | |
| 2517 </section> | |
| 2518 | |
| 2519 <section class=match id=match43> | |
| 2520 | |
| 2521 <h1>Nucleotide Sequence (25 letters)</h1> | |
| 2522 | |
| 2523 <section class=header> | |
| 2524 | |
| 2525 <table class=headerdata> | |
| 2526 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2527 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2528 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2529 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2530 <tr><td class=param>Database:</td><td></td></tr> | |
| 2531 </table> | |
| 2532 | |
| 2533 </section> | |
| 2534 | |
| 2535 <section> | |
| 2536 <h2>No Hits</h2> | |
| 2537 <div class=grey> | |
| 2538 <table class=headerdata> | |
| 2539 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2540 </table> | |
| 2541 </div> | |
| 2542 </section> | |
| 2543 </section> | |
| 2544 | |
| 2545 <section class=match id=match44> | |
| 2546 | |
| 2547 <h1>Nucleotide Sequence (25 letters)</h1> | |
| 2548 | |
| 2549 <section class=header> | |
| 2550 | |
| 2551 <table class=headerdata> | |
| 2552 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2553 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2554 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2555 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2556 <tr><td class=param>Database:</td><td></td></tr> | |
| 2557 </table> | |
| 2558 | |
| 2559 </section> | |
| 2560 | |
| 2561 <section> | |
| 2562 <h2>No Hits</h2> | |
| 2563 <div class=grey> | |
| 2564 <table class=headerdata> | |
| 2565 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2566 </table> | |
| 2567 </div> | |
| 2568 </section> | |
| 2569 </section> | |
| 2570 | |
| 2571 <section class=match id=match45> | |
| 2572 | |
| 2573 <h1>Nucleotide Sequence (25 letters)</h1> | |
| 2574 | |
| 2575 <section class=header> | |
| 2576 | |
| 2577 <table class=headerdata> | |
| 2578 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2579 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2580 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2581 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2582 <tr><td class=param>Database:</td><td></td></tr> | |
| 2583 </table> | |
| 2584 | |
| 2585 </section> | |
| 2586 | |
| 2587 <section> | |
| 2588 <h2>No Hits</h2> | |
| 2589 <div class=grey> | |
| 2590 <table class=headerdata> | |
| 2591 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2592 </table> | |
| 2593 </div> | |
| 2594 </section> | |
| 2595 </section> | |
| 2596 | |
| 2597 <section class=match id=match46> | |
| 2598 | |
| 2599 <h1>Nucleotide Sequence (25 letters)</h1> | |
| 2600 | |
| 2601 <section class=header> | |
| 2602 | |
| 2603 <table class=headerdata> | |
| 2604 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2605 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2606 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2607 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2608 <tr><td class=param>Database:</td><td></td></tr> | |
| 2609 </table> | |
| 2610 | |
| 2611 </section> | |
| 2612 | |
| 2613 <section> | |
| 2614 <h2>No Hits</h2> | |
| 2615 <div class=grey> | |
| 2616 <table class=headerdata> | |
| 2617 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2618 </table> | |
| 2619 </div> | |
| 2620 </section> | |
| 2621 </section> | |
| 2622 | |
| 2623 <section class=match id=match47> | |
| 2624 | |
| 2625 <h1>Nucleotide Sequence (25 letters)</h1> | |
| 2626 | |
| 2627 <section class=header> | |
| 2628 | |
| 2629 <table class=headerdata> | |
| 2630 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2631 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2632 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2633 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2634 <tr><td class=param>Database:</td><td></td></tr> | |
| 2635 </table> | |
| 2636 | |
| 2637 </section> | |
| 2638 | |
| 2639 | |
| 2640 <section class=graphics> | |
| 2641 <h2>Graphic Summary</h2> | |
| 2642 | |
| 2643 <div class=grey> | |
| 2644 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> | |
| 2645 | |
| 2646 <div class=defline id=defline47> | |
| 2647 Mouse-over to show defline and scores, click to show alignments | |
| 2648 </div> | |
| 2649 | |
| 2650 <div class=graphic> | |
| 2651 <h4 class=darkHeader>Color key for alignment scores</h4> | |
| 2652 <div class=legend><div class=graphicrow> | |
| 2653 <div class=graphicitem style="background-color: black"><40</div> | |
| 2654 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 2655 <div class=graphicitem style="background-color: green">50–80</div> | |
| 2656 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 2657 <div class=graphicitem style="background-color: red">200≤</div> | |
| 2658 </div></div> | |
| 2659 <div style="clear: left"></div> | |
| 2660 | |
| 2661 <div class=tablewrapper> | |
| 2662 | |
| 2663 <div class=scale> | |
| 2664 <div>query:</div> | |
| 2665 <div class=graphicrow> | |
| 2666 <div> | |
| 2667 <div class=graphicitem style="width: 12.0%"> | |
| 2668 <div>3</div> | |
| 2669 </div> | |
| 2670 <div class=graphicitem style="width: 12.0%"> | |
| 2671 <div>6</div> | |
| 2672 </div> | |
| 2673 <div class=graphicitem style="width: 12.0%"> | |
| 2674 <div>9</div> | |
| 2675 </div> | |
| 2676 <div class=graphicitem style="width: 12.0%"> | |
| 2677 <div>12</div> | |
| 2678 </div> | |
| 2679 <div class=graphicitem style="width: 12.0%"> | |
| 2680 <div>15</div> | |
| 2681 </div> | |
| 2682 <div class=graphicitem style="width: 12.0%"> | |
| 2683 <div>18</div> | |
| 2684 </div> | |
| 2685 <div class=graphicitem style="width: 12.0%"> | |
| 2686 <div>21</div> | |
| 2687 </div> | |
| 2688 <div class=graphicitem style="width: 12.0%"> | |
| 2689 <div>24</div> | |
| 2690 </div> | |
| 2691 <div class=graphicitem style="width: 4.0%"> | |
| 2692 <div>25</div> | |
| 2693 </div> | |
| 2694 </div> | |
| 2695 </div> | |
| 2696 <div style="clear: left"></div> | |
| 2697 </div> | |
| 2698 | |
| 2699 <a class=matchresult | |
| 2700 href="#hit1" | |
| 2701 onmouseover='document.getElementById("defline47").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' | |
| 2702 onmouseout='document.getElementById("defline47").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 2703 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> | |
| 2704 <div class="matchrow graphicrow"> | |
| 2705 <div class="matchitem graphicitem" | |
| 2706 style="background-color: black; width: 100.0%"></div> | |
| 2707 </div> | |
| 2708 </a> | |
| 2709 | |
| 2710 </div> | |
| 2711 </div> | |
| 2712 </div> | |
| 2713 </section> | |
| 2714 | |
| 2715 | |
| 2716 | |
| 2717 <section class=descriptions> | |
| 2718 <h2>Descriptions</h2> | |
| 2719 | |
| 2720 <div class=grey><div class=white> | |
| 2721 <h4 class=darkHeader>Sequences producing significant alignments:</h4> | |
| 2722 | |
| 2723 <table class=descriptiontable> | |
| 2724 <col/><col/><col/><col/><col/><col/><col/> | |
| 2725 <tr> | |
| 2726 <th>Description</th> | |
| 2727 <th>Max score</th> | |
| 2728 <th>Total score</th> | |
| 2729 <th>Query cover</th> | |
| 2730 <th>E value</th> | |
| 2731 <th>Ident</th> | |
| 2732 <th>Accession</th> | |
| 2733 </tr> | |
| 2734 <tr> | |
| 2735 <td><div><a href="#hit1" | |
| 2736 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" | |
| 2737 id="description1"> | |
| 2738 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 | |
| 2739 </a></div></td> | |
| 2740 <td>37.4</td> | |
| 2741 <td>37.4</td> | |
| 2742 <td>100%</td> | |
| 2743 <td>9.338e-08</td> | |
| 2744 <td>92%</td> | |
| 2745 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign">Subject_7</a></td> | |
| 2746 </tr> | |
| 2747 </table> | |
| 2748 | |
| 2749 </div></div> | |
| 2750 </section> | |
| 2751 | |
| 2752 | |
| 2753 | |
| 2754 <section class=alignments> | |
| 2755 <h2>Alignments</h2> | |
| 2756 | |
| 2757 <div class=grey><div class=white> | |
| 2758 <div class=alignment id=hit1> | |
| 2759 | |
| 2760 <div class=linkheader> | |
| 2761 <div class=right><a href="#description1">Descriptions</a></div> | |
| 2762 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign">GenBank</a> | |
| 2763 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=graph&log$=nuclalign">Graphics</a> | |
| 2764 </div> | |
| 2765 | |
| 2766 <div class=title> | |
| 2767 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> | |
| 2768 <p class=titleinfo> | |
| 2769 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign">Subject_7</a> | |
| 2770 <span class=b>Length:</span> 4180 | |
| 2771 <span class=b>Number of Matches:</span> 1 | |
| 2772 </p> | |
| 2773 </div> | |
| 2774 | |
| 2775 | |
| 2776 <div class=hotspot> | |
| 2777 <p class=range> | |
| 2778 <span class=range>Range 1: 1541 to 1565</span> | |
| 2779 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign&from=1541&to=1565">GenBank</a> | |
| 2780 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=graph&log$=nuclalign&from=1541&to=1565">Graphics</a> | |
| 2781 </p> | |
| 2782 | |
| 2783 <table class=hotspotstable> | |
| 2784 <tr> | |
| 2785 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 2786 </tr> | |
| 2787 <tr> | |
| 2788 <td>37.4 bits(40)</td> | |
| 2789 <td>0.0</td> | |
| 2790 <td>23/25(92%)</td> | |
| 2791 <td>0/25(0%)</td> | |
| 2792 <td>Plus/Plus</td> | |
| 2793 </tr> | |
| 2794 </table> | |
| 2795 | |
| 2796 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCACAGC 25 | |
| 2797 |||||||||||||| ||||||| || | |
| 2798 Subject 1541 ACATGAACAGCGCCCTGACCACCGC 1565</pre> | |
| 2799 </div> | |
| 2800 | |
| 2801 </div> | |
| 2802 | |
| 2803 </div></div> | |
| 2804 </section> | |
| 2805 </section> | |
| 2806 | |
| 2807 <section class=match id=match48> | |
| 2808 | |
| 2809 <h1>Nucleotide Sequence (25 letters)</h1> | |
| 2810 | |
| 2811 <section class=header> | |
| 2812 | |
| 2813 <table class=headerdata> | |
| 2814 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2815 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2816 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2817 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2818 <tr><td class=param>Database:</td><td></td></tr> | |
| 2819 </table> | |
| 2820 | |
| 2821 </section> | |
| 2822 | |
| 2823 | |
| 2824 <section class=graphics> | |
| 2825 <h2>Graphic Summary</h2> | |
| 2826 | |
| 2827 <div class=grey> | |
| 2828 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> | |
| 2829 | |
| 2830 <div class=defline id=defline48> | |
| 2831 Mouse-over to show defline and scores, click to show alignments | |
| 2832 </div> | |
| 2833 | |
| 2834 <div class=graphic> | |
| 2835 <h4 class=darkHeader>Color key for alignment scores</h4> | |
| 2836 <div class=legend><div class=graphicrow> | |
| 2837 <div class=graphicitem style="background-color: black"><40</div> | |
| 2838 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 2839 <div class=graphicitem style="background-color: green">50–80</div> | |
| 2840 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 2841 <div class=graphicitem style="background-color: red">200≤</div> | |
| 2842 </div></div> | |
| 2843 <div style="clear: left"></div> | |
| 2844 | |
| 2845 <div class=tablewrapper> | |
| 2846 | |
| 2847 <div class=scale> | |
| 2848 <div>query:</div> | |
| 2849 <div class=graphicrow> | |
| 2850 <div> | |
| 2851 <div class=graphicitem style="width: 12.0%"> | |
| 2852 <div>3</div> | |
| 2853 </div> | |
| 2854 <div class=graphicitem style="width: 12.0%"> | |
| 2855 <div>6</div> | |
| 2856 </div> | |
| 2857 <div class=graphicitem style="width: 12.0%"> | |
| 2858 <div>9</div> | |
| 2859 </div> | |
| 2860 <div class=graphicitem style="width: 12.0%"> | |
| 2861 <div>12</div> | |
| 2862 </div> | |
| 2863 <div class=graphicitem style="width: 12.0%"> | |
| 2864 <div>15</div> | |
| 2865 </div> | |
| 2866 <div class=graphicitem style="width: 12.0%"> | |
| 2867 <div>18</div> | |
| 2868 </div> | |
| 2869 <div class=graphicitem style="width: 12.0%"> | |
| 2870 <div>21</div> | |
| 2871 </div> | |
| 2872 <div class=graphicitem style="width: 12.0%"> | |
| 2873 <div>24</div> | |
| 2874 </div> | |
| 2875 <div class=graphicitem style="width: 4.0%"> | |
| 2876 <div>25</div> | |
| 2877 </div> | |
| 2878 </div> | |
| 2879 </div> | |
| 2880 <div style="clear: left"></div> | |
| 2881 </div> | |
| 2882 | |
| 2883 <a class=matchresult | |
| 2884 href="#hit1" | |
| 2885 onmouseover='document.getElementById("defline48").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' | |
| 2886 onmouseout='document.getElementById("defline48").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 2887 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> | |
| 2888 <div class="matchrow graphicrow"> | |
| 2889 <div class="matchitem graphicitem" | |
| 2890 style="background-color: black; width: 100.0%"></div> | |
| 2891 </div> | |
| 2892 </a> | |
| 2893 | |
| 2894 </div> | |
| 2895 </div> | |
| 2896 </div> | |
| 2897 </section> | |
| 2898 | |
| 2899 | |
| 2900 | |
| 2901 <section class=descriptions> | |
| 2902 <h2>Descriptions</h2> | |
| 2903 | |
| 2904 <div class=grey><div class=white> | |
| 2905 <h4 class=darkHeader>Sequences producing significant alignments:</h4> | |
| 2906 | |
| 2907 <table class=descriptiontable> | |
| 2908 <col/><col/><col/><col/><col/><col/><col/> | |
| 2909 <tr> | |
| 2910 <th>Description</th> | |
| 2911 <th>Max score</th> | |
| 2912 <th>Total score</th> | |
| 2913 <th>Query cover</th> | |
| 2914 <th>E value</th> | |
| 2915 <th>Ident</th> | |
| 2916 <th>Accession</th> | |
| 2917 </tr> | |
| 2918 <tr> | |
| 2919 <td><div><a href="#hit1" | |
| 2920 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" | |
| 2921 id="description1"> | |
| 2922 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 | |
| 2923 </a></div></td> | |
| 2924 <td>37.4</td> | |
| 2925 <td>37.4</td> | |
| 2926 <td>100%</td> | |
| 2927 <td>9.338e-08</td> | |
| 2928 <td>92%</td> | |
| 2929 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign">Subject_8</a></td> | |
| 2930 </tr> | |
| 2931 </table> | |
| 2932 | |
| 2933 </div></div> | |
| 2934 </section> | |
| 2935 | |
| 2936 | |
| 2937 | |
| 2938 <section class=alignments> | |
| 2939 <h2>Alignments</h2> | |
| 2940 | |
| 2941 <div class=grey><div class=white> | |
| 2942 <div class=alignment id=hit1> | |
| 2943 | |
| 2944 <div class=linkheader> | |
| 2945 <div class=right><a href="#description1">Descriptions</a></div> | |
| 2946 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign">GenBank</a> | |
| 2947 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=graph&log$=nuclalign">Graphics</a> | |
| 2948 </div> | |
| 2949 | |
| 2950 <div class=title> | |
| 2951 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> | |
| 2952 <p class=titleinfo> | |
| 2953 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign">Subject_8</a> | |
| 2954 <span class=b>Length:</span> 4983 | |
| 2955 <span class=b>Number of Matches:</span> 1 | |
| 2956 </p> | |
| 2957 </div> | |
| 2958 | |
| 2959 | |
| 2960 <div class=hotspot> | |
| 2961 <p class=range> | |
| 2962 <span class=range>Range 1: 2344 to 2368</span> | |
| 2963 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign&from=2344&to=2368">GenBank</a> | |
| 2964 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=graph&log$=nuclalign&from=2344&to=2368">Graphics</a> | |
| 2965 </p> | |
| 2966 | |
| 2967 <table class=hotspotstable> | |
| 2968 <tr> | |
| 2969 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 2970 </tr> | |
| 2971 <tr> | |
| 2972 <td>37.4 bits(40)</td> | |
| 2973 <td>0.0</td> | |
| 2974 <td>23/25(92%)</td> | |
| 2975 <td>0/25(0%)</td> | |
| 2976 <td>Plus/Plus</td> | |
| 2977 </tr> | |
| 2978 </table> | |
| 2979 | |
| 2980 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCACAGC 25 | |
| 2981 |||||||||||||| ||||||| || | |
| 2982 Subject 2344 ACATGAACAGCGCCCTGACCACCGC 2368</pre> | |
| 2983 </div> | |
| 2984 | |
| 2985 </div> | |
| 2986 | |
| 2987 </div></div> | |
| 2988 </section> | |
| 2989 </section> | |
| 2990 | |
| 2991 <section class=match id=match49> | |
| 2992 | |
| 2993 <h1>Nucleotide Sequence (74 letters)</h1> | |
| 2994 | |
| 2995 <section class=header> | |
| 2996 | |
| 2997 <table class=headerdata> | |
| 2998 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2999 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 3000 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 3001 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 3002 <tr><td class=param>Database:</td><td></td></tr> | |
| 3003 </table> | |
| 3004 | |
| 3005 </section> | |
| 3006 | |
| 3007 <section> | |
| 3008 <h2>No Hits</h2> | |
| 3009 <div class=grey> | |
| 3010 <table class=headerdata> | |
| 3011 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 3012 </table> | |
| 3013 </div> | |
| 3014 </section> | |
| 3015 </section> | |
| 3016 | |
| 3017 <section class=match id=match50> | |
| 3018 | |
| 3019 <h1>Nucleotide Sequence (74 letters)</h1> | |
| 3020 | |
| 3021 <section class=header> | |
| 3022 | |
| 3023 <table class=headerdata> | |
| 3024 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 3025 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 3026 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 3027 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 3028 <tr><td class=param>Database:</td><td></td></tr> | |
| 3029 </table> | |
| 3030 | |
| 3031 </section> | |
| 3032 | |
| 3033 <section> | |
| 3034 <h2>No Hits</h2> | |
| 3035 <div class=grey> | |
| 3036 <table class=headerdata> | |
| 3037 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 3038 </table> | |
| 3039 </div> | |
| 3040 </section> | |
| 3041 </section> | |
| 3042 | |
| 3043 <section class=match id=match51> | |
| 3044 | |
| 3045 <h1>Nucleotide Sequence (74 letters)</h1> | |
| 3046 | |
| 3047 <section class=header> | |
| 3048 | |
| 3049 <table class=headerdata> | |
| 3050 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 3051 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 3052 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 3053 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 3054 <tr><td class=param>Database:</td><td></td></tr> | |
| 3055 </table> | |
| 3056 | |
| 3057 </section> | |
| 3058 | |
| 3059 <section> | |
| 3060 <h2>No Hits</h2> | |
| 3061 <div class=grey> | |
| 3062 <table class=headerdata> | |
| 3063 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 3064 </table> | |
| 3065 </div> | |
| 3066 </section> | |
| 3067 </section> | |
| 3068 | |
| 3069 <section class=match id=match52> | |
| 3070 | |
| 3071 <h1>Nucleotide Sequence (74 letters)</h1> | |
| 3072 | |
| 3073 <section class=header> | |
| 3074 | |
| 3075 <table class=headerdata> | |
| 3076 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 3077 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 3078 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 3079 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 3080 <tr><td class=param>Database:</td><td></td></tr> | |
| 3081 </table> | |
| 3082 | |
| 3083 </section> | |
| 3084 | |
| 3085 <section> | |
| 3086 <h2>No Hits</h2> | |
| 3087 <div class=grey> | |
| 3088 <table class=headerdata> | |
| 3089 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 3090 </table> | |
| 3091 </div> | |
| 3092 </section> | |
| 3093 </section> | |
| 3094 | |
| 3095 <section class=match id=match53> | |
| 3096 | |
| 3097 <h1>Nucleotide Sequence (74 letters)</h1> | |
| 3098 | |
| 3099 <section class=header> | |
| 3100 | |
| 3101 <table class=headerdata> | |
| 3102 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 3103 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 3104 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 3105 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 3106 <tr><td class=param>Database:</td><td></td></tr> | |
| 3107 </table> | |
| 3108 | |
| 3109 </section> | |
| 3110 | |
| 3111 <section> | |
| 3112 <h2>No Hits</h2> | |
| 3113 <div class=grey> | |
| 3114 <table class=headerdata> | |
| 3115 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 3116 </table> | |
| 3117 </div> | |
| 3118 </section> | |
| 3119 </section> | |
| 3120 | |
| 3121 <section class=match id=match54> | |
| 3122 | |
| 3123 <h1>Nucleotide Sequence (74 letters)</h1> | |
| 3124 | |
| 3125 <section class=header> | |
| 3126 | |
| 3127 <table class=headerdata> | |
| 3128 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 3129 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 3130 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 3131 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 3132 <tr><td class=param>Database:</td><td></td></tr> | |
| 3133 </table> | |
| 3134 | |
| 3135 </section> | |
| 3136 | |
| 3137 <section> | |
| 3138 <h2>No Hits</h2> | |
| 3139 <div class=grey> | |
| 3140 <table class=headerdata> | |
| 3141 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 3142 </table> | |
| 3143 </div> | |
| 3144 </section> | |
| 3145 </section> | |
| 3146 | |
| 3147 <section class=match id=match55> | |
| 3148 | |
| 3149 <h1>Nucleotide Sequence (74 letters)</h1> | |
| 3150 | |
| 3151 <section class=header> | |
| 3152 | |
| 3153 <table class=headerdata> | |
| 3154 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 3155 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 3156 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 3157 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 3158 <tr><td class=param>Database:</td><td></td></tr> | |
| 3159 </table> | |
| 3160 | |
| 3161 </section> | |
| 3162 | |
| 3163 | |
| 3164 <section class=graphics> | |
| 3165 <h2>Graphic Summary</h2> | |
| 3166 | |
| 3167 <div class=grey> | |
| 3168 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> | |
| 3169 | |
| 3170 <div class=defline id=defline55> | |
| 3171 Mouse-over to show defline and scores, click to show alignments | |
| 3172 </div> | |
| 3173 | |
| 3174 <div class=graphic> | |
| 3175 <h4 class=darkHeader>Color key for alignment scores</h4> | |
| 3176 <div class=legend><div class=graphicrow> | |
| 3177 <div class=graphicitem style="background-color: black"><40</div> | |
| 3178 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 3179 <div class=graphicitem style="background-color: green">50–80</div> | |
| 3180 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 3181 <div class=graphicitem style="background-color: red">200≤</div> | |
| 3182 </div></div> | |
| 3183 <div style="clear: left"></div> | |
| 3184 | |
| 3185 <div class=tablewrapper> | |
| 3186 | |
| 3187 <div class=scale> | |
| 3188 <div>query:</div> | |
| 3189 <div class=graphicrow> | |
| 3190 <div> | |
| 3191 <div class=graphicitem style="width: 10.81081081081081%"> | |
| 3192 <div>8</div> | |
| 3193 </div> | |
| 3194 <div class=graphicitem style="width: 10.81081081081081%"> | |
| 3195 <div>16</div> | |
| 3196 </div> | |
| 3197 <div class=graphicitem style="width: 10.81081081081081%"> | |
| 3198 <div>24</div> | |
| 3199 </div> | |
| 3200 <div class=graphicitem style="width: 10.81081081081081%"> | |
| 3201 <div>32</div> | |
| 3202 </div> | |
| 3203 <div class=graphicitem style="width: 10.81081081081081%"> | |
| 3204 <div>40</div> | |
| 3205 </div> | |
| 3206 <div class=graphicitem style="width: 10.81081081081081%"> | |
| 3207 <div>48</div> | |
| 3208 </div> | |
| 3209 <div class=graphicitem style="width: 10.81081081081081%"> | |
| 3210 <div>56</div> | |
| 3211 </div> | |
| 3212 <div class=graphicitem style="width: 10.81081081081081%"> | |
| 3213 <div>64</div> | |
| 3214 </div> | |
| 3215 <div class=graphicitem style="width: 10.81081081081081%"> | |
| 3216 <div>72</div> | |
| 3217 </div> | |
| 3218 <div class=graphicitem style="width: 2.7027027027027026%"> | |
| 3219 <div> </div> | |
| 3220 <div class=lastlabel>74</div> | |
| 3221 </div> | |
| 3222 </div> | |
| 3223 </div> | |
| 3224 <div style="clear: left"></div> | |
| 3225 </div> | |
| 3226 | |
| 3227 <a class=matchresult | |
| 3228 href="#hit1" | |
| 3229 onmouseover='document.getElementById("defline55").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' | |
| 3230 onmouseout='document.getElementById("defline55").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 3231 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> | |
| 3232 <div class="matchrow graphicrow"> | |
| 3233 <div class="matchitem graphicitem" | |
| 3234 style="background-color: green; width: 100.0%"></div> | |
| 3235 </div> | |
| 3236 </a> | |
| 3237 | |
| 3238 </div> | |
| 3239 </div> | |
| 3240 </div> | |
| 3241 </section> | |
| 3242 | |
| 3243 | |
| 3244 | |
| 3245 <section class=descriptions> | |
| 3246 <h2>Descriptions</h2> | |
| 3247 | |
| 3248 <div class=grey><div class=white> | |
| 3249 <h4 class=darkHeader>Sequences producing significant alignments:</h4> | |
| 3250 | |
| 3251 <table class=descriptiontable> | |
| 3252 <col/><col/><col/><col/><col/><col/><col/> | |
| 3253 <tr> | |
| 3254 <th>Description</th> | |
| 3255 <th>Max score</th> | |
| 3256 <th>Total score</th> | |
| 3257 <th>Query cover</th> | |
| 3258 <th>E value</th> | |
| 3259 <th>Ident</th> | |
| 3260 <th>Accession</th> | |
| 3261 </tr> | |
| 3262 <tr> | |
| 3263 <td><div><a href="#hit1" | |
| 3264 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" | |
| 3265 id="description1"> | |
| 3266 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 | |
| 3267 </a></div></td> | |
| 3268 <td>89.7</td> | |
| 3269 <td>89.7</td> | |
| 3270 <td>100%</td> | |
| 3271 <td>6.629e-23</td> | |
| 3272 <td>86%</td> | |
| 3273 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign">Subject_7</a></td> | |
| 3274 </tr> | |
| 3275 </table> | |
| 3276 | |
| 3277 </div></div> | |
| 3278 </section> | |
| 3279 | |
| 3280 | |
| 3281 | |
| 3282 <section class=alignments> | |
| 3283 <h2>Alignments</h2> | |
| 3284 | |
| 3285 <div class=grey><div class=white> | |
| 3286 <div class=alignment id=hit1> | |
| 3287 | |
| 3288 <div class=linkheader> | |
| 3289 <div class=right><a href="#description1">Descriptions</a></div> | |
| 3290 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign">GenBank</a> | |
| 3291 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=graph&log$=nuclalign">Graphics</a> | |
| 3292 </div> | |
| 3293 | |
| 3294 <div class=title> | |
| 3295 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> | |
| 3296 <p class=titleinfo> | |
| 3297 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign">Subject_7</a> | |
| 3298 <span class=b>Length:</span> 4180 | |
| 3299 <span class=b>Number of Matches:</span> 1 | |
| 3300 </p> | |
| 3301 </div> | |
| 3302 | |
| 3303 | |
| 3304 <div class=hotspot> | |
| 3305 <p class=range> | |
| 3306 <span class=range>Range 1: 1516 to 1589</span> | |
| 3307 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign&from=1516&to=1589">GenBank</a> | |
| 3308 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=graph&log$=nuclalign&from=1516&to=1589">Graphics</a> | |
| 3309 </p> | |
| 3310 | |
| 3311 <table class=hotspotstable> | |
| 3312 <tr> | |
| 3313 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 3314 </tr> | |
| 3315 <tr> | |
| 3316 <td>89.7 bits(98)</td> | |
| 3317 <td>0.0</td> | |
| 3318 <td>64/74(86%)</td> | |
| 3319 <td>0/74(0%)</td> | |
| 3320 <td>Plus/Plus</td> | |
| 3321 </tr> | |
| 3322 </table> | |
| 3323 | |
| 3324 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTGTTCGCAGTCCAGAA 74 | |
| 3325 ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | ||||| |||||||| | |
| 3326 Subject 1516 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTCTTCGCCGTCCAGAA 1589</pre> | |
| 3327 </div> | |
| 3328 | |
| 3329 </div> | |
| 3330 | |
| 3331 </div></div> | |
| 3332 </section> | |
| 3333 </section> | |
| 3334 | |
| 3335 <section class=match id=match56> | |
| 3336 | |
| 3337 <h1>Nucleotide Sequence (74 letters)</h1> | |
| 3338 | |
| 3339 <section class=header> | |
| 3340 | |
| 3341 <table class=headerdata> | |
| 3342 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 3343 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 3344 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 3345 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 3346 <tr><td class=param>Database:</td><td></td></tr> | |
| 3347 </table> | |
| 3348 | |
| 3349 </section> | |
| 3350 | |
| 3351 | |
| 3352 <section class=graphics> | |
| 3353 <h2>Graphic Summary</h2> | |
| 3354 | |
| 3355 <div class=grey> | |
| 3356 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> | |
| 3357 | |
| 3358 <div class=defline id=defline56> | |
| 3359 Mouse-over to show defline and scores, click to show alignments | |
| 3360 </div> | |
| 3361 | |
| 3362 <div class=graphic> | |
| 3363 <h4 class=darkHeader>Color key for alignment scores</h4> | |
| 3364 <div class=legend><div class=graphicrow> | |
| 3365 <div class=graphicitem style="background-color: black"><40</div> | |
| 3366 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 3367 <div class=graphicitem style="background-color: green">50–80</div> | |
| 3368 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 3369 <div class=graphicitem style="background-color: red">200≤</div> | |
| 3370 </div></div> | |
| 3371 <div style="clear: left"></div> | |
| 3372 | |
| 3373 <div class=tablewrapper> | |
| 3374 | |
| 3375 <div class=scale> | |
| 3376 <div>query:</div> | |
| 3377 <div class=graphicrow> | |
| 3378 <div> | |
| 3379 <div class=graphicitem style="width: 10.81081081081081%"> | |
| 3380 <div>8</div> | |
| 3381 </div> | |
| 3382 <div class=graphicitem style="width: 10.81081081081081%"> | |
| 3383 <div>16</div> | |
| 3384 </div> | |
| 3385 <div class=graphicitem style="width: 10.81081081081081%"> | |
| 3386 <div>24</div> | |
| 3387 </div> | |
| 3388 <div class=graphicitem style="width: 10.81081081081081%"> | |
| 3389 <div>32</div> | |
| 3390 </div> | |
| 3391 <div class=graphicitem style="width: 10.81081081081081%"> | |
| 3392 <div>40</div> | |
| 3393 </div> | |
| 3394 <div class=graphicitem style="width: 10.81081081081081%"> | |
| 3395 <div>48</div> | |
| 3396 </div> | |
| 3397 <div class=graphicitem style="width: 10.81081081081081%"> | |
| 3398 <div>56</div> | |
| 3399 </div> | |
| 3400 <div class=graphicitem style="width: 10.81081081081081%"> | |
| 3401 <div>64</div> | |
| 3402 </div> | |
| 3403 <div class=graphicitem style="width: 10.81081081081081%"> | |
| 3404 <div>72</div> | |
| 3405 </div> | |
| 3406 <div class=graphicitem style="width: 2.7027027027027026%"> | |
| 3407 <div> </div> | |
| 3408 <div class=lastlabel>74</div> | |
| 3409 </div> | |
| 3410 </div> | |
| 3411 </div> | |
| 3412 <div style="clear: left"></div> | |
| 3413 </div> | |
| 3414 | |
| 3415 <a class=matchresult | |
| 3416 href="#hit1" | |
| 3417 onmouseover='document.getElementById("defline56").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' | |
| 3418 onmouseout='document.getElementById("defline56").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 3419 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> | |
| 3420 <div class="matchrow graphicrow"> | |
| 3421 <div class="matchitem graphicitem" | |
| 3422 style="background-color: green; width: 100.0%"></div> | |
| 3423 </div> | |
| 3424 </a> | |
| 3425 | |
| 3426 </div> | |
| 3427 </div> | |
| 3428 </div> | |
| 3429 </section> | |
| 3430 | |
| 3431 | |
| 3432 | |
| 3433 <section class=descriptions> | |
| 3434 <h2>Descriptions</h2> | |
| 3435 | |
| 3436 <div class=grey><div class=white> | |
| 3437 <h4 class=darkHeader>Sequences producing significant alignments:</h4> | |
| 3438 | |
| 3439 <table class=descriptiontable> | |
| 3440 <col/><col/><col/><col/><col/><col/><col/> | |
| 3441 <tr> | |
| 3442 <th>Description</th> | |
| 3443 <th>Max score</th> | |
| 3444 <th>Total score</th> | |
| 3445 <th>Query cover</th> | |
| 3446 <th>E value</th> | |
| 3447 <th>Ident</th> | |
| 3448 <th>Accession</th> | |
| 3449 </tr> | |
| 3450 <tr> | |
| 3451 <td><div><a href="#hit1" | |
| 3452 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" | |
| 3453 id="description1"> | |
| 3454 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 | |
| 3455 </a></div></td> | |
| 3456 <td>89.7</td> | |
| 3457 <td>89.7</td> | |
| 3458 <td>100%</td> | |
| 3459 <td>6.629e-23</td> | |
| 3460 <td>86%</td> | |
| 3461 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign">Subject_8</a></td> | |
| 3462 </tr> | |
| 3463 </table> | |
| 3464 | |
| 3465 </div></div> | |
| 3466 </section> | |
| 3467 | |
| 3468 | |
| 3469 | |
| 3470 <section class=alignments> | |
| 3471 <h2>Alignments</h2> | |
| 3472 | |
| 3473 <div class=grey><div class=white> | |
| 3474 <div class=alignment id=hit1> | |
| 3475 | |
| 3476 <div class=linkheader> | |
| 3477 <div class=right><a href="#description1">Descriptions</a></div> | |
| 3478 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign">GenBank</a> | |
| 3479 <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=graph&log$=nuclalign">Graphics</a> | |
| 3480 </div> | |
| 3481 | |
| 3482 <div class=title> | |
| 3483 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> | |
| 3484 <p class=titleinfo> | |
| 3485 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign">Subject_8</a> | |
| 3486 <span class=b>Length:</span> 4983 | |
| 3487 <span class=b>Number of Matches:</span> 1 | |
| 3488 </p> | |
| 3489 </div> | |
| 3490 | |
| 3491 | |
| 3492 <div class=hotspot> | |
| 3493 <p class=range> | |
| 3494 <span class=range>Range 1: 2319 to 2392</span> | |
| 3495 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign&from=2319&to=2392">GenBank</a> | |
| 3496 <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=graph&log$=nuclalign&from=2319&to=2392">Graphics</a> | |
| 3497 </p> | |
| 3498 | |
| 3499 <table class=hotspotstable> | |
| 3500 <tr> | |
| 3501 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 3502 </tr> | |
| 3503 <tr> | |
| 3504 <td>89.7 bits(98)</td> | |
| 3505 <td>0.0</td> | |
| 3506 <td>64/74(86%)</td> | |
| 3507 <td>0/74(0%)</td> | |
| 3508 <td>Plus/Plus</td> | |
| 3509 </tr> | |
| 3510 </table> | |
| 3511 | |
| 3512 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTGTTCGCAGTCCAGAA 74 | |
| 3513 ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | ||||| |||||||| | |
| 3514 Subject 2319 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTCTTCGCCGTCCAGAA 2392</pre> | |
| 3515 </div> | |
| 3516 | |
| 3517 </div> | |
| 3518 | |
| 3519 </div></div> | |
| 3520 </section> | |
| 3521 </section> | |
| 3522 | |
| 3523 </div> | |
| 3524 | |
| 3525 <footer> | |
|
33
3bb5da68305e
add test update script, add url to github page
Jan Kanis <jan.code@jankanis.nl>
parents:
32
diff
changeset
|
3526 This page was generated by <a href="https://github.com/thehyve/blast2html/">blast2html</a>. |
| 32 | 3527 </footer> |
| 3528 </body> | |
| 3529 </html> | |
| 3530 |
