# HG changeset patch
# User iuc
# Date 1737367774 0
# Node ID cfbd9a5694ffdc85304fd4982ca695b46e3f9a56
# Parent  b23add4731b4ee5f7e17b59ccae250d4c20e85f2
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/snippy commit bc5bbb26c53bf2455043cf4b8f552571e6f74530

diff -r b23add4731b4 -r cfbd9a5694ff macros.xml.orig
--- a/macros.xml.orig	Wed Sep 01 08:39:51 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,83 +0,0 @@
-<macros>
-    <xml name="requirements">
-        <requirements>
-            <requirement type="package" version="@WRAPPER_VERSION@">snippy</requirement>
-            <requirement type="package" version="1.32">tar</requirement>
-            <yield />
-        </requirements>
-    </xml>
-<<<<<<< HEAD
-
-    <token name="@WRAPPER_VERSION@">4.6.0</token>
-    <token name="@VERSION_SUFFIX@">0</token>
-=======
-    <xml name="bio_tools">
-        <xrefs>
-            <xref type='bio.tools'>snippy</xref>
-        </xrefs>
-    </xml>
-    <token name="@WRAPPER_VERSION@">4.5.0</token>
-    <token name="@VERSION_SUFFIX@">1</token>
->>>>>>> 3b8498343 (and the rest)
-
-    <xml name="version_command">
-        <version_command><![CDATA[snippy --version]]></version_command>
-    </xml>
-
-    <token name="@REFERENCE_SOURCE_FILE@">
-        <![CDATA[
-        #if $reference_source.reference_source_selector == 'history'
-            #if $reference_source.ref_file.is_of_type("fasta")
-                ln -sf '$reference_source.ref_file' 'ref.fna' &&
-            #elif $reference_source.ref_file.is_of_type("genbank")
-                ln -sf '$reference_source.ref_file' 'ref.gbk' &&
-            #end if
-        #elif $reference_source.reference_source_selector == 'cached'
-            ln -sf '$reference_source.ref_file.fields.path' 'ref.fna' &&
-        #end if]]>
-    </token>
-
-    <token name="@REFERENCE_COMMAND@">
-        <![CDATA[
-        #if $reference_source.reference_source_selector == 'history'
-            #if $reference_source.ref_file.is_of_type("fasta")
-                --ref 'ref.fna'
-            #elif $reference_source.ref_file.is_of_type("genbank")
-                --ref 'ref.gbk'
-            #end if
-        #elif $reference_source.reference_source_selector == 'cached'
-            --ref 'ref.fna'
-        #end if
-        ]]>
-    </token>
-
-    <xml name="reference_selector">
-        <conditional name="reference_source">
-            <param name="reference_source_selector" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options. See `Indexes` section of help below. If you would like to perform self-mapping select `history` here, then choose your input file as reference.">
-                <option value="cached">Use a built-in genome index</option>
-                <option value="history">Use a genome from history and build index</option>
-            </param>
-            <when value="cached">
-                <param name="ref_file" type="select" label="Using reference genome" help="Select genome from the list">
-                    <options from_data_table="all_fasta">
-                        <validator type="no_options" message="No reference genomes are available" />
-                    </options>
-                </param>
-            </when>
-            <when value="history">
-                <param name="ref_file" type="data" format="fasta,fasta.gz,genbank" label="Use the following dataset as the reference sequence" help="You can upload a FASTA or FASTQ sequence to the history and use it as reference" />
-            </when>
-        </conditional>
-    </xml>
-
-    <xml name="citations">
-      <citations>
-          <citation type="bibtex">@UNPUBLISHED{Seemann2013,
-              author = "Seemann T",
-              title = "snippy: fast bacterial variant calling from NGS reads",
-              year = "2015",
-              note = "https://github.com/tseemann/snippy",
-              url = "https://github.com/tseemann/snippy"}</citation>
-      </citations>
-    </xml>
-</macros>
diff -r b23add4731b4 -r cfbd9a5694ff snippy.xml
--- a/snippy.xml	Wed Sep 01 08:39:51 2021 +0000
+++ b/snippy.xml	Mon Jan 20 10:09:34 2025 +0000
@@ -2,7 +2,6 @@
   <description>
       Snippy finds SNPs between a haploid reference genome and your NGS sequence reads.
     </description>
-    <expand macro="bio_tools"/>
     <macros>
         <import>macros.xml</import>
     </macros>
@@ -22,6 +21,8 @@
             #set $dir_name = re.sub('[^\w_]', '_', $fastq_input.fastq_input_single.element_identifier)
         #elif str( $fastq_input.fastq_input_selector ) == "paired_iv"
             #set $dir_name = re.sub('[^\w_]', '_', $fastq_input.fastq_input_interleaved.element_identifier)
+        #elif str( $fastq_input.fastq_input_selector ) == "contigs"
+            #set $dir_name = re.sub('[^\w_]', '_', $fastq_input.fasta_input.element_identifier)
         #end if
 
         snippy
@@ -50,6 +51,8 @@
                 --se '$fastq_input.fastq_input_single'
             #elif str( $fastq_input.fastq_input_selector ) == "paired_iv"
                 --peil '$fastq_input.fastq_input_interleaved'
+            #elif str( $fastq_input.fastq_input_selector ) == "contigs"
+                --ctgs '$fastq_input.fasta_input'
             #end if
 
         #if "outcon" in str($outputs) and $adv.rename_cons
@@ -63,11 +66,12 @@
     <inputs>
         <expand macro="reference_selector" />
         <conditional name="fastq_input">
-            <param name="fastq_input_selector" type="select" label="Single or Paired-end reads" help="Select between paired and single end data">
-                <option value="paired">Paired</option>
-                <option value="single">Single</option>
-                <option value="paired_collection">Paired Collection</option>
-                <option value="paired_iv">Paired Interleaved</option>
+            <param name="fastq_input_selector" type="select" label="Input type" help="Select paired/single end raw read data or assembled contigs">
+                <option value="paired">Paired end reads</option>
+                <option value="single">Single end reads</option>
+                <option value="paired_collection">Paired end reads in a collection</option>
+                <option value="paired_iv">Interleaved paired end reads</option>
+                <option value="contigs">Assembled Contigs</option>
             </param>
             <when value="paired">
                 <param name="fastq_input1" type="data" format="fastqsanger,fastqsanger.gz,fasta,fasta.gz" label="Select first set of reads" help="Specify dataset with forward reads"/>
@@ -82,6 +86,10 @@
             <when value="paired_iv">
                 <param name="fastq_input_interleaved" type="data" format="fastqsanger,fastqsanger.gz" label="Select fastq dataset" help="Specify dataset with interleaved reads"/>
             </when>
+            <when value="contigs">
+                <param name="fasta_input" type="data" format="fasta" label="Select fasta dataset" help="Specify dataset with assembled contigs"/>
+            </when>
+
         </conditional>
 
         <section name="adv" title="Advanced parameters" expanded="false">
@@ -219,6 +227,22 @@
             <output name="snpsum" ftype="tabular" file="b_fna_ref_mincov_2_minqual_60.snps.txt" lines_diff="8" />
             <output name="snpgff" ftype="gff3" file="b_2_fna_ref_mincov_2_minqual_60.snps.gff" lines_diff="2"/>
         </test>
+
+        <test>            <!-- test 5 - fasta ref one snp single -->
+            <conditional name="reference_source">
+                <param name="reference_source_selector" value="history"/>
+                <param name="ref_file" value="reference.fasta" ftype="fasta"/>
+            </conditional>
+            <conditional name="fastq_input">
+                <param name="fastq_input_selector" value="contigs" />
+                <param name="fasta_input" value="contigs.fasta" ftype="fasta" />
+            </conditional>
+            <param name="mincov" value="2" />
+            <param name="minqual" value="60" />
+            <param name="outputs" value="outgff,outsum" />
+            <output name="snpsum" ftype="tabular" file="d_fna_ref_mincov_1_minqual_60.snps.txt" lines_diff="6" />
+            <output name="snpgff" ftype="gff3" file="d_fna_ref_mincov_1_minqual_60.snps.gff" lines_diff="2"/>
+        </test>
     </tests>
 
 
diff -r b23add4731b4 -r cfbd9a5694ff test-data/contigs.fasta
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/contigs.fasta	Mon Jan 20 10:09:34 2025 +0000
@@ -0,0 +1,11 @@
+>reference
+TCCACAAGCCATTGTGTGTAATTAACCACTAATTGTGTATAAGTTTAAACTAATTGAAAAGGTTATCCAC
+AATAAAAAGGCGTTATTCAGGAGTTATCCACACTTTCTAGGAAAGGATTTCATTGCGCCAATGTGTTAAA
+TTATTTACCGAATACGAAAAAAAGACAAATAAATGAGGTTGTGAAAAATGATATTTCAACGGCTTTTGAA
+GACTAGAGATACAGAGTTTTATCGAGTTATACAAAACAGGAATATTGACGACGTATTTGGATACTTATTA
+ATTCACGATAAACGGGAACCAGCAGAAATTGACGATTTTAAGGTATTTGCAAAAAGTAATATAAATAAAG
+AAGCTTTTTCAGTGAATATCAAAAAAAATCATATTTACACGATGTTTTTCCACTTTACTGATTTAGAGGA
+AGAACAGGAAATTCCAAAATTTACTAAAGTTATTCGTTTTATAGAAGGACTTTTATCTTTTCAGCCAGAA
+ACAAGCCATTACGTTGATAACTATTTAATAAAGGAAAAACTAATTTTTGAATATCCTGCTGAATTTGAGA
+AAATCGGGGAGTTTGCTAAATATTTAGTAAAGCTTTCGGGTCGTAAAATTACTATTCCAGACACAACGAG
+AGAAAAATATATCTATTTAACGCAATAATTTTCGAAAAATGGTTTTTCTCTCTATAAAAATATGATATGA
diff -r b23add4731b4 -r cfbd9a5694ff test-data/d_fna_ref_mincov_1_minqual_60.snps.gff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/d_fna_ref_mincov_1_minqual_60.snps.gff	Mon Jan 20 10:09:34 2025 +0000
@@ -0,0 +1,3 @@
+##gff-version 3
+reference	snippy:4.6.0	variation	141	141	.	.	0	note=snp C=>T T:4 C:0
+reference	snippy:4.6.0	variation	211	211	.	.	0	note=snp A=>G G:5 A:0
diff -r b23add4731b4 -r cfbd9a5694ff test-data/d_fna_ref_mincov_1_minqual_60.snps.txt
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/d_fna_ref_mincov_1_minqual_60.snps.txt	Mon Jan 20 10:09:34 2025 +0000
@@ -0,0 +1,7 @@
+DateTime	2025-01-15T12:20:46
+ReadFiles	fake_reads.fq
+Reference	reference.fasta
+ReferenceSize	700
+Software	snippy 4.6.0
+Variant-SNP	2
+VariantTotal	2