# HG changeset patch
# User iuc
# Date 1617794637 0
# Node ID bd61e60350fd61af47167cd559b7a4fc5e981f96
# Parent  ac6e4444e3b81b0b472ceb0408d505e0379f4f91
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/snippy commit 7dec701af24e00b3328459f0a823eefd461237bb"

diff -r ac6e4444e3b8 -r bd61e60350fd macros.xml
--- a/macros.xml	Wed Mar 11 07:50:14 2020 +0000
+++ b/macros.xml	Wed Apr 07 11:23:57 2021 +0000
@@ -1,12 +1,15 @@
 <macros>
     <xml name="requirements">
         <requirements>
-            <requirement type="package" version="@VERSION@">snippy</requirement>
+            <requirement type="package" version="@WRAPPER_VERSION@">snippy</requirement>
             <requirement type="package" version="1.32">tar</requirement>
             <yield />
         </requirements>
     </xml>
 
+    <token name="@WRAPPER_VERSION@">4.5.0</token>
+    <token name="@VERSION_SUFFIX@">1</token>
+
     <xml name="version_command">
         <version_command><![CDATA[snippy --version]]></version_command>
     </xml>
@@ -52,13 +55,11 @@
                 </param>
             </when>
             <when value="history">
-                <param name="ref_file" type="data" format="fasta,genbank" label="Use the following dataset as the reference sequence" help="You can upload a FASTA or FASTQ sequence to the history and use it as reference" />
+                <param name="ref_file" type="data" format="fasta,fasta.gz,genbank" label="Use the following dataset as the reference sequence" help="You can upload a FASTA or FASTQ sequence to the history and use it as reference" />
             </when>
         </conditional>
     </xml>
 
-    <token name="@VERSION@">4.5.0</token>
-
     <xml name="citations">
       <citations>
           <citation type="bibtex">@UNPUBLISHED{Seemann2013,
diff -r ac6e4444e3b8 -r bd61e60350fd snippy-core.xml
--- a/snippy-core.xml	Wed Mar 11 07:50:14 2020 +0000
+++ b/snippy-core.xml	Wed Apr 07 11:23:57 2021 +0000
@@ -1,5 +1,5 @@
 <?xml version="1.0" encoding="utf-8"?>
-<tool id="snippy_core" name="snippy-core" version="@VERSION@">
+<tool id="snippy_core" name="snippy-core" version="@WRAPPER_VERSION@+galaxy@VERSION_SUFFIX@">
     <description>
         Combine multiple Snippy outputs into a core SNP alignment
     </description>
diff -r ac6e4444e3b8 -r bd61e60350fd snippy.xml
--- a/snippy.xml	Wed Mar 11 07:50:14 2020 +0000
+++ b/snippy.xml	Wed Apr 07 11:23:57 2021 +0000
@@ -1,4 +1,4 @@
-<tool id="snippy" name="snippy" version="@VERSION@">
+<tool id="snippy" name="snippy" version="@WRAPPER_VERSION@+galaxy@VERSION_SUFFIX@">
   <description>
       Snippy finds SNPs between a haploid reference genome and your NGS sequence reads.
     </description>
@@ -69,17 +69,17 @@
                 <option value="paired_iv">Paired Interleaved</option>
             </param>
             <when value="paired">
-                <param name="fastq_input1" type="data" format="fastqsanger,fasta" label="Select first set of reads" help="Specify dataset with forward reads"/>
-                <param name="fastq_input2" type="data" format="fastqsanger,fasta" label="Select second set of reads" help="Specify dataset with reverse reads"/>
+                <param name="fastq_input1" type="data" format="fastqsanger,fastqsanger.gz,fasta,fasta.gz" label="Select first set of reads" help="Specify dataset with forward reads"/>
+                <param name="fastq_input2" type="data" format="fastqsanger,fastqsanger.gz,fasta,fasta.gz" label="Select second set of reads" help="Specify dataset with reverse reads"/>
             </when>
             <when value="single">
-                <param name="fastq_input_single" type="data" format="fastqsanger,fasta" label="Select fastq dataset" help="Specify dataset with single reads"/>
+                <param name="fastq_input_single" type="data" format="fastqsanger,fastqsanger.gz,fasta,fasta.gz" label="Select fastq dataset" help="Specify dataset with single reads"/>
             </when>
             <when value="paired_collection">
-                <param name="fastq_input" format="fastqsanger,fasta" type="data_collection" collection_type="paired" label="Select a paired collection" help="See help section for an explanation of dataset collections"/>
+                <param name="fastq_input" format="fastqsanger,fastqsanger.gz,fasta,fasta.gz" type="data_collection" collection_type="paired" label="Select a paired collection" help="See help section for an explanation of dataset collections"/>
             </when>
             <when value="paired_iv">
-                <param name="fastq_input_interleaved" type="data" format="fastqsanger" label="Select fastq dataset" help="Specify dataset with interleaved reads"/>
+                <param name="fastq_input_interleaved" type="data" format="fastqsanger,fastqsanger.gz" label="Select fastq dataset" help="Specify dataset with interleaved reads"/>
             </when>
         </conditional>
 
@@ -148,8 +148,8 @@
                 <param name="ref_file" value="reference.fasta" ftype="fasta"/>
             </conditional>
             <param name="fastq_input_selector" value="paired" />
-            <param name="fastq_input1" ftype="fastqsanger" value="a_1.fastq" />
-            <param name="fastq_input2" ftype="fastqsanger" value="a_2.fastq" />
+            <param name="fastq_input1" ftype="fastqsanger.gz" value="a_1.fastq.gz" />
+            <param name="fastq_input2" ftype="fastqsanger.gz" value="a_2.fastq.gz" />
             <param name="mincov" value="2" />
             <param name="minqual" value="60" />
             <param name="outputs" value="outgff,outsum" />
diff -r ac6e4444e3b8 -r bd61e60350fd snippy_clean_full_aln.xml
--- a/snippy_clean_full_aln.xml	Wed Mar 11 07:50:14 2020 +0000
+++ b/snippy_clean_full_aln.xml	Wed Apr 07 11:23:57 2021 +0000
@@ -1,5 +1,5 @@
 <?xml version="1.0" encoding="utf-8"?>
-<tool id="snippy_clean_full_aln" name="snippy-clean_full_aln" version="@VERSION@">
+<tool id="snippy_clean_full_aln" name="snippy-clean_full_aln" version="@WRAPPER_VERSION@+galaxy@VERSION_SUFFIX@">
     <description>
         Replace any non-standard sequence characters in snippy 'core.full.aln' file.
     </description>
diff -r ac6e4444e3b8 -r bd61e60350fd test-data/a_1.fastq
--- a/test-data/a_1.fastq	Wed Mar 11 07:50:14 2020 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,20 +0,0 @@
-@1
-tccacaagccattgtgtgtaattaaccactaattgtgtataagtttaaact
-+
-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
-@2
-tccacaagccattgtgtgtaattaaccactaattgtgtataagtttaaact
-+
-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
-@3
-tccacaagccattgtgtgtaattaaccactaattgtgtataagtttaaact
-+
-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
-@4
-tccacaagccattgtgtgtaattaaccactaattgtgtataagtttaaact
-+
-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
-@5
-tccacaagccattgtgtgtaattaaccactaattgtgtataagtttaaact
-+
-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
diff -r ac6e4444e3b8 -r bd61e60350fd test-data/a_1.fastq.gz
Binary file test-data/a_1.fastq.gz has changed
diff -r ac6e4444e3b8 -r bd61e60350fd test-data/a_2.fastq
--- a/test-data/a_2.fastq	Wed Mar 11 07:50:14 2020 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,20 +0,0 @@
-@1
-agtttaaacttatacacaattagtggttaattacacacaatggcttgtgga
-+
-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
-@2
-agtttaaacttatacacaattagtggttaattacacacaatggcttgtgga
-+
-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
-@3
-agtttaaacttatacacaattagtggttaattacacacaatggcttgtgga
-+
-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
-@4
-agtttaaacttatacacaattagtggttaattacacacaatggcttgtgga
-+
-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
-@5
-agtttaaacttatacacaattagtggttaattacacacaatggcttgtgga
-+
-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
diff -r ac6e4444e3b8 -r bd61e60350fd test-data/a_2.fastq.gz
Binary file test-data/a_2.fastq.gz has changed