changeset 27:b7e8663db1ec draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/multiqc commit 327834d2ea9b16f0f0264fa4e9b675a2277f2fee
author iuc
date Tue, 18 Feb 2025 23:17:45 +0000
parents 1206c725e45a
children e99aaf069191
files bakta_plugin.xml bamtools_plugin.xml bbduk_plugin.xml checkm_plugin.xml diamond_plugin.xml freyja_plugin.xml gtdbtk_plugin.xml kraken_plugin.xml macros.xml megahit_plugin.xml metaphlan_plugin.xml multiqc.xml nonpareil_plugin.xml pairtools_plugin.xml picard_plugin.xml porechop_plugin.xml samtools_plugin.xml snippy_plugin.xml template_plugin.xml test-data/bakta.txt test-data/bbduk.txt test-data/checkm.tabular test-data/diamond.log test-data/freyja.tsv test-data/gtdbtk.tsv test-data/kraken_test0_report.tab test-data/megahit.txt test-data/metaphlan.txt test-data/nonpareil.json test-data/output_dedup_pairs.stats test-data/porechop.log test-data/snippy.txt
diffstat 32 files changed, 3900 insertions(+), 7 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/bakta_plugin.xml	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,48 @@
+<macros>
+    <token name="@BAKTA_COMMAND@"><![CDATA[
+        #set $pattern = "Bakta:"
+        #for $file in $repeat.software_cond.input
+            @ESCAPE_IDENTIFIER@
+            #set file_path = os.path.join($software_dir, str($identifier) + '.txt')
+            ln -s '$file' '$file_path' &&
+        #end for
+    ]]></token>
+    <xml name="bakta_form">
+        <param name="input" type="data" format="txt" multiple="true" label="Output of Bakta" help="It should contain 'Bakta:'"/>
+    </xml>
+    <xml name="bakta_test">
+        <test expect_num_outputs="3">
+            <repeat name="results">
+                <conditional name="software_cond">
+                    <param name="software" value="bakta"/>
+                    <param name="input" value="bakta.txt"/>
+                </conditional>
+            </repeat>
+            <param name="title" value="Title of the report"/>
+            <param name="comment" value="Commment for the report"/>
+            <param name="flat" value="true"/>
+            <param name="export" value="true"/>
+            <output name="html_report">
+                <assert_contents>
+                    <has_text text="Title of the report"/>
+                    <has_text text="Commment for the report"/>
+                    <has_text text="Bakta"/>
+                    <has_text text="bakta_txt"/>
+                </assert_contents>
+            </output>
+            <output name="stats">
+                <assert_contents>
+                    <has_text text="bakta-Count"/>
+                    <has_text text="bakta-Length"/>
+                    <has_text text="bakta-CDSs"/>
+                    <has_text text="1"/>
+                    <has_text text="1330"/>
+                    <has_text text="2"/>
+                    <has_n_lines n="2"/>
+                    <has_n_columns n="4"/>
+                </assert_contents>
+            </output>
+            <output_collection name="plots" type="list" count="0"/>
+        </test>
+    </xml>
+</macros>
--- a/bamtools_plugin.xml	Tue Feb 11 10:12:32 2025 +0000
+++ b/bamtools_plugin.xml	Tue Feb 18 23:17:45 2025 +0000
@@ -1,6 +1,6 @@
 <macros>
     <token name="@BAMTOOLS_COMMAND@"><![CDATA[
-        #set $pattern = "Stats for BAM file(s)"
+        #set $pattern = "Stats for BAM file\(s\)"
         @LN_FILES@
     ]]></token>
     <xml name="bamtools_form">
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/bbduk_plugin.xml	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,44 @@
+<macros>
+    <token name="@BBDUK_COMMAND@"><![CDATA[
+        #set $pattern = "Executing jgi\.BBDuk"
+        @LN_FILES@
+    ]]></token>
+    <xml name="bbduk_form">
+        <param name="input" type="data" format="txt" multiple="true" label="Output of BBDuk" help="It should contain 'Executing jgi.BBDuk'"/>
+    </xml>
+    <xml name="bbduk_test">
+        <test expect_num_outputs="3">
+            <repeat name="results">
+                <conditional name="software_cond">
+                    <param name="software" value="bbduk"/>
+                    <param name="input" value="bbduk.txt"/>
+                </conditional>
+            </repeat>
+            <param name="title" value="Title of the report"/>
+            <param name="comment" value="Commment for the report"/>
+            <param name="flat" value="true"/>
+            <param name="export" value="true"/>
+            <output name="html_report">
+                <assert_contents>
+                    <has_text text="Title of the report"/>
+                    <has_text text="Commment for the report"/>
+                    <has_text text="BBDuk"/>
+                    <has_text text="BBDuk: Filtered Reads"/>
+                    <has_text text="0.0"/>
+                </assert_contents>
+            </output>
+            <output name="stats">
+                <assert_contents>
+                    <has_text text="bbduk-Total_Removed_bases_percent"/>
+                    <has_text text="bbduk-Total_Removed_bases"/>
+                    <has_text text="bbduk-Total_Removed_reads_percent"/>
+                    <has_text text="bbduk-Total_Removed_reads"/>
+                    <has_text text="bbduk-Input_reads"/>
+                    <has_n_lines n="2"/>
+                    <has_n_columns n="6"/>
+                </assert_contents>
+            </output>
+            <output_collection name="plots" type="list" count="2"/>
+        </test>
+    </xml>
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/checkm_plugin.xml	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,37 @@
+<macros>
+    <token name="@CHECKM_COMMAND@"><![CDATA[
+        #set $pattern = ".*Bin Id(?:\t| {3,})Marker lineage(?:\t| {3,})# genomes(?:\t| {3,})# markers(?:\t| {3,})# marker sets.*"
+        #for $file in $repeat.software_cond.input
+            @ESCAPE_IDENTIFIER@
+            #set file_path = os.path.join($software_dir, 'output_file')
+            ln -s '$file' '$file_path' &&
+        #end for
+    ]]></token>
+    <xml name="checkm_form">
+        <param name="input" type="data" format="tabular" multiple="true" label="Output of Checkm"/>
+    </xml>
+    <xml name="checkm_test">
+        <test expect_num_outputs="3">
+            <repeat name="results">
+                <conditional name="software_cond">
+                    <param name="software" value="checkm"/>
+                    <param name="input" value="checkm.tabular"/>
+                </conditional>
+            </repeat>
+            <param name="title" value="Title of the report"/>
+            <param name="comment" value="Commment for the report"/>
+            <param name="flat" value="true"/>
+            <param name="export" value="true"/>
+            <output name="html_report">
+                <assert_contents>
+                    <has_text text="Title of the report"/>
+                    <has_text text="Commment for the report"/>
+                    <has_text text="CheckM"/>
+                    <has_text text="Bin quality"/>
+                    <has_text text="637000110"/>
+                </assert_contents>
+            </output>
+            <output_collection name="plots" type="list" count="0"/>
+        </test>
+    </xml>
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/diamond_plugin.xml	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,45 @@
+<macros>
+    <token name="@DIAMOND_COMMAND@"><![CDATA[
+        #for $file in $repeat.software_cond.input
+            @ESCAPE_IDENTIFIER@
+            #set file_path = os.path.join($software_dir, 'diamond.log')
+            ln -s '$file' '$file_path' &&
+        #end for
+    ]]></token>
+    <xml name="diamond_form">
+        <param name="input" type="data" format="txt" multiple="true" label="Log output of DIAMOND"/>
+    </xml>
+    <xml name="diamond_test">
+        <test expect_num_outputs="3">
+            <repeat name="results">
+                <conditional name="software_cond">
+                    <param name="software" value="diamond"/>
+                    <param name="input" value="diamond.log"/>
+                </conditional>
+            </repeat>
+            <param name="title" value="Title of the report"/>
+            <param name="comment" value="Commment for the report"/>
+            <param name="flat" value="true"/>
+            <param name="export" value="true"/>
+            <output name="html_report">
+                <assert_contents>
+                    <has_text text="Title of the report"/>
+                    <has_text text="Commment for the report"/>
+                    <has_text text="DIAMOND"/>
+                    <has_text text="Queries aligned"/>
+                </assert_contents>
+            </output>
+            <output name="stats">
+                <assert_contents>
+                    <has_text text="Sample"/>
+                    <has_text text="diamond_0"/>
+                    <has_text text="diamond-queries_aligned"/>
+                    <has_text text="1"/>
+                    <has_n_lines n="2"/>
+                    <has_n_columns n="2"/>
+                </assert_contents>
+            </output>
+            <output_collection name="plots" type="list" count="0"/>
+        </test>
+    </xml>
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/freyja_plugin.xml	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,46 @@
+<macros>
+    <token name="@FREYJA_COMMAND@"><![CDATA[
+        #set $pattern = "summarized\t\["
+        #for $file in $repeat.software_cond.input
+            @ESCAPE_IDENTIFIER@
+            #set file_path = os.path.join($software_dir, str($identifier) + '.tsv')
+            ln -s '$file' '$file_path' &&
+        #end for
+    ]]></token>
+    <xml name="freyja_form">
+        <param name="input" type="data" format="tsv" multiple="true" label="Output of Freyja" help="It should contain 'summarized\t['"/>
+    </xml>
+    <xml name="freyja_test">
+        <test expect_num_outputs="3">
+            <repeat name="results">
+                <conditional name="software_cond">
+                    <param name="software" value="freyja"/>
+                    <param name="input" value="freyja.tsv"/>
+                </conditional>
+            </repeat>
+            <param name="title" value="Title of the report"/>
+            <param name="comment" value="Commment for the report"/>
+            <param name="flat" value="true"/>
+            <param name="export" value="true"/>
+            <output name="html_report">
+                <assert_contents>
+                    <has_text text="Title of the report"/>
+                    <has_text text="Commment for the report"/>
+                    <has_text text="Freyja Summary"/>
+                    <has_text text="Top lineage"/>
+                </assert_contents>
+            </output>
+            <output name="stats">
+                <assert_contents>
+                    <has_text text="freyja-Top_lineage_freyja"/>
+                    <has_text text="freyja-Top_lineage_freyja_percentage"/>
+                    <has_text text="A"/>
+                    <has_text text="57.89470000000878"/>
+                    <has_n_lines n="2"/>
+                    <has_n_columns n="3"/>
+                </assert_contents>
+            </output>
+            <output_collection name="plots" type="list" count="1"/>
+        </test>
+    </xml>
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/gtdbtk_plugin.xml	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,32 @@
+<macros>
+    <token name="@GTDBTK_COMMAND@"><![CDATA[
+        #set $pattern = "user_genome\tclassification\tclosest_genome_reference\tclosest_genome_reference_radius\tclosest_genome_taxonomy\tclosest_genome_ani"
+        @LN_FILES@
+    ]]></token>
+    <xml name="gtdbtk_form">
+        <param name="input" type="data" format="tsv" multiple="true" label="Output of GTDB-Tk" help="It should contain 'user_genome\tclassification\tclosest_genome_reference\tclosest_genome_reference_radius\tclosest_genome_taxonomy\tclosest_genome_ani'"/>
+    </xml>
+    <xml name="gtdbtk_test">
+        <test expect_num_outputs="3">
+            <repeat name="results">
+                <conditional name="software_cond">
+                    <param name="software" value="gtdbtk"/>
+                    <param name="input" value="gtdbtk.tsv"/>
+                </conditional>
+            </repeat>
+            <param name="title" value="Title of the report"/>
+            <param name="comment" value="Commment for the report"/>
+            <param name="flat" value="true"/>
+            <param name="export" value="true"/>
+            <output name="html_report">
+                <assert_contents>
+                    <has_text text="Title of the report"/>
+                    <has_text text="Commment for the report"/>
+                    <has_text text="GTDB-Tk"/>
+                    <has_text text="genome_1_fna_gz"/>
+                </assert_contents>
+            </output>
+            <output_collection name="plots" type="list" count="0"/>
+        </test>
+    </xml>
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/kraken_plugin.xml	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,43 @@
+<macros>
+    <token name="@KRAKEN_COMMAND@"><![CDATA[
+        #set $pattern = "^\s{0,2}(\d{1,3}\.\d{1,2})\t(\d+)\t(\d+)\t((\d+)\t(\d+)\t)?([URDKPCOFGS-]\d{0,2})\t(\d+)(\s+)[root|unclassified]"
+        @LN_FILES@
+    ]]></token>
+    <xml name="kraken_form">
+        <param name="input" type="data" format="tabular" multiple="true" label="Output report of Kraken 1 or 2" />
+    </xml>
+    <xml name="kraken_test">
+        <test expect_num_outputs="3">
+            <repeat name="results">
+                <conditional name="software_cond">
+                    <param name="software" value="kraken"/>
+                    <param name="input" value="kraken_test0_report.tab"/>
+                </conditional>
+            </repeat>
+            <param name="title" value="Title of the report"/>
+            <param name="comment" value="Commment for the report"/>
+            <param name="flat" value="true"/>
+            <param name="export" value="true"/>
+            <output name="html_report">
+                <assert_contents>
+                    <has_text text="Title of the report"/>
+                    <has_text text="Commment for the report"/>
+                    <has_text text="General Statistics"/>
+                    <has_text text="kraken_test0_report_tab"/>
+                    <has_text text="100.0"/>
+                </assert_contents>
+            </output>
+            <output name="stats">
+                <assert_contents>
+                    <has_text text="kraken-pct_top_one"/>
+                    <has_text text="kraken-pct_top_n"/>
+                    <has_text text="100.0"/>
+                    <has_text text="kraken_test0_report_tab"/>
+                    <has_n_lines n="2"/>
+                    <has_n_columns n="3"/>
+                </assert_contents>
+            </output>
+            <output_collection name="plots" type="list" count="0"/>
+        </test>
+    </xml>
+</macros>
--- a/macros.xml	Tue Feb 11 10:12:32 2025 +0000
+++ b/macros.xml	Tue Feb 18 23:17:45 2025 +0000
@@ -1,6 +1,6 @@
 <macros>
     <token name="@TOOL_VERSION@">1.27</token>
-    <token name="@VERSION_SUFFIX@">1</token>
+    <token name="@VERSION_SUFFIX@">2</token>
     <xml name="bio_tools">
         <xrefs>
             <xref type="bio.tools">multiqc</xref>
@@ -55,7 +55,7 @@
             #set $file_path += '_' + str($file_paths.count($file_path))
         #end if
         #set $file_paths += [$file_path]
-        grep -q '$pattern' $file || die "Module '${repeat.software_cond.software}: '$pattern' not found in the file '$identifier'" &&
+        grep -Pq '$pattern' $file || die "Module '${repeat.software_cond.software}: '$pattern' not found in the file '$identifier'" &&
         ln -s '$file' '$file_path'  &&
     ]]></token>
     <token name="@CREATE_REPEAT_DIR_1@">
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/megahit_plugin.xml	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,44 @@
+<macros>
+    <token name="@MEGAHIT_COMMAND@"><![CDATA[
+        #set $pattern = " - MEGAHIT v"
+        @LN_FILES@
+    ]]></token>
+    <xml name="megahit_form">
+        <param name="input" type="data" format="txt" multiple="true" label="Output of MEGAHIT" help="It should contain ' - MEGAHIT v'"/>
+    </xml>
+    <xml name="megahit_test">
+        <test expect_num_outputs="3">
+            <repeat name="results">
+                <conditional name="software_cond">
+                    <param name="software" value="megahit"/>
+                    <param name="input" value="megahit.txt"/>
+                </conditional>
+            </repeat>
+            <param name="title" value="Title of the report"/>
+            <param name="comment" value="Commment for the report"/>
+            <param name="flat" value="true"/>
+            <param name="export" value="true"/>
+            <output name="html_report">
+                <assert_contents>
+                    <has_text text="Title of the report"/>
+                    <has_text text="Commment for the report"/>
+                    <has_text text="MEGAHIT"/>
+                    <has_text text="NGS read assembler"/>
+                    <has_text text="Metrics and run statistics from MEGAHIT run logs"/>
+                </assert_contents>
+            </output>
+            <output name="stats">
+                <assert_contents>
+                    <has_text text="megahit-megahit_contigs"/>
+                    <has_text text="megahit-megahit_avg_contig"/>
+                    <has_text text="megahit-megahit_n50"/>
+                    <has_text text="576"/>
+                    <has_text text="1"/>
+                    <has_n_lines n="2"/>
+                    <has_n_columns n="4"/>
+                </assert_contents>
+            </output>
+            <output_collection name="plots" type="list" count="0"/>
+        </test>
+    </xml>
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/metaphlan_plugin.xml	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,46 @@
+<macros>
+    <token name="@METAPHLAN_COMMAND@"><![CDATA[
+        #set $pattern = "#clade_name\tNCBI_tax_id\trelative_abundance\t"
+        #for $file in $repeat.software_cond.input
+            @ESCAPE_IDENTIFIER@
+            #set file_path = os.path.join($software_dir, str($identifier) + '.txt')
+            ln -s '$file' '$file_path' &&
+        #end for
+    ]]></token>
+    <xml name="metaphlan_form">
+        <param name="input" type="data" format="txt" multiple="true" label="Output of MetaPhlAn" help="It should contain '#clade_name\tNCBI_tax_id\trelative_abundance\t'"/>
+    </xml>
+    <xml name="metaphlan_test">
+        <test expect_num_outputs="3">
+            <repeat name="results">
+                <conditional name="software_cond">
+                    <param name="software" value="metaphlan"/>
+                    <param name="input" value="metaphlan.txt"/>
+                </conditional>
+            </repeat>
+            <param name="title" value="Title of the report"/>
+            <param name="comment" value="Commment for the report"/>
+            <param name="flat" value="true"/>
+            <param name="export" value="true"/>
+            <output name="html_report">
+                <assert_contents>
+                    <has_text text="Title of the report"/>
+                    <has_text text="Commment for the report"/>
+                    <has_text text="MetaPhlAn"/>
+                    <has_text text="Top taxa"/>
+                </assert_contents>
+            </output>
+            <output name="stats">
+                <assert_contents>
+                    <has_text text="metaphlan-Moraxella_lacunata"/>
+                    <has_text text="metaphlan-Top"/>
+                    <has_text text="22.57968"/>
+                    <has_text text="100.00001000000002"/>
+                    <has_n_lines n="2"/>
+                    <has_n_columns n="3"/>
+                </assert_contents>
+            </output>
+            <output_collection name="plots" type="list" count="7"/>
+        </test>
+    </xml>
+</macros>
--- a/multiqc.xml	Tue Feb 11 10:12:32 2025 +0000
+++ b/multiqc.xml	Tue Feb 18 23:17:45 2025 +0000
@@ -23,6 +23,19 @@
         <import>star_plugin.xml</import>
         <import>trimmomatic_plugin.xml</import>
         <import>vcftools_plugin.xml</import>
+        <import>kraken_plugin.xml</import>
+        <import>diamond_plugin.xml</import>
+        <import>bakta_plugin.xml</import>
+        <import>freyja_plugin.xml</import>
+        <import>checkm_plugin.xml</import>
+        <import>pairtools_plugin.xml</import>
+        <import>porechop_plugin.xml</import>
+        <import>snippy_plugin.xml</import>
+        <import>metaphlan_plugin.xml</import>
+        <import>bbduk_plugin.xml</import>
+        <import>megahit_plugin.xml</import>
+        <import>nonpareil_plugin.xml</import>
+        <import>gtdbtk_plugin.xml</import>
         <import>sambamba_plugin.xml</import>
     </macros>
     <expand macro="bio_tools"/>
@@ -144,6 +157,32 @@
         @TRIMMOMATIC_COMMAND@
     #elif str($repeat.software_cond.software) == "vcftools"
         @VCFTOOLS_COMMAND@
+    #elif str($repeat.software_cond.software) == "kraken"
+        @KRAKEN_COMMAND@
+    #elif str($repeat.software_cond.software) == "diamond"
+        @DIAMOND_COMMAND@
+    #elif str($repeat.software_cond.software) == "bakta"
+        @BAKTA_COMMAND@
+    #elif str($repeat.software_cond.software) == "freyja"
+        @FREYJA_COMMAND@
+    #elif str($repeat.software_cond.software) == "checkm"
+        @CHECKM_COMMAND@
+    #elif str($repeat.software_cond.software) == "pairtools"
+        @PAIRTOOLS_COMMAND@
+    #elif str($repeat.software_cond.software) == "porechop"
+        @PORECHOP_COMMAND@
+    #elif str($repeat.software_cond.software) == "snippy"
+        @SNIPPY_COMMAND@
+    #elif str($repeat.software_cond.software) == "metaphlan"
+        @METAPHLAN_COMMAND@
+    #elif str($repeat.software_cond.software) == "bbduk"
+        @BBDUK_COMMAND@
+    #elif str($repeat.software_cond.software) == "megahit"
+        @MEGAHIT_COMMAND@
+    #elif str($repeat.software_cond.software) == "nonpareil"
+        @NONPAREIL_COMMAND@
+    #elif str($repeat.software_cond.software) == "gtdbtk"
+        @GTDBTK_COMMAND@
     #elif str($repeat.software_cond.software) == "sambamba"
         @SAMBAMBA_COMMAND@
     #else if str($repeat.software_cond.software) == "custom_content":
@@ -253,6 +292,19 @@
                     <option value="tophat">TopHat2 (TopHat2 is deprecated you should not use it)</option>
                     <option value="trimmomatic">Trimmomatic</option>
                     <option value="vcftools">VCFTools</option>
+                    <option value="kraken">Kraken 1 or 2</option>
+                    <option value="diamond">DIAMOND</option>
+                    <option value="bakta">Bakta</option>
+                    <option value="freyja">Freyja</option>
+                    <option value="checkm">CheckM</option>
+                    <option value="pairtools">pairtools</option>
+                    <option value="porechop">Porechop</option>
+                    <option value="snippy">Snippy</option>
+                    <option value="metaphlan">MetaPhlAn</option>
+                    <option value="bbduk">BBDuk</option>
+                    <option value="megahit">MEGAHIT</option>
+                    <option value="nonpareil">Nonpareil</option>
+                    <option value="gtdbtk">GTDB-Tk</option>
                     <!--<option value="verifybamid">VerifyBAMID</option>-->
                     <!--Custom-->
                     <option value="custom_content">Custom Content</option>
@@ -353,6 +405,45 @@
                 <when value="vcftools">
                     <expand macro="vcftools_form"/>
                 </when>
+                <when value="kraken">
+                    <expand macro="kraken_form"/>
+                </when>
+                <when value="diamond">
+                    <expand macro="diamond_form"/>
+                </when>
+                <when value="bakta">
+                    <expand macro="bakta_form"/>
+                </when>
+                <when value="freyja">
+                    <expand macro="freyja_form"/>
+                </when>
+                <when value="checkm">
+                    <expand macro="checkm_form"/>
+                </when>
+                <when value="pairtools">
+                    <expand macro="pairtools_form"/>
+                </when>
+                <when value="porechop">
+                    <expand macro="porechop_form"/>
+                </when>
+                <when value="snippy">
+                    <expand macro="snippy_form"/>
+                </when>
+                <when value="metaphlan">
+                    <expand macro="metaphlan_form"/>
+                </when>
+                <when value="bbduk">
+                    <expand macro="bbduk_form"/>
+                </when>
+                <when value="megahit">
+                    <expand macro="megahit_form"/>
+                </when>
+                <when value="nonpareil">
+                    <expand macro="nonpareil_form"/>
+                </when>
+                <when value="gtdbtk">
+                    <expand macro="gtdbtk_form"/>
+                </when>
                 <when value="sambamba">
                     <expand macro="sambamba_form"/>
                 </when>
@@ -432,6 +523,19 @@
         <expand macro="gatk_test"/>
         <expand macro="bamtools_test"/>
         <expand macro="pycoqc_test"/>
+        <expand macro="kraken_test"/>
+        <expand macro="diamond_test"/>
+        <expand macro="bakta_test"/>
+        <expand macro="freyja_test"/>
+        <expand macro="checkm_test"/>
+        <expand macro="pairtools_test"/>
+        <expand macro="porechop_test"/>
+        <expand macro="snippy_test"/>
+        <expand macro="metaphlan_test"/>
+        <expand macro="bbduk_test"/>
+        <expand macro="megahit_test"/>
+        <expand macro="nonpareil_test"/>
+        <expand macro="gtdbtk_test"/>
         <expand macro="sambamba_test"/>
 
         <!--expand macro="vcftools_test"/> Does not work, did it ever worked? -->
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/nonpareil_plugin.xml	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,52 @@
+<macros>
+    <token name="@NONPAREIL_COMMAND@"><![CDATA[
+        #set $pattern = "LRstar"
+        #for $file in $repeat.software_cond.input
+            @ESCAPE_IDENTIFIER@
+            #set file_path = os.path.join($software_dir, str($identifier) + '.json')
+            ln -s '$file' '$file_path' &&
+        #end for
+    ]]></token>
+    <xml name="nonpareil_form">
+        <param name="input" type="data" format="json" multiple="true" label="JSON object output of Nonpareil" help="It should contain 'LRstar'"/>
+    </xml>
+    <xml name="nonpareil_test">
+        <test expect_num_outputs="3">
+            <repeat name="results">
+                <conditional name="software_cond">
+                    <param name="software" value="nonpareil"/>
+                    <param name="input" value="nonpareil.json"/>
+                </conditional>
+            </repeat>
+            <param name="title" value="Title of the report"/>
+            <param name="comment" value="Commment for the report"/>
+            <param name="flat" value="true"/>
+            <param name="export" value="true"/>
+            <output name="html_report">
+                <assert_contents>
+                    <has_text text="Title of the report"/>
+                    <has_text text="Commment for the report"/>
+                    <has_text text="Estimates metagenomic coverage and sequence diversity"/>
+                    <has_text text="Nonpareil"/>
+                    <has_text text="Redundancy levels"/>
+                    <has_text text="21.3"/>
+                    <has_text text="24.3"/>
+                </assert_contents>
+            </output>
+            <output name="stats">
+                <assert_contents>
+                    <has_text text="nonpareil-nonpareil_R"/>
+                    <has_text text="nonpareil-nonpareil_LR"/>
+                    <has_text text="nonpareil-nonpareil_kappa"/>
+                    <has_text text="nonpareil-nonpareil_C"/>
+                    <has_text text="nonpareil-nonpareil_diversity"/>
+                    <has_text text="11.9521"/>
+                    <has_text text="0.0005"/>
+                    <has_n_lines n="2"/>
+                    <has_n_columns n="6"/>
+                </assert_contents>
+            </output>
+            <output_collection name="plots" type="list" count="3"/>
+        </test>
+    </xml>
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/pairtools_plugin.xml	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,55 @@
+<macros>
+    <token name="@PAIRTOOLS_COMMAND@"><![CDATA[
+        #set $pattern = "total_single_sided_mapped"
+        #set file_paths = []
+        #for $file in $repeat.software_cond.input:
+            @ESCAPE_IDENTIFIER@
+            #set file_path = os.path.join($software_dir, str($identifier))
+            #if $file_path in $file_paths
+                #set $file_path += '_' + str($file_paths.count($file_path))
+            #end if
+            #set $file_paths += [$file_path]
+            grep -Pzq "(?s)(?=.*total_single_sided_mapped\t)(?=.*cis\t)(?=.*trans\t)(?=.*pair_types/)" $file || die "Module '${repeat.software_cond.software}: '$pattern' not found in the file '$identifier'" &&
+            ln -s '$file' '$file_path'  &&
+        #end for
+    ]]></token>
+    <xml name="pairtools_form">
+        <param name="input" type="data" format="tabular" multiple="true" label="Output of Pairtools"/>
+    </xml>
+    <xml name="pairtools_test">
+        <test expect_num_outputs="3">
+            <repeat name="results">
+                <conditional name="software_cond">
+                    <param name="software" value="pairtools"/>
+                    <param name="input" value="output_dedup_pairs.stats"/>
+                </conditional>
+            </repeat>
+            <param name="title" value="Title of the report"/>
+            <param name="comment" value="Commment for the report"/>
+            <param name="flat" value="true"/>
+            <param name="export" value="true"/>
+            <output name="html_report">
+                <assert_contents>
+                    <has_text text="Title of the report"/>
+                    <has_text text="Commment for the report"/>
+                    <has_text text="output_dedup_pairs"/>
+                    <has_text text="Pairs by alignment status"/>
+                    <has_text text="Fraction of read pairs by strand orientation"/>
+                </assert_contents>
+            </output>
+            <output name="stats">
+                <assert_contents>
+                    <has_text text="pairtools-total"/>
+                    <has_text text="pairtools-frac_unmapped"/>
+                    <has_text text="0.001992"/>
+                    <has_text text="45.88353413654618"/>
+                    <has_text text="pairtools-frac_dups"/>
+                    <has_text text="0.4518072289156626"/>
+                    <has_n_lines n="2"/>
+                    <has_n_columns n="8"/>
+                </assert_contents>
+            </output>
+            <output_collection name="plots" type="list" count="5"/>
+        </test>
+    </xml>
+</macros>
--- a/picard_plugin.xml	Tue Feb 11 10:12:32 2025 +0000
+++ b/picard_plugin.xml	Tue Feb 18 23:17:45 2025 +0000
@@ -12,7 +12,7 @@
                 @LN_2_FILES@
             #elif str($repeat2.type) == "hsmetrics"
                 #set $pattern = "picard.analysis.directed.HsMetrics"
-                @   @
+                @LN_2_FILES@
             #elif str($repeat2.type) == "insertsize"
                 #set $pattern = "picard.analysis.InsertSizeMetrics"
                 @LN_2_FILES@
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/porechop_plugin.xml	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,44 @@
+<macros>
+    <token name="@PORECHOP_COMMAND@"><![CDATA[
+        #set $pattern = "Looking for known adapter sets"
+        @LN_FILES@
+    ]]></token>
+    <xml name="porechop_form">
+        <param name="input" type="data" format="txt" multiple="true" label="Output of Porechop" help="It should contain 'Looking for known adapter sets'"/>
+    </xml>
+    <xml name="porechop_test">
+        <test expect_num_outputs="3">
+            <repeat name="results">
+                <conditional name="software_cond">
+                    <param name="software" value="porechop"/>
+                    <param name="input" value="porechop.log"/>
+                </conditional>
+            </repeat>
+            <param name="title" value="Title of the report"/>
+            <param name="comment" value="Commment for the report"/>
+            <param name="flat" value="true"/>
+            <param name="export" value="true"/>
+            <output name="html_report">
+                <assert_contents>
+                    <has_text text="Title of the report"/>
+                    <has_text text="Commment for the report"/>
+                    <has_text text="Porechop"/>
+                    <has_text text="Reads adapter-trimmed read end"/>
+                    <has_text text="Middle split reads"/>
+                </assert_contents>
+            </output>
+            <output name="stats">
+                <assert_contents>
+                    <has_text text="porechop-Input_Reads"/>
+                    <has_text text="porechop-Start_Trimmed"/>
+                    <has_text text="porechop-Middle_Split_Percent"/>
+                    <has_text text="44.44444444444444"/>
+                    <has_text text="4e-06"/>
+                    <has_n_lines n="2"/>
+                    <has_n_columns n="8"/>
+                </assert_contents>
+            </output>
+            <output_collection name="plots" type="list" count="3"/>
+        </test>
+    </xml>
+</macros>
--- a/samtools_plugin.xml	Tue Feb 11 10:12:32 2025 +0000
+++ b/samtools_plugin.xml	Tue Feb 18 23:17:45 2025 +0000
@@ -6,7 +6,7 @@
                 #set $pattern = "This file was produced by samtools stats"
                 @LN_3_FILES@
             #elif str($repeat2.type.type) == "flagstat"
-                #set $pattern = "in total (QC-passed reads + QC-failed reads)"
+                #set $pattern = "in total \(QC-passed reads \+ QC-failed reads\)"
                 @LN_3_FILES@
             #elif str($repeat2.type.type) == "idxstats"
                 #for $file in $repeat2.type.input
@@ -15,7 +15,7 @@
                     ln -s '$file' '$file_path' &&
                 #end for
             #elif str($repeat2.type.type) == "rmdup"
-                #set $pattern = "[bam_rmdup"
+                #set $pattern = "\[bam_rmdup"
                 @LN_3_FILES@
             #end if
         #end for
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/snippy_plugin.xml	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,42 @@
+<macros>
+    <token name="@SNIPPY_COMMAND@"><![CDATA[
+        #set $pattern = "snippy|ID\tLENGTH\tALIGNED\tUNALIGNED\tVARIANT\tHET\tMASKED\tLOWCOV"
+        @LN_FILES@
+    ]]></token>
+    <xml name="snippy_form">
+        <param name="input" type="data" format="txt" multiple="true" label="Output summary of Snippy" help="It should contain 'snippy' or 'ID\tLENGTH\tALIGNED\tUNALIGNED\tVARIANT\tHET\tMASKED\tLOWCOV'"/>
+    </xml>
+    <xml name="snippy_test">
+        <test expect_num_outputs="3">
+            <repeat name="results">
+                <conditional name="software_cond">
+                    <param name="software" value="snippy"/>
+                    <param name="input" value="snippy.txt"/>
+                </conditional>
+            </repeat>
+            <param name="title" value="Title of the report"/>
+            <param name="comment" value="Commment for the report"/>
+            <param name="flat" value="true"/>
+            <param name="export" value="true"/>
+            <output name="html_report">
+                <assert_contents>
+                    <has_text text="Title of the report"/>
+                    <has_text text="Commment for the report"/>
+                    <has_text text="Snippy-Core Alignment Statistics"/>
+                </assert_contents>
+            </output>
+            <output name="stats">
+                <assert_contents>
+                    <has_text text="snippy-Percent_Het"/>
+                    <has_text text="snippy-HET"/>
+                    <has_text text="700"/>
+                    <has_text text="7.285714285714286"/>
+                    <has_text text="a"/>
+                    <has_n_lines n="5"/>
+                    <has_n_columns n="6"/>
+                </assert_contents>
+            </output>
+            <output_collection name="plots" type="list" count="0"/>
+        </test>
+    </xml>
+</macros>
--- a/template_plugin.xml	Tue Feb 11 10:12:32 2025 +0000
+++ b/template_plugin.xml	Tue Feb 18 23:17:45 2025 +0000
@@ -12,7 +12,7 @@
     <token name="@TEMPLATE_COMMAND@"><![CDATA[
         <!--This pattern is used to check the file content in the @CHECK_LN_FILE@ token. The pattern should be included in the file. -->
         #set $pattern = "Trimmomatic"
-        @LN_FILES@f
+        @LN_FILES@
     ]]></token>
     <xml name="TEMPLATE_form">
         <!-- Please add here your input forms specific to your plugin. Keep the name as `input` if you have a single input.
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bakta.txt	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,30 @@
+Sequence(s):
+Length: 1330
+Count: 1
+GC: 45.2
+N50: 1330
+N ratio: 0.0
+coding density: 79.0
+
+Annotation:
+tRNAs: 0
+tmRNAs: 0
+rRNAs: 0
+ncRNAs: 0
+ncRNA regions: 0
+CRISPR arrays: 0
+CDSs: 2
+pseudogenes: 0
+hypotheticals: 1
+signal peptides: 0
+sORFs: 0
+gaps: 0
+oriCs: 0
+oriVs: 0
+oriTs: 1
+
+Bakta:
+Software: v1.9.4
+Database: v5.0, full
+DOI: 10.1099/mgen.0.000685
+URL: github.com/oschwengers/bakta
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bbduk.txt	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,26 @@
+Executing jgi.BBDuk [in=forward.fastq.gz, out=/data/jwd05e/main/079/061/79061727/outputs/dataset_1abda394-9c76-4c97-9712-e52be8f79694.dat, ref=dataset_5c3ad7b3-f75c-4f5a-a70e-15ae843bc97c.dat.fa, k=27, rcomp=t, maskmiddle=t, minkmerhits=1, minkmerfraction=0.0, mincovfraction=0.0, hammingdistance=0, qhdist=0, editdistance=0, forbidn=f, trimfailures=f, findbestmatch=f, skipr1=f, skipr2=f, t=1]
+Version 39.08
+
+Set threads to 1
+Changed from ASCII-33 to ASCII-64 on input quality B (Q33) for base N at lines 1 and 3, position 0 while prescanning.
+Unspecified format for output /data/jwd05e/main/079/061/79061727/outputs/dataset_1abda394-9c76-4c97-9712-e52be8f79694.dat; defaulting to fastq.
+0.398 seconds.
+Initial:
+Memory: max=3672m, total=270m, free=243m, used=27m
+
+Added 2970 kmers; time: 	0.549 seconds.
+Memory: max=3672m, total=270m, free=238m, used=32m
+
+Input is being processed as unpaired
+Changed from ASCII-33 to ASCII-64 on input ;: 59 -> 28
+Started output streams:	0.052 seconds.
+Processing time:   		0.106 seconds.
+
+Input:                  	100 reads 		10000 bases.
+Contaminants:           	0 reads (0.00%) 	0 bases (0.00%)
+Total Removed:          	0 reads (0.00%) 	0 bases (0.00%)
+Result:                 	100 reads (100.00%) 	10000 bases (100.00%)
+
+Time:                         	0.711 seconds.
+Reads Processed:         100 	0.14k reads/sec
+Bases Processed:       10000 	0.01m bases/sec
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/checkm.tabular	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,2 @@
+Bin Id	Marker lineage	# genomes	# markers	# marker sets	0	1	2	3	4	5+	Completeness	Contamination	Strain heterogeneity
+637000110	f__Enterobacteriaceae (UID5103)	157	1005	324	1005	0	0	0	0	0	0.00	0.00	0.00
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/diamond.log	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,180 @@
+diamond blastp --quiet --threads 1 --db ./database --query /tmp/tmpxfb7idqd/files/e/4/f/dataset_e4f75201-863d-4397-8ca7-7c0b79593e9d.dat --no-self-hits --outfmt 0 --out /tmp/tmpxfb7idqd/job_working_directory/000/3/outputs/dataset_0fb25f52-9d9b-4592-a709-7e516f37daa1.dat --compress 0 --algo 0 --matrix BLOSUM62 --comp-based-stats 1 --masking 1 --max-target-seqs 25 --evalue 0.001 --id 0 --query-cover 0 --subject-cover 0 --block-size 2.0 --motif-masking 0 --log
+diamond v2.0.15.153
+#CPU threads: 1
+Scoring parameters: (Matrix=BLOSUM62 Lambda=0.267 K=0.041 Penalties=11/1)
+CPU features detected: ssse3 popcnt sse4.1 avx2
+Runtime dispatch: disabled
+L3 cache size: 8388608
+MAX_SHAPE_LEN=19 SEQ_MASK STRICT_BAND
+Temporary directory: /tmp/tmpxfb7idqd/job_working_directory/000/3/outputs
+#Target sequences to report alignments for: 25
+DP fields: 1
+Opening the database...  [0s]
+Database: ./database.dmnd (type: Diamond database, sequences: 2, letters: 568)
+Block size = 2000000000
+Opening the input file...  [0s]
+Opening the output file...  [0s]
+Loading query sequences...  [0s]
+Sequences = 2, letters = 566, average length = 283
+Masking queries...  [0s]
+Current RSS: 6.8 MB, Peak RSS: 6.8 MB
+Algorithm: Double-indexed
+Shape configuration: 111101110111,111011010010111
+Building query histograms...  [0s]
+Allocating buffers...  [0s]
+Current RSS: 6.9 MB, Peak RSS: 6.9 MB
+Loading reference sequences...  [0s]
+Sequences = 2, letters = 568, average length = 284
+Current RSS: 6.9 MB, Peak RSS: 6.9 MB
+Masking reference...  [0s]
+Masked letters: 0
+Initializing temporary storage... Async_buffer() 2,1
+ [0s]
+Building reference histograms...  [0s]
+Allocating buffers...  [0s]
+Current RSS: 6.9 MB, Peak RSS: 7.0 MB
+Processing query block 1, reference block 1/1, shape 1/2, index chunk 1/4.
+Building reference seed array...  [0s]
+Building query seed array...  [0s]
+Indexed query seeds = 97875695011120/566 (17292525620339.22%), reference seeds = 0/568 (0.00%)
+Soft masked letters = 0/566 (0.00%), 0/568 (0.00%)
+Computing hash join...  [0s]
+Masking low complexity seeds...  [0s]
+Masked seeds: 0/57 (0.00%)
+Masked positions (query): 0/566 (0.00%)
+Masked positions (target): 0/568 (0.00%)
+Searching alignments...  [0s]
+Processing query block 1, reference block 1/1, shape 1/2, index chunk 2/4.
+Building reference seed array...  [0s]
+Building query seed array...  [0s]
+Indexed query seeds = 2560271741526742528/566 (452344830658435072.00%), reference seeds = 0/568 (0.00%)
+Soft masked letters = 0/566 (0.00%), 0/568 (0.00%)
+Computing hash join...  [0s]
+Masking low complexity seeds...  [0s]
+Masked seeds: 0/57 (0.00%)
+Masked positions (query): 0/566 (0.00%)
+Masked positions (target): 0/568 (0.00%)
+Searching alignments...  [0s]
+Processing query block 1, reference block 1/1, shape 1/2, index chunk 3/4.
+Building reference seed array...  [0s]
+Building query seed array...  [0s]
+Indexed query seeds = 2560271741526742528/566 (452344830658435072.00%), reference seeds = 0/568 (0.00%)
+Soft masked letters = 0/566 (0.00%), 0/568 (0.00%)
+Computing hash join...  [0s]
+Masking low complexity seeds...  [0s]
+Masked seeds: 0/65 (0.00%)
+Masked positions (query): 0/566 (0.00%)
+Masked positions (target): 0/568 (0.00%)
+Searching alignments...  [0s]
+Processing query block 1, reference block 1/1, shape 1/2, index chunk 4/4.
+Building reference seed array...  [0s]
+Building query seed array...  [0s]
+Indexed query seeds = 129/566 (22.79%), reference seeds = 107/568 (18.84%)
+Soft masked letters = 0/566 (0.00%), 0/568 (0.00%)
+Computing hash join...  [0s]
+Masking low complexity seeds...  [0s]
+Masked seeds: 0/60 (0.00%)
+Masked positions (query): 0/566 (0.00%)
+Masked positions (target): 0/568 (0.00%)
+Searching alignments...  [0s]
+Current RSS: 9.1 MB, Peak RSS: 9.2 MB
+Processing query block 1, reference block 1/1, shape 2/2, index chunk 1/4.
+Building reference seed array...  [0s]
+Building query seed array...  [0s]
+Indexed query seeds = 97875695011120/566 (17292525620339.22%), reference seeds = 107/568 (18.84%)
+Soft masked letters = 0/566 (0.00%), 0/568 (0.00%)
+Computing hash join...  [0s]
+Masking low complexity seeds...  [0s]
+Masked seeds: 0/58 (0.00%)
+Masked positions (query): 0/566 (0.00%)
+Masked positions (target): 0/568 (0.00%)
+Searching alignments...  [0s]
+Processing query block 1, reference block 1/1, shape 2/2, index chunk 2/4.
+Building reference seed array...  [0s]
+Building query seed array...  [0s]
+Indexed query seeds = 2560271741526742528/566 (452344830658435072.00%), reference seeds = 107/568 (18.84%)
+Soft masked letters = 0/566 (0.00%), 0/568 (0.00%)
+Computing hash join...  [0s]
+Masking low complexity seeds...  [0s]
+Masked seeds: 0/66 (0.00%)
+Masked positions (query): 0/566 (0.00%)
+Masked positions (target): 0/568 (0.00%)
+Searching alignments...  [0s]
+Processing query block 1, reference block 1/1, shape 2/2, index chunk 3/4.
+Building reference seed array...  [0s]
+Building query seed array...  [0s]
+Indexed query seeds = 2560271741526742528/566 (452344830658435072.00%), reference seeds = 107/568 (18.84%)
+Soft masked letters = 0/566 (0.00%), 0/568 (0.00%)
+Computing hash join...  [0s]
+Masking low complexity seeds...  [0s]
+Masked seeds: 0/46 (0.00%)
+Masked positions (query): 0/566 (0.00%)
+Masked positions (target): 0/568 (0.00%)
+Searching alignments...  [0s]
+Processing query block 1, reference block 1/1, shape 2/2, index chunk 4/4.
+Building reference seed array...  [0s]
+Building query seed array...  [0s]
+Indexed query seeds = 120/566 (21.20%), reference seeds = 102/568 (17.96%)
+Soft masked letters = 0/566 (0.00%), 0/568 (0.00%)
+Computing hash join...  [0s]
+Masking low complexity seeds...  [0s]
+Masked seeds: 0/60 (0.00%)
+Masked positions (query): 0/566 (0.00%)
+Masked positions (target): 0/568 (0.00%)
+Searching alignments...  [0s]
+Deallocating buffers...  [0s]
+Clearing query masking...  [0s]
+Computing alignments... Async_buffer.load() 17(2.37487e-07 GB, 1.4063e-07 GB on disk)
+Loading trace points...  [0s]
+Sorting trace points...  [0s]
+Computing alignments...  [0.01s]
+Deallocating buffers...  [0s]
+Loading trace points...  [0s]
+ [0.011s]
+Deallocating reference...  [0s]
+Loading reference sequences...  [0s]
+Current RSS: 9.6 MB, Peak RSS: 9.6 MB
+Deallocating buffers...  [0s]
+Current RSS: 9.6 MB, Peak RSS: 9.6 MB
+Deallocating queries...  [0s]
+Loading query sequences...  [0s]
+Closing the input file...  [0s]
+Closing the output file...  [0s]
+Cleaning up...  [0s]
+Current RSS: 9.6 MB, Peak RSS: 9.6 MB
+Total time = 0.093s
+Hits (filter stage 0) = 774
+Hits (filter stage 1) = 774 (100 %)
+Hits (filter stage 2) = 774 (100 %)
+Hits (filter stage 3) = 17 (2.19638 %)
+Target hits (stage 0) = 2
+Target hits (stage 1) = 0
+Target hits (stage 2) = 2
+Target hits (stage 3) = 2 (0 (0%) with CBS)
+Target hits (stage 4) = 2
+Target hits (stage 5) = 2
+Swipe realignments    = 0
+Matrix adjusts        = 0
+Extensions (8 bit)    = 0
+Extensions (16 bit)   = 4
+Extensions (32 bit)   = 0
+Hard queries          = 0
+Gapped filter (targets) = 0
+Gapped filter (hits) stage 1 = 0
+Gapped filter (hits) stage 2 = 0
+Time (Load seed hit targets) = 4e-06s (CPU)
+Time (Sort targets by score) = 0s (CPU)
+Time (Gapped filter)         = 0s (CPU)
+Time (Matrix adjust)         = 0s (CPU)
+Time (Chaining)              = 2e-05s (CPU)
+Time (DP target sorting)     = 0s (CPU)
+Time (Smith Waterman)        = 6.9e-05s (CPU)
+Time (Smith Waterman TB)     = 0.0001s (CPU)
+Time (Traceback)             = 8e-06s (CPU)
+Time (Target parallel)       = 0s (wall)
+Time (Load seed hits)        = 0.000495s (wall)
+Time (Sort seed hits)        = 2.4e-05s (wall)
+Time (Extension)             = 0.010185s (wall)
+Temporary disk space used (search): 1.4063e-07 GB
+Reported 2 pairwise alignments, 2 HSPs.
+1 queries aligned.
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/freyja.tsv	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,6 @@
+	variants.tsv
+summarized	[('A', 0.5789470000000878), ('Delta', 0.4188134220012827)]
+lineages	A AY.48 B.1.617.2 A.4 A.2
+abundances	0.57475400 0.37892715 0.03988627 0.00313480 0.00105820
+resid	3.5081238846264213
+coverage	99.73246831421596
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gtdbtk.tsv	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,2 @@
+user_genome	classification	closest_genome_reference	closest_genome_reference_radius	closest_genome_taxonomy	closest_genome_ani	closest_genome_af	closest_placement_reference	closest_placement_radius	closest_placement_taxonomy	closest_placement_ani	closest_placement_af	pplacer_taxonomy	classification_method	note	other_related_references(genome_id,species_name,radius,ANI,AF)	msa_percent	translation_table	red_value	warnings
+genome_1_fna_gz	d__Archaea;p__Methanobacteriota;c__Methanobacteria;o__Methanobacteriales;f__Methanobacteriaceae;g__Methanobrevibacter;s__Methanobrevibacter ruminantium	GCF_000024185.1	95.0	d__Archaea;p__Methanobacteriota;c__Methanobacteria;o__Methanobacteriales;f__Methanobacteriaceae;g__Methanobrevibacter;s__Methanobrevibacter ruminantium	100.0	1.0	GCF_000024185.1	95.0	d__Archaea;p__Methanobacteriota;c__Methanobacteria;o__Methanobacteriales;f__Methanobacteriaceae;g__Methanobrevibacter;s__Methanobrevibacter ruminantium	100.0	1.0	d__Archaea;p__Methanobacteriota;c__Methanobacteria;o__Methanobacteriales;f__Methanobacteriaceae;g__Methanobrevibacter;s__	taxonomic classification defined by topology and ANI	topological placement and ANI have congruent species assignments	N/A	97.56	11	N/A	N/A
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/kraken_test0_report.tab	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,1 @@
+100.00	240	240	0	0	U	0	root
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/megahit.txt	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,143 @@
+2025-02-13 13:23:44 - MEGAHIT v1.2.9
+2025-02-13 13:23:44 - Using megahit_core with POPCNT and BMI2 support
+2025-02-13 13:23:44 - Convert reads to binary library
+2025-02-13 13:23:44 - command /usr/local/tools/_conda/envs/__megahit@1.2.9/bin/megahit_core buildlib /data/jwd02f/main/079/102/79102477/working/megahit_out/tmp/reads.lib /data/jwd02f/main/079/102/79102477/working/megahit_out/tmp/reads.lib
+2025-02-13 13:23:44 - b'INFO  sequence/io/sequence_lib.cpp  :   75 - Lib 0 (/data/dnb10/galaxy_db/files/c/5/2/dataset_c52c6559-228d-4131-9eec-f5b8d04f08c8.dat): se, 1 reads, 1232 max length'
+2025-02-13 13:23:44 - b'INFO  utils/utils.h                 :  152 - Real: 0.2031\tuser: 0.0028\tsys: 0.0074\tmaxrss: 14696'
+2025-02-13 13:23:44 - Start assembly. Number of CPU threads 10 
+2025-02-13 13:23:44 - k list: 21,29,39,59,79,99,119,141 
+2025-02-13 13:23:44 - Memory used: 83886080
+2025-02-13 13:23:44 - Extract solid (k+1)-mers for k = 21 
+2025-02-13 13:23:44 - command /usr/local/tools/_conda/envs/__megahit@1.2.9/bin/megahit_core count -k 21 -m 2 --host_mem 83886080 --mem_flag 1 --output_prefix /data/jwd02f/main/079/102/79102477/working/megahit_out/tmp/k21/21 --num_cpu_threads 10 --read_lib_file /data/jwd02f/main/079/102/79102477/working/megahit_out/tmp/reads.lib
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  148 - Preparing data...'
+2025-02-13 13:23:44 - b'INFO  sequence/io/sequence_lib.cpp  :  115 - Before reading, sizeof seq_package: 324'
+2025-02-13 13:23:44 - b'INFO  sequence/io/sequence_lib.cpp  :  117 - After reading, sizeof seq_package: 324'
+2025-02-13 13:23:44 - b'INFO  sorting/kmer_counter.cpp      :   76 - 1 reads, 1232 max read length'
+2025-02-13 13:23:44 - b'INFO  sorting/kmer_counter.cpp      :   82 - 2 words per substring, 2 words per edge'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  153 - Preparing data... Done. Time elapsed: 0.0209'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  156 - Preparing partitions and calculating bucket sizes...'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :   80 - Minimum memory required: 5243336 bytes'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  138 - Lv1 items: 161, Lv2 items: 30'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  139 - Memory of derived class: 5243252, Memory for Lv1+Lv2: 1124'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  165 - Preparing partitions and calculating bucket sizes... Done. Time elapsed: 0.0257'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  172 - Start main loop...'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  185 - Lv1 scanning from bucket 0 to 120'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  192 - Lv1 scanning done. Large diff: 0. Time elapsed: 0.0003'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  198 - Lv1 fetching & sorting done. Time elapsed: 0.0022'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  185 - Lv1 scanning from bucket 120 to 361'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  192 - Lv1 scanning done. Large diff: 0. Time elapsed: 0.0001'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  198 - Lv1 fetching & sorting done. Time elapsed: 0.0001'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  185 - Lv1 scanning from bucket 361 to 602'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  192 - Lv1 scanning done. Large diff: 0. Time elapsed: 0.0001'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  198 - Lv1 fetching & sorting done. Time elapsed: 0.0001'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  185 - Lv1 scanning from bucket 602 to 843'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  192 - Lv1 scanning done. Large diff: 0. Time elapsed: 0.0001'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  198 - Lv1 fetching & sorting done. Time elapsed: 0.0002'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  185 - Lv1 scanning from bucket 843 to 1084'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  192 - Lv1 scanning done. Large diff: 0. Time elapsed: 0.0001'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  198 - Lv1 fetching & sorting done. Time elapsed: 0.0002'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  185 - Lv1 scanning from bucket 1084 to 65536'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  192 - Lv1 scanning done. Large diff: 0. Time elapsed: 0.0027'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  198 - Lv1 fetching & sorting done. Time elapsed: 0.0031'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  204 - Main loop done. Time elapsed: 0.0096'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  207 - Postprocessing...'
+2025-02-13 13:23:44 - b'INFO  sorting/kmer_counter.cpp      :  405 - Total number of candidate reads: 1 (1)'
+2025-02-13 13:23:44 - b'INFO  sorting/kmer_counter.cpp      :  407 - Total number of solid edges: 26'
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  210 - Postprocess done. Time elapsed: 0.0595'
+2025-02-13 13:23:44 - b'INFO  utils/utils.h                 :  152 - Real: 0.1204\tuser: 0.3707\tsys: 0.0656\tmaxrss: 30296'
+2025-02-13 13:23:44 - Build graph for k = 21 
+2025-02-13 13:23:44 - command /usr/local/tools/_conda/envs/__megahit@1.2.9/bin/megahit_core seq2sdbg --host_mem 83886080 --mem_flag 1 --output_prefix /data/jwd02f/main/079/102/79102477/working/megahit_out/tmp/k21/21 --num_cpu_threads 10 -k 21 --kmer_from 0 --input_prefix /data/jwd02f/main/079/102/79102477/working/megahit_out/tmp/k21/21 --need_mercy
+2025-02-13 13:23:44 - b'INFO  sorting/base_engine.cpp       :  148 - Preparing data...'
+2025-02-13 13:23:44 - b'INFO  sorting/seq_to_sdbg.cpp       :  369 - Number edges: 26'
+2025-02-13 13:23:44 - b'INFO  sorting/seq_to_sdbg.cpp       :  413 - Bases to reserve: 704, number contigs: 0, number multiplicity: 32'
+2025-02-13 13:23:44 - b'INFO  sorting/seq_to_sdbg.cpp       :  421 - Before reading, sizeof seq_package: 184, multiplicity vector: 32'
+2025-02-13 13:23:44 - b'INFO  sorting/seq_to_sdbg.cpp       :  428 - Read 26 edges.'
+2025-02-13 13:23:44 - b'INFO  sorting/seq_to_sdbg.cpp       :  429 - After reading, sizeof seq_package: 184/26/572, multiplicity vector: 26/32'
+2025-02-13 13:23:44 - b'INFO  sorting/seq_to_sdbg.cpp       :  440 - Adding mercy edges...'
+2025-02-13 13:23:44 - b'INFO  sorting/seq_to_sdbg.cpp       :  191 - Read 1 reads to search for mercy k-mers'
+2025-02-13 13:23:44 - b'INFO  sorting/seq_to_sdbg.cpp       :  355 - Number of reads: 1, Number of mercy edges: 529'
+2025-02-13 13:23:45 - b'INFO  sorting/seq_to_sdbg.cpp       :  444 - Done. Time elapsed: 0.2585'
+2025-02-13 13:23:45 - b'INFO  sorting/seq_to_sdbg.cpp       :  445 - After adding mercy, sizeof seq_package: 5640/555/12210, multiplicity vector: 555/555'
+2025-02-13 13:23:45 - b'INFO  sorting/seq_to_sdbg.cpp       :  506 - Finally, sizeof seq_package: 5640/555/12210, multiplicity vector: 555/555'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  153 - Preparing data... Done. Time elapsed: 0.3852'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  156 - Preparing partitions and calculating bucket sizes...'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :   80 - Minimum memory required: 7022 bytes'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  138 - Lv1 items: 444, Lv2 items: 90'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  139 - Memory of derived class: 6870, Memory for Lv1+Lv2: 2496'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  165 - Preparing partitions and calculating bucket sizes... Done. Time elapsed: 0.0129'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  172 - Start main loop...'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  185 - Lv1 scanning from bucket 0 to 167'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  192 - Lv1 scanning done. Large diff: 0. Time elapsed: 0.0001'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  198 - Lv1 fetching & sorting done. Time elapsed: 0.0005'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  185 - Lv1 scanning from bucket 167 to 355'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  192 - Lv1 scanning done. Large diff: 0. Time elapsed: 0.0001'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  198 - Lv1 fetching & sorting done. Time elapsed: 0.0001'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  185 - Lv1 scanning from bucket 355 to 543'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  192 - Lv1 scanning done. Large diff: 0. Time elapsed: 0.0000'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  198 - Lv1 fetching & sorting done. Time elapsed: 0.0001'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  185 - Lv1 scanning from bucket 543 to 731'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  192 - Lv1 scanning done. Large diff: 0. Time elapsed: 0.0000'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  198 - Lv1 fetching & sorting done. Time elapsed: 0.0001'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  185 - Lv1 scanning from bucket 731 to 919'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  192 - Lv1 scanning done. Large diff: 0. Time elapsed: 0.0000'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  198 - Lv1 fetching & sorting done. Time elapsed: 0.0002'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  185 - Lv1 scanning from bucket 919 to 65536'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  192 - Lv1 scanning done. Large diff: 0. Time elapsed: 0.0026'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  198 - Lv1 fetching & sorting done. Time elapsed: 0.0024'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  204 - Main loop done. Time elapsed: 0.0066'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  207 - Postprocessing...'
+2025-02-13 13:23:45 - b'INFO  sorting/seq_to_sdbg.cpp       :  793 - Number of $ A C G T A- C- G- T-:'
+2025-02-13 13:23:45 - b'INFO  sorting/seq_to_sdbg.cpp       :  794 - 0 253 302 302 253 0 0 0 0'
+2025-02-13 13:23:45 - b'INFO  sorting/seq_to_sdbg.cpp       :  800 - Total number of edges: 1110'
+2025-02-13 13:23:45 - b'INFO  sorting/seq_to_sdbg.cpp       :  801 - Total number of ONEs: 1110'
+2025-02-13 13:23:45 - b'INFO  sorting/seq_to_sdbg.cpp       :  802 - Total number of $v edges: 0'
+2025-02-13 13:23:45 - b'INFO  sorting/base_engine.cpp       :  210 - Postprocess done. Time elapsed: 0.1141'
+2025-02-13 13:23:45 - b'INFO  utils/utils.h                 :  152 - Real: 0.5262\tuser: 0.5163\tsys: 0.3042\tmaxrss: 269456'
+2025-02-13 13:23:45 - Assemble contigs from SdBG for k = 21
+2025-02-13 13:23:45 - command /usr/local/tools/_conda/envs/__megahit@1.2.9/bin/megahit_core assemble -s /data/jwd02f/main/079/102/79102477/working/megahit_out/tmp/k21/21 -o /data/jwd02f/main/079/102/79102477/working/megahit_out/intermediate_contigs/k21 -t 10 --min_standalone 300 --prune_level 2 --merge_len 20 --merge_similar 0.95 --cleaning_rounds 5 --disconnect_ratio 0.1 --low_local_ratio 0.2 --cleaning_rounds 5 --min_depth 2.0 --bubble_level 2 --max_tip_len -1 --careful_bubble
+2025-02-13 13:23:45 - b'INFO  main_assemble.cpp             :  129 - Loading succinct de Bruijn graph: /data/jwd02f/main/079/102/79102477/working/megahit_out/tmp/k21/21Done. Time elapsed: 0.148410'
+2025-02-13 13:23:45 - b'INFO  main_assemble.cpp             :  133 - Number of Edges: 1110; K value: 21'
+2025-02-13 13:23:45 - b'INFO  main_assemble.cpp             :  140 - Number of CPU threads: 10'
+2025-02-13 13:23:45 - b'INFO  assembly/sdbg_pruning.cpp     :  160 - Removing tips with length less than 2; Accumulated tips removed: 0; time elapsed: 0.0000'
+2025-02-13 13:23:45 - b'INFO  assembly/sdbg_pruning.cpp     :  160 - Removing tips with length less than 4; Accumulated tips removed: 0; time elapsed: 0.0000'
+2025-02-13 13:23:45 - b'INFO  assembly/sdbg_pruning.cpp     :  160 - Removing tips with length less than 8; Accumulated tips removed: 0; time elapsed: 0.0000'
+2025-02-13 13:23:45 - b'INFO  assembly/sdbg_pruning.cpp     :  160 - Removing tips with length less than 16; Accumulated tips removed: 0; time elapsed: 0.0000'
+2025-02-13 13:23:45 - b'INFO  assembly/sdbg_pruning.cpp     :  160 - Removing tips with length less than 32; Accumulated tips removed: 0; time elapsed: 0.0000'
+2025-02-13 13:23:45 - b'INFO  assembly/sdbg_pruning.cpp     :  169 - Removing tips with length less than 42; Accumulated tips removed: 0; time elapsed: 0.0000'
+2025-02-13 13:23:45 - b'INFO  main_assemble.cpp             :  158 - Tips removal done! Time elapsed(sec): 0.002'
+2025-02-13 13:23:45 - b'INFO  assembly/unitig_graph.cpp     :   83 - Graph size without loops: 0, palindrome: 0'
+2025-02-13 13:23:45 - b'INFO  main_assemble.cpp             :  166 - unitig graph size: 1, time for building: 0.002'
+2025-02-13 13:23:45 - b'INFO  assembly/contig_stat.h        :   40 - Max: 576, Min: 576, N50: 576, number contigs: 1, number isolated: 1, number looped: 1, total size: 576,'
+2025-02-13 13:23:45 - b'INFO  main_assemble.cpp             :  184 - Graph cleaning round 1'
+2025-02-13 13:23:45 - b'INFO  main_assemble.cpp             :  200 - Number of bubbles removed: 0, Time elapsed(sec): 0.000'
+2025-02-13 13:23:45 - b'INFO  main_assemble.cpp             :  210 - Number of complex bubbles removed: 0, Time elapsed(sec): 0.000024'
+2025-02-13 13:23:45 - b'INFO  main_assemble.cpp             :  221 - Number unitigs disconnected: 0, time: 0.000'
+2025-02-13 13:23:45 - b'INFO  main_assemble.cpp             :  245 - Unitigs removed in excessive pruning: 0, time: 0.000'
+2025-02-13 13:23:45 - b'INFO  assembly/contig_stat.h        :   40 - Max: 576, Min: 576, N50: 576, number contigs: 1, number isolated: 1, number looped: 1, total size: 576,'
+2025-02-13 13:23:45 - b'INFO  main_assemble.cpp             :  267 - Time to output: 0.000192'
+2025-02-13 13:23:45 - b'INFO  main_assemble.cpp             :  286 - Number of local low depth unitigs removed: 0, complex bubbles removed: 0, time: 0.000034'
+2025-02-13 13:23:45 - b'INFO  assembly/contig_stat.h        :   40 - Max: 576, Min: 576, N50: 576, number contigs: 1, number isolated: 1, number looped: 1, total size: 576,'
+2025-02-13 13:23:45 - b'INFO  utils/utils.h                 :  152 - Real: 0.1675\tuser: 0.2808\tsys: 0.0330\tmaxrss: 22464'
+2025-02-13 13:23:45 - Local assembly for k = 21
+2025-02-13 13:23:45 - command /usr/local/tools/_conda/envs/__megahit@1.2.9/bin/megahit_core local -c /data/jwd02f/main/079/102/79102477/working/megahit_out/intermediate_contigs/k21.contigs.fa -l /data/jwd02f/main/079/102/79102477/working/megahit_out/tmp/reads.lib -t 10 -o /data/jwd02f/main/079/102/79102477/working/megahit_out/intermediate_contigs/k21.local.fa --kmax 29
+2025-02-13 13:23:45 - b'INFO  localasm/hash_mapper.cpp      :   99 - Number of contigs: 0, index size: 0'
+2025-02-13 13:23:45 - b'INFO  localasm/local_assemble.cpp   :  315 - Hash mapper construction time elapsed: 0.003884'
+2025-02-13 13:23:45 - b'INFO  sequence/io/sequence_lib.cpp  :  115 - Before reading, sizeof seq_package: 324'
+2025-02-13 13:23:45 - b'INFO  sequence/io/sequence_lib.cpp  :  117 - After reading, sizeof seq_package: 324'
+2025-02-13 13:23:45 - b'INFO  localasm/local_assemble.cpp   :  324 - Read lib time elapsed: 0.001268'
+2025-02-13 13:23:45 - b'INFO  localasm/local_assemble.cpp   :  330 - Insert size estimation time elapsed: 0.000001'
+2025-02-13 13:23:45 - b'INFO  localasm/local_assemble.cpp   :  218 - Lib 0: total 1 reads, aligned 0, added 0 reads to local assembly'
+2025-02-13 13:23:45 - b'INFO  localasm/local_assemble.cpp   :  338 - Mapping time elapsed: 0.000047'
+2025-02-13 13:23:45 - b'INFO  localasm/local_assemble.cpp   :  232 - Minimum number of reads to do local assembly: 0'
+2025-02-13 13:23:45 - b'INFO  localasm/local_assemble.cpp   :  346 - Local assembly time elapsed: 0.004100'
+2025-02-13 13:23:45 - b'INFO  utils/utils.h                 :  152 - Real: 0.0094\tuser: 0.0553\tsys: 0.0074\tmaxrss: 14696'
+2025-02-13 13:23:45 - Extract iterative edges from k = 21 to 29 
+2025-02-13 13:23:45 - command /usr/local/tools/_conda/envs/__megahit@1.2.9/bin/megahit_core iterate -c /data/jwd02f/main/079/102/79102477/working/megahit_out/intermediate_contigs/k21.contigs.fa -b /data/jwd02f/main/079/102/79102477/working/megahit_out/intermediate_contigs/k21.bubble_seq.fa -t 10 -k 21 -s 8 -o /data/jwd02f/main/079/102/79102477/working/megahit_out/tmp/k29/29 -r /data/jwd02f/main/079/102/79102477/working/megahit_out/tmp/reads.lib.bin
+2025-02-13 13:23:45 - b'INFO  main_iterate.cpp              :  190 - Selected kmer type size for k: 8'
+2025-02-13 13:23:45 - b'INFO  main_iterate.cpp              :  123 - Selected kmer type size for next k: 8'
+2025-02-13 13:23:45 - b'INFO  main_iterate.cpp              :  138 - Processed: 1, aligned: 0. Iterative edges: 0'
+2025-02-13 13:23:45 - b'INFO  main_iterate.cpp              :  142 - Total: 1, aligned: 0. Iterative edges: 0'
+2025-02-13 13:23:45 - b'INFO  utils/utils.h                 :  152 - Real: 0.0136\tuser: 0.0433\tsys: 0.0101\tmaxrss: 14696'
+2025-02-13 13:23:45 - Merging to output final contigs 
+2025-02-13 13:23:45 - 1 contigs, total 576 bp, min 576 bp, max 576 bp, avg 576 bp, N50 576 bp
+2025-02-13 13:23:45 - ALL DONE. Time elapsed: 1.490756 seconds 
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/metaphlan.txt	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,31 @@
+#custom_db
+#mpa_v21_CHOCOPhlAnxxx_2
+#/home/bebatut/miniconda3/envs/mulled-v1-b4915a464cf72db4053ec566c65e3f5f431691323f08f9b6b1c9ecfc4f8b9c88/bin/metaphlan in --input_type fasta --read_min_len 70 --bowtie2db ref_db/ --index custom_db --bt2_ps very-sensitive --min_mapq_val 5 -t rel_ab --tax_lev a --min_cu_len 2000 --add_viruses --stat_q 0.2 --perc_nonzero 0.33 --avoid_disqm --sample_id_key SampleID --sample_id Metaphlan_Analysis -o /tmp/tmptu3575j7/files/000/dataset_19.dat --bowtie2out bowtie2out -s /tmp/tmptu3575j7/files/000/dataset_21.dat --biom /tmp/tmptu3575j7/files/000/dataset_22.dat --nproc 1
+#SampleID	Metaphlan_Analysis
+#clade_name	NCBI_tax_id	relative_abundance	additional_species
+k__Bacteria	2	100.0	
+k__Bacteria|p__Proteobacteria	2|1224	52.20019	
+k__Bacteria|p__Actinobacteria	2|201174	34.37371	
+k__Bacteria|p__Firmicutes	2|1239	13.4261	
+k__Bacteria|p__Proteobacteria|c__Gammaproteobacteria	2|1224|1236	52.20019	
+k__Bacteria|p__Actinobacteria|c__Actinobacteria	2|201174|1760	34.37371	
+k__Bacteria|p__Firmicutes|c__Bacilli	2|1239|91061	13.4261	
+k__Bacteria|p__Proteobacteria|c__Gammaproteobacteria|o__Pseudomonadales	2|1224|1236|72274	52.20019	
+k__Bacteria|p__Actinobacteria|c__Actinobacteria|o__Corynebacteriales	2|201174|1760|85007	24.7409	
+k__Bacteria|p__Firmicutes|c__Bacilli|o__Lactobacillales	2|1239|91061|186826	13.4261	
+k__Bacteria|p__Actinobacteria|c__Actinobacteria|o__Propionibacteriales	2|201174|1760|85009	9.63281	
+k__Bacteria|p__Proteobacteria|c__Gammaproteobacteria|o__Pseudomonadales|f__Moraxellaceae	2|1224|1236|72274|468	52.20019	
+k__Bacteria|p__Actinobacteria|c__Actinobacteria|o__Corynebacteriales|f__Corynebacteriaceae	2|201174|1760|85007|1653	24.7409	
+k__Bacteria|p__Firmicutes|c__Bacilli|o__Lactobacillales|f__Carnobacteriaceae	2|1239|91061|186826|186828	13.4261	
+k__Bacteria|p__Actinobacteria|c__Actinobacteria|o__Propionibacteriales|f__Propionibacteriaceae	2|201174|1760|85009|31957	9.63281	
+k__Bacteria|p__Proteobacteria|c__Gammaproteobacteria|o__Pseudomonadales|f__Moraxellaceae|g__Moraxella	2|1224|1236|72274|468|475	52.20019	
+k__Bacteria|p__Actinobacteria|c__Actinobacteria|o__Corynebacteriales|f__Corynebacteriaceae|g__Corynebacterium	2|201174|1760|85007|1653|1716	24.7409	
+k__Bacteria|p__Firmicutes|c__Bacilli|o__Lactobacillales|f__Carnobacteriaceae|g__Dolosigranulum	2|1239|91061|186826|186828|29393	13.4261	
+k__Bacteria|p__Actinobacteria|c__Actinobacteria|o__Propionibacteriales|f__Propionibacteriaceae|g__Cutibacterium	2|201174|1760|85009|31957|1912216	9.63281	
+k__Bacteria|p__Proteobacteria|c__Gammaproteobacteria|o__Pseudomonadales|f__Moraxellaceae|g__Moraxella|s__Moraxella_lacunata	2|1224|1236|72274|468|475|477	22.57968	
+k__Bacteria|p__Actinobacteria|c__Actinobacteria|o__Corynebacteriales|f__Corynebacteriaceae|g__Corynebacterium|s__Corynebacterium_pseudodiphtheriticum	2|201174|1760|85007|1653|1716|37637	18.75365	
+k__Bacteria|p__Proteobacteria|c__Gammaproteobacteria|o__Pseudomonadales|f__Moraxellaceae|g__Moraxella|s__Moraxella_nonliquefaciens	2|1224|1236|72274|468|475|478	15.88652	
+k__Bacteria|p__Proteobacteria|c__Gammaproteobacteria|o__Pseudomonadales|f__Moraxellaceae|g__Moraxella|s__Moraxella_equi	2|1224|1236|72274|468|475|60442	13.73399	
+k__Bacteria|p__Firmicutes|c__Bacilli|o__Lactobacillales|f__Carnobacteriaceae|g__Dolosigranulum|s__Dolosigranulum_pigrum	2|1239|91061|186826|186828|29393|29394	13.4261	
+k__Bacteria|p__Actinobacteria|c__Actinobacteria|o__Propionibacteriales|f__Propionibacteriaceae|g__Cutibacterium|s__Cutibacterium_acnes	2|201174|1760|85009|31957|1912216|1747	9.63281	
+k__Bacteria|p__Actinobacteria|c__Actinobacteria|o__Corynebacteriales|f__Corynebacteriaceae|g__Corynebacterium|s__Corynebacterium_accolens	2|201174|1760|85007|1653|1716|38284	5.98726	
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/nonpareil.json	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,2194 @@
+{
+    "test.fasta": {
+        "file": "test.fasta",
+        "label": "test.fasta",
+        "col": "#79756B",
+        "L": 88.496,
+        "AL": 88.496,
+        "R": 500,
+        "LR": 44248,
+        "overlap": 50,
+        "ksize": [
+
+        ],
+        "log.sample": 0.7,
+        "kernel": "alignment",
+        "version": "3.5.5",
+        "kappa": 0.2128,
+        "C": 0.2431,
+        "consistent": true,
+        "star": 95,
+        "has.model": true,
+        "warning": [
+
+        ],
+        "LRstar": 24276420.6735,
+        "modelR": 0.9977,
+        "diversity": 11.9521,
+        "x.obs": [
+            0,
+            2,
+            2,
+            3,
+            5,
+            7,
+            10,
+            14,
+            20,
+            29,
+            41,
+            59,
+            84,
+            120,
+            171,
+            245,
+            350,
+            500
+        ],
+        "x.adj": [
+            0,
+            1021.2669,
+            1021.2669,
+            1346.8936,
+            1908.7977,
+            2401.6077,
+            3063.6067,
+            3854.5631,
+            4917.0668,
+            6336.5164,
+            8025.9965,
+            10289.4237,
+            13095.2993,
+            16704.9959,
+            21273.3215,
+            27191.4116,
+            34686.6773,
+            44248
+        ],
+        "y.red": [
+            0,
+            0,
+            0.0012,
+            0.0046,
+            0.006,
+            0.0075,
+            0.0146,
+            0.0231,
+            0.0329,
+            0.0439,
+            0.0585,
+            0.0786,
+            0.0989,
+            0.1216,
+            0.1432,
+            0.1679,
+            0.1914,
+            0.2128
+        ],
+        "y.cov": [
+            0,
+            0,
+            0.0022,
+            0.0073,
+            0.0093,
+            0.0114,
+            0.021,
+            0.032,
+            0.0441,
+            0.0575,
+            0.0747,
+            0.0978,
+            0.1206,
+            0.1457,
+            0.1692,
+            0.1957,
+            0.2206,
+            0.2431
+        ],
+        "y.sd": [
+            0,
+            0,
+            0.0432,
+            0.0518,
+            0.062,
+            0.0512,
+            0.0584,
+            0.0619,
+            0.0609,
+            0.0567,
+            0.0556,
+            0.0513,
+            0.0476,
+            0.0437,
+            0.0365,
+            0.0306,
+            0.0237,
+            0.0135
+        ],
+        "y.p25": [
+            0,
+            0,
+            0,
+            0,
+            0,
+            0,
+            0,
+            0,
+            0,
+            0,
+            0.0409,
+            0.0657,
+            0.0933,
+            0.1208,
+            0.1494,
+            0.1802,
+            0.209,
+            0.2368
+        ],
+        "y.p50": [
+            0,
+            0,
+            0,
+            0,
+            0,
+            0,
+            0,
+            0,
+            0,
+            0.0547,
+            0.0527,
+            0.0937,
+            0.1173,
+            0.1241,
+            0.1667,
+            0.1944,
+            0.2204,
+            0.2423
+        ],
+        "y.p75": [
+            0,
+            0,
+            0,
+            0,
+            0,
+            0,
+            0,
+            0,
+            0.0793,
+            0.0868,
+            0.1058,
+            0.1241,
+            0.147,
+            0.1702,
+            0.1889,
+            0.2115,
+            0.232,
+            0.2504
+        ],
+        "x.model": [
+            1000,
+            1006.0155,
+            1012.0672,
+            1018.1552,
+            1024.2799,
+            1030.4415,
+            1036.6401,
+            1042.876,
+            1049.1494,
+            1055.4605,
+            1061.8096,
+            1068.1969,
+            1074.6226,
+            1081.087,
+            1087.5902,
+            1094.1326,
+            1100.7144,
+            1107.3357,
+            1113.9969,
+            1120.6981,
+            1127.4396,
+            1134.2217,
+            1141.0446,
+            1147.9085,
+            1154.8138,
+            1161.7605,
+            1168.7491,
+            1175.7797,
+            1182.8525,
+            1189.968,
+            1197.1262,
+            1204.3275,
+            1211.5721,
+            1218.8603,
+            1226.1923,
+            1233.5685,
+            1240.989,
+            1248.4541,
+            1255.9642,
+            1263.5194,
+            1271.1201,
+            1278.7665,
+            1286.4589,
+            1294.1976,
+            1301.9828,
+            1309.8148,
+            1317.694,
+            1325.6206,
+            1333.5948,
+            1341.617,
+            1349.6875,
+            1357.8065,
+            1365.9744,
+            1374.1914,
+            1382.4578,
+            1390.774,
+            1399.1402,
+            1407.5567,
+            1416.0238,
+            1424.5419,
+            1433.1112,
+            1441.732,
+            1450.4047,
+            1459.1296,
+            1467.907,
+            1476.7372,
+            1485.6204,
+            1494.5572,
+            1503.5477,
+            1512.5922,
+            1521.6912,
+            1530.8449,
+            1540.0537,
+            1549.3178,
+            1558.6377,
+            1568.0137,
+            1577.446,
+            1586.9351,
+            1596.4813,
+            1606.0849,
+            1615.7463,
+            1625.4658,
+            1635.2438,
+            1645.0805,
+            1654.9765,
+            1664.932,
+            1674.9474,
+            1685.023,
+            1695.1592,
+            1705.3564,
+            1715.6149,
+            1725.9352,
+            1736.3175,
+            1746.7623,
+            1757.2699,
+            1767.8408,
+            1778.4752,
+            1789.1736,
+            1799.9363,
+            1810.7638,
+            1821.6564,
+            1832.6145,
+            1843.6386,
+            1854.729,
+            1865.8861,
+            1877.1103,
+            1888.402,
+            1899.7617,
+            1911.1896,
+            1922.6864,
+            1934.2523,
+            1945.8877,
+            1957.5932,
+            1969.369,
+            1981.2157,
+            1993.1337,
+            2005.1234,
+            2017.1852,
+            2029.3195,
+            2041.5268,
+            2053.8076,
+            2066.1623,
+            2078.5912,
+            2091.0949,
+            2103.6739,
+            2116.3285,
+            2129.0592,
+            2141.8666,
+            2154.7509,
+            2167.7128,
+            2180.7526,
+            2193.8709,
+            2207.0681,
+            2220.3447,
+            2233.7011,
+            2247.1379,
+            2260.6555,
+            2274.2545,
+            2287.9352,
+            2301.6982,
+            2315.5441,
+            2329.4732,
+            2343.4861,
+            2357.5833,
+            2371.7653,
+            2386.0326,
+            2400.3857,
+            2414.8252,
+            2429.3516,
+            2443.9653,
+            2458.6669,
+            2473.457,
+            2488.336,
+            2503.3046,
+            2518.3632,
+            2533.5123,
+            2548.7526,
+            2564.0846,
+            2579.5088,
+            2595.0258,
+            2610.6361,
+            2626.3404,
+            2642.1391,
+            2658.0328,
+            2674.0222,
+            2690.1077,
+            2706.29,
+            2722.5696,
+            2738.9472,
+            2755.4233,
+            2771.9985,
+            2788.6734,
+            2805.4486,
+            2822.3248,
+            2839.3024,
+            2856.3822,
+            2873.5647,
+            2890.8506,
+            2908.2404,
+            2925.7349,
+            2943.3346,
+            2961.0402,
+            2978.8523,
+            2996.7715,
+            3014.7985,
+            3032.934,
+            3051.1786,
+            3069.5329,
+            3087.9976,
+            3106.5734,
+            3125.2609,
+            3144.0609,
+            3162.9739,
+            3182.0008,
+            3201.142,
+            3220.3984,
+            3239.7707,
+            3259.2595,
+            3278.8655,
+            3298.5895,
+            3318.4321,
+            3338.394,
+            3358.4761,
+            3378.6789,
+            3399.0033,
+            3419.45,
+            3440.0196,
+            3460.713,
+            3481.5309,
+            3502.4739,
+            3523.543,
+            3544.7388,
+            3566.0621,
+            3587.5137,
+            3609.0944,
+            3630.8048,
+            3652.6458,
+            3674.6183,
+            3696.7229,
+            3718.9604,
+            3741.3318,
+            3763.8377,
+            3786.479,
+            3809.2565,
+            3832.171,
+            3855.2234,
+            3878.4144,
+            3901.7449,
+            3925.2158,
+            3948.8279,
+            3972.582,
+            3996.479,
+            4020.5198,
+            4044.7051,
+            4069.036,
+            4093.5132,
+            4118.1376,
+            4142.9102,
+            4167.8318,
+            4192.9034,
+            4218.1257,
+            4243.4998,
+            4269.0265,
+            4294.7067,
+            4320.5415,
+            4346.5316,
+            4372.6781,
+            4398.9818,
+            4425.4438,
+            4452.065,
+            4478.8464,
+            4505.7888,
+            4532.8933,
+            4560.1608,
+            4587.5924,
+            4615.189,
+            4642.9516,
+            4670.8811,
+            4698.9788,
+            4727.2454,
+            4755.682,
+            4784.2898,
+            4813.0696,
+            4842.0225,
+            4871.1496,
+            4900.4519,
+            4929.9305,
+            4959.5864,
+            4989.4207,
+            5019.4345,
+            5049.6288,
+            5080.0048,
+            5110.5635,
+            5141.306,
+            5172.2334,
+            5203.3469,
+            5234.6475,
+            5266.1365,
+            5297.8148,
+            5329.6837,
+            5361.7444,
+            5393.9978,
+            5426.4453,
+            5459.088,
+            5491.9271,
+            5524.9637,
+            5558.199,
+            5591.6342,
+            5625.2706,
+            5659.1093,
+            5693.1516,
+            5727.3987,
+            5761.8517,
+            5796.5121,
+            5831.3809,
+            5866.4595,
+            5901.749,
+            5937.2509,
+            5972.9663,
+            6008.8966,
+            6045.043,
+            6081.4069,
+            6117.9895,
+            6154.7921,
+            6191.8162,
+            6229.063,
+            6266.5338,
+            6304.23,
+            6342.153,
+            6380.3041,
+            6418.6847,
+            6457.2962,
+            6496.14,
+            6535.2174,
+            6574.5299,
+            6614.0788,
+            6653.8657,
+            6693.8919,
+            6734.1589,
+            6774.6681,
+            6815.421,
+            6856.4191,
+            6897.6637,
+            6939.1565,
+            6980.8989,
+            7022.8924,
+            7065.1385,
+            7107.6387,
+            7150.3946,
+            7193.4076,
+            7236.6795,
+            7280.2116,
+            7324.0056,
+            7368.063,
+            7412.3855,
+            7456.9745,
+            7501.8318,
+            7546.959,
+            7592.3576,
+            7638.0293,
+            7683.9757,
+            7730.1985,
+            7776.6994,
+            7823.48,
+            7870.542,
+            7917.8871,
+            7965.517,
+            8013.4335,
+            8061.6381,
+            8110.1328,
+            8158.9192,
+            8207.999,
+            8257.3741,
+            8307.0462,
+            8357.0171,
+            8407.2885,
+            8457.8624,
+            8508.7406,
+            8559.9248,
+            8611.4168,
+            8663.2187,
+            8715.3321,
+            8767.759,
+            8820.5013,
+            8873.5609,
+            8926.9397,
+            8980.6395,
+            9034.6624,
+            9089.0103,
+            9143.685,
+            9198.6887,
+            9254.0233,
+            9309.6907,
+            9365.693,
+            9422.0321,
+            9478.7102,
+            9535.7292,
+            9593.0912,
+            9650.7983,
+            9708.8525,
+            9767.256,
+            9826.0107,
+            9885.1189,
+            9944.5827,
+            10004.4042,
+            10064.5855,
+            10125.1288,
+            10186.0364,
+            10247.3103,
+            10308.9528,
+            10370.9661,
+            10433.3525,
+            10496.1141,
+            10559.2533,
+            10622.7723,
+            10686.6735,
+            10750.959,
+            10815.6312,
+            10880.6924,
+            10946.145,
+            11011.9914,
+            11078.2338,
+            11144.8747,
+            11211.9165,
+            11279.3616,
+            11347.2124,
+            11415.4714,
+            11484.141,
+            11553.2236,
+            11622.7218,
+            11692.6381,
+            11762.975,
+            11833.735,
+            11904.9206,
+            11976.5344,
+            12048.5791,
+            12121.0571,
+            12193.9711,
+            12267.3237,
+            12341.1176,
+            12415.3554,
+            12490.0397,
+            12565.1734,
+            12640.7589,
+            12716.7992,
+            12793.2969,
+            12870.2548,
+            12947.6756,
+            13025.5621,
+            13103.9171,
+            13182.7435,
+            13262.0441,
+            13341.8217,
+            13422.0792,
+            13502.8195,
+            13584.0454,
+            13665.76,
+            13747.9662,
+            13830.6668,
+            13913.865,
+            13997.5636,
+            14081.7657,
+            14166.4743,
+            14251.6925,
+            14337.4233,
+            14423.6698,
+            14510.4351,
+            14597.7224,
+            14685.5348,
+            14773.8754,
+            14862.7473,
+            14952.1539,
+            15042.0984,
+            15132.5839,
+            15223.6137,
+            15315.191,
+            15407.3193,
+            15500.0018,
+            15593.2418,
+            15687.0426,
+            15781.4078,
+            15876.3406,
+            15971.8444,
+            16067.9228,
+            16164.5791,
+            16261.8168,
+            16359.6395,
+            16458.0506,
+            16557.0538,
+            16656.6524,
+            16756.8502,
+            16857.6508,
+            16959.0577,
+            17061.0746,
+            17163.7052,
+            17266.9532,
+            17370.8222,
+            17475.3161,
+            17580.4386,
+            17686.1934,
+            17792.5844,
+            17899.6154,
+            18007.2902,
+            18115.6128,
+            18224.5869,
+            18334.2166,
+            18444.5058,
+            18555.4584,
+            18667.0784,
+            18779.3699,
+            18892.3369,
+            19005.9834,
+            19120.3136,
+            19235.3315,
+            19351.0413,
+            19467.4472,
+            19584.5533,
+            19702.3638,
+            19820.883,
+            19940.1152,
+            20060.0646,
+            20180.7356,
+            20302.1325,
+            20424.2596,
+            20547.1214,
+            20670.7222,
+            20795.0666,
+            20920.159,
+            21046.0038,
+            21172.6057,
+            21299.9692,
+            21428.0988,
+            21556.9991,
+            21686.6749,
+            21817.1307,
+            21948.3713,
+            22080.4013,
+            22213.2256,
+            22346.8489,
+            22481.2759,
+            22616.5117,
+            22752.5609,
+            22889.4286,
+            23027.1195,
+            23165.6388,
+            23304.9913,
+            23445.182,
+            23586.2161,
+            23728.0986,
+            23870.8346,
+            24014.4292,
+            24158.8875,
+            24304.2149,
+            24450.4165,
+            24597.4976,
+            24745.4634,
+            24894.3193,
+            25044.0706,
+            25194.7228,
+            25346.2812,
+            25498.7514,
+            25652.1387,
+            25806.4487,
+            25961.6869,
+            26117.859,
+            26274.9705,
+            26433.0272,
+            26592.0346,
+            26751.9985,
+            26912.9247,
+            27074.8189,
+            27237.687,
+            27401.5349,
+            27566.3683,
+            27732.1933,
+            27899.0159,
+            28066.8419,
+            28235.6775,
+            28405.5288,
+            28576.4017,
+            28748.3026,
+            28921.2375,
+            29095.2127,
+            29270.2345,
+            29446.3091,
+            29623.4428,
+            29801.6421,
+            29980.9134,
+            30161.2631,
+            30342.6976,
+            30525.2236,
+            30708.8476,
+            30893.5761,
+            31079.4159,
+            31266.3736,
+            31454.4559,
+            31643.6696,
+            31834.0216,
+            32025.5186,
+            32218.1676,
+            32411.9754,
+            32606.9491,
+            32803.0956,
+            33000.4221,
+            33198.9355,
+            33398.6432,
+            33599.5521,
+            33801.6697,
+            34005.003,
+            34209.5595,
+            34415.3465,
+            34622.3715,
+            34830.6417,
+            35040.1649,
+            35250.9484,
+            35462.9999,
+            35676.3269,
+            35890.9373,
+            36106.8386,
+            36324.0386,
+            36542.5453,
+            36762.3663,
+            36983.5097,
+            37205.9834,
+            37429.7953,
+            37654.9536,
+            37881.4663,
+            38109.3416,
+            38338.5877,
+            38569.2128,
+            38801.2253,
+            39034.6334,
+            39269.4456,
+            39505.6702,
+            39743.3159,
+            39982.3911,
+            40222.9045,
+            40464.8647,
+            40708.2804,
+            40953.1604,
+            41199.5134,
+            41447.3484,
+            41696.6742,
+            41947.4998,
+            42199.8343,
+            42453.6866,
+            42709.0661,
+            42965.9817,
+            43224.4428,
+            43484.4587,
+            43746.0387,
+            44009.1923,
+            44273.9288,
+            44540.2579,
+            44808.189,
+            45077.7319,
+            45348.8963,
+            45621.6918,
+            45896.1283,
+            46172.2156,
+            46449.9638,
+            46729.3828,
+            47010.4826,
+            47293.2733,
+            47577.7652,
+            47863.9684,
+            48151.8933,
+            48441.5502,
+            48732.9495,
+            49026.1017,
+            49321.0174,
+            49617.7071,
+            49916.1816,
+            50216.4515,
+            50518.5277,
+            50822.421,
+            51128.1424,
+            51435.7029,
+            51745.1135,
+            52056.3853,
+            52369.5296,
+            52684.5576,
+            53001.4807,
+            53320.3101,
+            53641.0576,
+            53963.7344,
+            54288.3523,
+            54614.923,
+            54943.4581,
+            55273.9695,
+            55606.4692,
+            55940.9689,
+            56277.4808,
+            56616.0171,
+            56956.5897,
+            57299.2111,
+            57643.8935,
+            57990.6494,
+            58339.4911,
+            58690.4314,
+            59043.4826,
+            59398.6577,
+            59755.9693,
+            60115.4303,
+            60477.0536,
+            60840.8523,
+            61206.8394,
+            61575.0281,
+            61945.4316,
+            62318.0633,
+            62692.9365,
+            63070.0648,
+            63449.4617,
+            63831.1408,
+            64215.116,
+            64601.4009,
+            64990.0095,
+            65380.9558,
+            65774.2538,
+            66169.9177,
+            66567.9617,
+            66968.4001,
+            67371.2474,
+            67776.518,
+            68184.2265,
+            68594.3875,
+            69007.0159,
+            69422.1264,
+            69839.734,
+            70259.8537,
+            70682.5006,
+            71107.69,
+            71535.4371,
+            71965.7573,
+            72398.6661,
+            72834.179,
+            73272.3117,
+            73713.0801,
+            74156.4998,
+            74602.587,
+            75051.3576,
+            75502.8277,
+            75957.0137,
+            76413.9318,
+            76873.5985,
+            77336.0303,
+            77801.2438,
+            78269.2559,
+            78740.0832,
+            79213.7429,
+            79690.2518,
+            80169.6271,
+            80651.8861,
+            81137.0461,
+            81625.1246,
+            82116.1392,
+            82610.1074,
+            83107.0471,
+            83606.9761,
+            84109.9124,
+            84615.8742,
+            85124.8795,
+            85636.9467,
+            86152.0943,
+            86670.3408,
+            87191.7047,
+            87716.2049,
+            88243.8602,
+            88774.6896,
+            89308.7123,
+            89845.9473,
+            90386.414,
+            90930.132,
+            91477.1206,
+            92027.3996,
+            92580.9889,
+            93137.9082,
+            93698.1777,
+            94261.8175,
+            94828.8478,
+            95399.2891,
+            95973.1619,
+            96550.4868,
+            97131.2846,
+            97715.5762,
+            98303.3825,
+            98894.7248,
+            99489.6244,
+            100088.1025,
+            100690.1807,
+            101295.8808,
+            101905.2244,
+            102518.2335,
+            103134.9302,
+            103755.3366,
+            104379.4751,
+            105007.368,
+            105639.038,
+            106274.5078,
+            106913.8003,
+            107556.9384,
+            108203.9453,
+            108854.8443,
+            109509.6588,
+            110168.4122,
+            110831.1284,
+            111497.8312,
+            112168.5444,
+            112843.2924,
+            113522.0993,
+            114204.9895,
+            114891.9877,
+            115583.1184,
+            116278.4067,
+            116977.8774,
+            117681.5559,
+            118389.4672,
+            119101.637,
+            119818.0909,
+            120538.8545,
+            121263.9539,
+            121993.4152,
+            122727.2645,
+            123465.5282,
+            124208.233,
+            124955.4055,
+            125707.0726,
+            126463.2613,
+            127223.9989,
+            127989.3126,
+            128759.2301,
+            129533.7791,
+            130312.9873,
+            131096.8828,
+            131885.4939,
+            132678.8488,
+            133476.9761,
+            134279.9046,
+            135087.663,
+            135900.2805,
+            136717.7863,
+            137540.2098,
+            138367.5806,
+            139199.9284,
+            140037.2832,
+            140879.675,
+            141727.1343,
+            142579.6914,
+            143437.3771,
+            144300.2222,
+            145168.2577,
+            146041.5148,
+            146920.0251,
+            147803.82,
+            148692.9313,
+            149587.3911,
+            150487.2314,
+            151392.4848,
+            152303.1837,
+            153219.3609,
+            154141.0493,
+            155068.2821,
+            156001.0927,
+            156939.5146,
+            157883.5815,
+            158833.3275,
+            159788.7866,
+            160749.9933,
+            161716.9822,
+            162689.7879,
+            163668.4455,
+            164652.9902,
+            165643.4575,
+            166639.8828,
+            167642.3022,
+            168650.7516,
+            169665.2672,
+            170685.8857,
+            171712.6438,
+            172745.5782,
+            173784.7263,
+            174830.1253,
+            175881.8129,
+            176939.8269,
+            178004.2054,
+            179074.9866,
+            180152.2091,
+            181235.9117,
+            182326.1332,
+            183422.9129,
+            184526.2903,
+            185636.305,
+            186752.997,
+            187876.4064,
+            189006.5737,
+            190143.5395,
+            191287.3447,
+            192438.0304,
+            193595.6381,
+            194760.2093,
+            195931.786,
+            197110.4103,
+            198296.1246,
+            199488.9715,
+            200688.994,
+            201896.2352,
+            203110.7385,
+            204332.5476,
+            205561.7066,
+            206798.2595,
+            208042.2508,
+            209293.7254,
+            210552.7282,
+            211819.3045,
+            213093.4999,
+            214375.3602,
+            215664.9315,
+            216962.2602,
+            218267.3929,
+            219580.3767,
+            220901.2586,
+            222230.0864,
+            223566.9076,
+            224911.7705,
+            226264.7234,
+            227625.8149,
+            228995.0941,
+            230372.6102,
+            231758.4126,
+            233152.5514,
+            234555.0765,
+            235966.0386,
+            237385.4882,
+            238813.4765,
+            240250.0549,
+            241695.275,
+            243149.1887,
+            244611.8485,
+            246083.3069,
+            247563.6168,
+            249052.8314,
+            250551.0045,
+            252058.1897,
+            253574.4414,
+            255099.8141,
+            256634.3626,
+            258178.1422,
+            259731.2084,
+            261293.617,
+            262865.4243,
+            264446.6867,
+            266037.4612,
+            267637.805,
+            269247.7756,
+            270867.431,
+            272496.8293,
+            274136.0293,
+            275785.0899,
+            277444.0703,
+            279113.0304,
+            280792.03,
+            282481.1296,
+            284180.39,
+            285889.8722,
+            287609.6379,
+            289339.7487,
+            291080.267,
+            292831.2553,
+            294592.7767,
+            296364.8945,
+            298147.6724,
+            299941.1746,
+            301745.4655,
+            303560.6102,
+            305386.6738,
+            307223.7221,
+            309071.8211,
+            310931.0373,
+            312801.4377,
+            314683.0893,
+            316576.06,
+            318480.4179,
+            320396.2313,
+            322323.5694,
+            324262.5012,
+            326213.0967,
+            328175.426,
+            330149.5596,
+            332135.5686,
+            334133.5244,
+            336143.4989,
+            338165.5643,
+            340199.7935,
+            342246.2595,
+            344305.036,
+            346376.197,
+            348459.817,
+            350555.9711,
+            352664.7345,
+            354786.1831,
+            356920.3933,
+            359067.4418,
+            361227.4058,
+            363400.363,
+            365586.3917,
+            367785.5703,
+            369997.9781,
+            372223.6946,
+            374462.7998,
+            376715.3743,
+            378981.4992,
+            381261.2559,
+            383554.7264,
+            385861.9932,
+            388183.1394,
+            390518.2484,
+            392867.4042,
+            395230.6913,
+            397608.1947,
+            400000
+        ],
+        "y.model": [
+            0.0056,
+            0.0056,
+            0.0057,
+            0.0058,
+            0.0058,
+            0.0059,
+            0.0059,
+            0.006,
+            0.0061,
+            0.0061,
+            0.0062,
+            0.0062,
+            0.0063,
+            0.0064,
+            0.0064,
+            0.0065,
+            0.0065,
+            0.0066,
+            0.0067,
+            0.0067,
+            0.0068,
+            0.0069,
+            0.0069,
+            0.007,
+            0.0071,
+            0.0071,
+            0.0072,
+            0.0073,
+            0.0073,
+            0.0074,
+            0.0075,
+            0.0076,
+            0.0076,
+            0.0077,
+            0.0078,
+            0.0078,
+            0.0079,
+            0.008,
+            0.0081,
+            0.0081,
+            0.0082,
+            0.0083,
+            0.0084,
+            0.0084,
+            0.0085,
+            0.0086,
+            0.0087,
+            0.0088,
+            0.0088,
+            0.0089,
+            0.009,
+            0.0091,
+            0.0092,
+            0.0093,
+            0.0093,
+            0.0094,
+            0.0095,
+            0.0096,
+            0.0097,
+            0.0098,
+            0.0099,
+            0.0099,
+            0.01,
+            0.0101,
+            0.0102,
+            0.0103,
+            0.0104,
+            0.0105,
+            0.0106,
+            0.0107,
+            0.0108,
+            0.0109,
+            0.011,
+            0.0111,
+            0.0112,
+            0.0113,
+            0.0114,
+            0.0115,
+            0.0116,
+            0.0117,
+            0.0118,
+            0.0119,
+            0.012,
+            0.0121,
+            0.0122,
+            0.0123,
+            0.0124,
+            0.0125,
+            0.0126,
+            0.0127,
+            0.0128,
+            0.0129,
+            0.013,
+            0.0131,
+            0.0133,
+            0.0134,
+            0.0135,
+            0.0136,
+            0.0137,
+            0.0138,
+            0.0139,
+            0.0141,
+            0.0142,
+            0.0143,
+            0.0144,
+            0.0145,
+            0.0147,
+            0.0148,
+            0.0149,
+            0.015,
+            0.0151,
+            0.0153,
+            0.0154,
+            0.0155,
+            0.0157,
+            0.0158,
+            0.0159,
+            0.016,
+            0.0162,
+            0.0163,
+            0.0164,
+            0.0166,
+            0.0167,
+            0.0168,
+            0.017,
+            0.0171,
+            0.0173,
+            0.0174,
+            0.0175,
+            0.0177,
+            0.0178,
+            0.018,
+            0.0181,
+            0.0182,
+            0.0184,
+            0.0185,
+            0.0187,
+            0.0188,
+            0.019,
+            0.0191,
+            0.0193,
+            0.0194,
+            0.0196,
+            0.0197,
+            0.0199,
+            0.02,
+            0.0202,
+            0.0204,
+            0.0205,
+            0.0207,
+            0.0208,
+            0.021,
+            0.0211,
+            0.0213,
+            0.0215,
+            0.0216,
+            0.0218,
+            0.022,
+            0.0221,
+            0.0223,
+            0.0225,
+            0.0226,
+            0.0228,
+            0.023,
+            0.0232,
+            0.0233,
+            0.0235,
+            0.0237,
+            0.0239,
+            0.024,
+            0.0242,
+            0.0244,
+            0.0246,
+            0.0248,
+            0.025,
+            0.0251,
+            0.0253,
+            0.0255,
+            0.0257,
+            0.0259,
+            0.0261,
+            0.0263,
+            0.0265,
+            0.0267,
+            0.0268,
+            0.027,
+            0.0272,
+            0.0274,
+            0.0276,
+            0.0278,
+            0.028,
+            0.0282,
+            0.0284,
+            0.0286,
+            0.0289,
+            0.0291,
+            0.0293,
+            0.0295,
+            0.0297,
+            0.0299,
+            0.0301,
+            0.0303,
+            0.0305,
+            0.0307,
+            0.031,
+            0.0312,
+            0.0314,
+            0.0316,
+            0.0318,
+            0.0321,
+            0.0323,
+            0.0325,
+            0.0327,
+            0.033,
+            0.0332,
+            0.0334,
+            0.0337,
+            0.0339,
+            0.0341,
+            0.0344,
+            0.0346,
+            0.0348,
+            0.0351,
+            0.0353,
+            0.0355,
+            0.0358,
+            0.036,
+            0.0363,
+            0.0365,
+            0.0368,
+            0.037,
+            0.0373,
+            0.0375,
+            0.0378,
+            0.038,
+            0.0383,
+            0.0385,
+            0.0388,
+            0.039,
+            0.0393,
+            0.0396,
+            0.0398,
+            0.0401,
+            0.0403,
+            0.0406,
+            0.0409,
+            0.0411,
+            0.0414,
+            0.0417,
+            0.0419,
+            0.0422,
+            0.0425,
+            0.0428,
+            0.043,
+            0.0433,
+            0.0436,
+            0.0439,
+            0.0442,
+            0.0444,
+            0.0447,
+            0.045,
+            0.0453,
+            0.0456,
+            0.0459,
+            0.0462,
+            0.0465,
+            0.0468,
+            0.0471,
+            0.0474,
+            0.0477,
+            0.048,
+            0.0483,
+            0.0486,
+            0.0489,
+            0.0492,
+            0.0495,
+            0.0498,
+            0.0501,
+            0.0504,
+            0.0507,
+            0.051,
+            0.0513,
+            0.0517,
+            0.052,
+            0.0523,
+            0.0526,
+            0.0529,
+            0.0533,
+            0.0536,
+            0.0539,
+            0.0542,
+            0.0546,
+            0.0549,
+            0.0552,
+            0.0556,
+            0.0559,
+            0.0562,
+            0.0566,
+            0.0569,
+            0.0572,
+            0.0576,
+            0.0579,
+            0.0583,
+            0.0586,
+            0.059,
+            0.0593,
+            0.0597,
+            0.06,
+            0.0604,
+            0.0607,
+            0.0611,
+            0.0614,
+            0.0618,
+            0.0621,
+            0.0625,
+            0.0629,
+            0.0632,
+            0.0636,
+            0.064,
+            0.0643,
+            0.0647,
+            0.0651,
+            0.0655,
+            0.0658,
+            0.0662,
+            0.0666,
+            0.067,
+            0.0673,
+            0.0677,
+            0.0681,
+            0.0685,
+            0.0689,
+            0.0693,
+            0.0697,
+            0.07,
+            0.0704,
+            0.0708,
+            0.0712,
+            0.0716,
+            0.072,
+            0.0724,
+            0.0728,
+            0.0732,
+            0.0736,
+            0.074,
+            0.0745,
+            0.0749,
+            0.0753,
+            0.0757,
+            0.0761,
+            0.0765,
+            0.0769,
+            0.0774,
+            0.0778,
+            0.0782,
+            0.0786,
+            0.079,
+            0.0795,
+            0.0799,
+            0.0803,
+            0.0808,
+            0.0812,
+            0.0816,
+            0.0821,
+            0.0825,
+            0.0829,
+            0.0834,
+            0.0838,
+            0.0843,
+            0.0847,
+            0.0852,
+            0.0856,
+            0.0861,
+            0.0865,
+            0.087,
+            0.0874,
+            0.0879,
+            0.0883,
+            0.0888,
+            0.0892,
+            0.0897,
+            0.0902,
+            0.0906,
+            0.0911,
+            0.0916,
+            0.092,
+            0.0925,
+            0.093,
+            0.0935,
+            0.0939,
+            0.0944,
+            0.0949,
+            0.0954,
+            0.0959,
+            0.0963,
+            0.0968,
+            0.0973,
+            0.0978,
+            0.0983,
+            0.0988,
+            0.0993,
+            0.0998,
+            0.1003,
+            0.1008,
+            0.1013,
+            0.1018,
+            0.1023,
+            0.1028,
+            0.1033,
+            0.1038,
+            0.1043,
+            0.1048,
+            0.1053,
+            0.1058,
+            0.1064,
+            0.1069,
+            0.1074,
+            0.1079,
+            0.1084,
+            0.109,
+            0.1095,
+            0.11,
+            0.1105,
+            0.1111,
+            0.1116,
+            0.1121,
+            0.1127,
+            0.1132,
+            0.1138,
+            0.1143,
+            0.1148,
+            0.1154,
+            0.1159,
+            0.1165,
+            0.117,
+            0.1176,
+            0.1181,
+            0.1187,
+            0.1192,
+            0.1198,
+            0.1203,
+            0.1209,
+            0.1215,
+            0.122,
+            0.1226,
+            0.1231,
+            0.1237,
+            0.1243,
+            0.1248,
+            0.1254,
+            0.126,
+            0.1266,
+            0.1271,
+            0.1277,
+            0.1283,
+            0.1289,
+            0.1295,
+            0.13,
+            0.1306,
+            0.1312,
+            0.1318,
+            0.1324,
+            0.133,
+            0.1336,
+            0.1342,
+            0.1348,
+            0.1354,
+            0.136,
+            0.1366,
+            0.1372,
+            0.1378,
+            0.1384,
+            0.139,
+            0.1396,
+            0.1402,
+            0.1408,
+            0.1414,
+            0.1421,
+            0.1427,
+            0.1433,
+            0.1439,
+            0.1445,
+            0.1452,
+            0.1458,
+            0.1464,
+            0.147,
+            0.1477,
+            0.1483,
+            0.1489,
+            0.1496,
+            0.1502,
+            0.1508,
+            0.1515,
+            0.1521,
+            0.1528,
+            0.1534,
+            0.154,
+            0.1547,
+            0.1553,
+            0.156,
+            0.1566,
+            0.1573,
+            0.1579,
+            0.1586,
+            0.1593,
+            0.1599,
+            0.1606,
+            0.1612,
+            0.1619,
+            0.1626,
+            0.1632,
+            0.1639,
+            0.1646,
+            0.1652,
+            0.1659,
+            0.1666,
+            0.1673,
+            0.1679,
+            0.1686,
+            0.1693,
+            0.17,
+            0.1707,
+            0.1713,
+            0.172,
+            0.1727,
+            0.1734,
+            0.1741,
+            0.1748,
+            0.1755,
+            0.1762,
+            0.1769,
+            0.1776,
+            0.1783,
+            0.179,
+            0.1797,
+            0.1804,
+            0.1811,
+            0.1818,
+            0.1825,
+            0.1832,
+            0.1839,
+            0.1846,
+            0.1853,
+            0.186,
+            0.1867,
+            0.1875,
+            0.1882,
+            0.1889,
+            0.1896,
+            0.1903,
+            0.1911,
+            0.1918,
+            0.1925,
+            0.1932,
+            0.194,
+            0.1947,
+            0.1954,
+            0.1962,
+            0.1969,
+            0.1976,
+            0.1984,
+            0.1991,
+            0.1999,
+            0.2006,
+            0.2013,
+            0.2021,
+            0.2028,
+            0.2036,
+            0.2043,
+            0.2051,
+            0.2058,
+            0.2066,
+            0.2073,
+            0.2081,
+            0.2089,
+            0.2096,
+            0.2104,
+            0.2111,
+            0.2119,
+            0.2127,
+            0.2134,
+            0.2142,
+            0.2149,
+            0.2157,
+            0.2165,
+            0.2173,
+            0.218,
+            0.2188,
+            0.2196,
+            0.2204,
+            0.2211,
+            0.2219,
+            0.2227,
+            0.2235,
+            0.2243,
+            0.225,
+            0.2258,
+            0.2266,
+            0.2274,
+            0.2282,
+            0.229,
+            0.2298,
+            0.2306,
+            0.2313,
+            0.2321,
+            0.2329,
+            0.2337,
+            0.2345,
+            0.2353,
+            0.2361,
+            0.2369,
+            0.2377,
+            0.2385,
+            0.2393,
+            0.2402,
+            0.241,
+            0.2418,
+            0.2426,
+            0.2434,
+            0.2442,
+            0.245,
+            0.2458,
+            0.2466,
+            0.2475,
+            0.2483,
+            0.2491,
+            0.2499,
+            0.2507,
+            0.2516,
+            0.2524,
+            0.2532,
+            0.254,
+            0.2549,
+            0.2557,
+            0.2565,
+            0.2574,
+            0.2582,
+            0.259,
+            0.2599,
+            0.2607,
+            0.2615,
+            0.2624,
+            0.2632,
+            0.264,
+            0.2649,
+            0.2657,
+            0.2666,
+            0.2674,
+            0.2682,
+            0.2691,
+            0.2699,
+            0.2708,
+            0.2716,
+            0.2725,
+            0.2733,
+            0.2742,
+            0.275,
+            0.2759,
+            0.2767,
+            0.2776,
+            0.2784,
+            0.2793,
+            0.2802,
+            0.281,
+            0.2819,
+            0.2827,
+            0.2836,
+            0.2845,
+            0.2853,
+            0.2862,
+            0.2871,
+            0.2879,
+            0.2888,
+            0.2897,
+            0.2905,
+            0.2914,
+            0.2923,
+            0.2931,
+            0.294,
+            0.2949,
+            0.2958,
+            0.2966,
+            0.2975,
+            0.2984,
+            0.2993,
+            0.3001,
+            0.301,
+            0.3019,
+            0.3028,
+            0.3037,
+            0.3045,
+            0.3054,
+            0.3063,
+            0.3072,
+            0.3081,
+            0.309,
+            0.3099,
+            0.3107,
+            0.3116,
+            0.3125,
+            0.3134,
+            0.3143,
+            0.3152,
+            0.3161,
+            0.317,
+            0.3179,
+            0.3188,
+            0.3197,
+            0.3206,
+            0.3215,
+            0.3224,
+            0.3233,
+            0.3242,
+            0.3251,
+            0.326,
+            0.3269,
+            0.3278,
+            0.3287,
+            0.3296,
+            0.3305,
+            0.3314,
+            0.3323,
+            0.3332,
+            0.3341,
+            0.335,
+            0.3359,
+            0.3368,
+            0.3377,
+            0.3386,
+            0.3395,
+            0.3405,
+            0.3414,
+            0.3423,
+            0.3432,
+            0.3441,
+            0.345,
+            0.3459,
+            0.3469,
+            0.3478,
+            0.3487,
+            0.3496,
+            0.3505,
+            0.3514,
+            0.3524,
+            0.3533,
+            0.3542,
+            0.3551,
+            0.356,
+            0.357,
+            0.3579,
+            0.3588,
+            0.3597,
+            0.3606,
+            0.3616,
+            0.3625,
+            0.3634,
+            0.3643,
+            0.3653,
+            0.3662,
+            0.3671,
+            0.3681,
+            0.369,
+            0.3699,
+            0.3708,
+            0.3718,
+            0.3727,
+            0.3736,
+            0.3746,
+            0.3755,
+            0.3764,
+            0.3773,
+            0.3783,
+            0.3792,
+            0.3801,
+            0.3811,
+            0.382,
+            0.3829,
+            0.3839,
+            0.3848,
+            0.3857,
+            0.3867,
+            0.3876,
+            0.3885,
+            0.3895,
+            0.3904,
+            0.3914,
+            0.3923,
+            0.3932,
+            0.3942,
+            0.3951,
+            0.396,
+            0.397,
+            0.3979,
+            0.3989,
+            0.3998,
+            0.4007,
+            0.4017,
+            0.4026,
+            0.4036,
+            0.4045,
+            0.4054,
+            0.4064,
+            0.4073,
+            0.4083,
+            0.4092,
+            0.4101,
+            0.4111,
+            0.412,
+            0.413,
+            0.4139,
+            0.4148,
+            0.4158,
+            0.4167,
+            0.4177,
+            0.4186,
+            0.4196,
+            0.4205,
+            0.4215,
+            0.4224,
+            0.4233,
+            0.4243,
+            0.4252,
+            0.4262,
+            0.4271,
+            0.4281,
+            0.429,
+            0.4299,
+            0.4309,
+            0.4318,
+            0.4328,
+            0.4337,
+            0.4347,
+            0.4356,
+            0.4366,
+            0.4375,
+            0.4384,
+            0.4394,
+            0.4403,
+            0.4413,
+            0.4422,
+            0.4432,
+            0.4441,
+            0.4451,
+            0.446,
+            0.447,
+            0.4479,
+            0.4488,
+            0.4498,
+            0.4507,
+            0.4517,
+            0.4526,
+            0.4536,
+            0.4545,
+            0.4555,
+            0.4564,
+            0.4573,
+            0.4583,
+            0.4592,
+            0.4602,
+            0.4611,
+            0.4621,
+            0.463,
+            0.464,
+            0.4649,
+            0.4658,
+            0.4668,
+            0.4677,
+            0.4687,
+            0.4696,
+            0.4706,
+            0.4715,
+            0.4724,
+            0.4734,
+            0.4743,
+            0.4753,
+            0.4762,
+            0.4772,
+            0.4781,
+            0.479,
+            0.48,
+            0.4809,
+            0.4819,
+            0.4828,
+            0.4837,
+            0.4847,
+            0.4856,
+            0.4866,
+            0.4875,
+            0.4884,
+            0.4894,
+            0.4903,
+            0.4913,
+            0.4922,
+            0.4931,
+            0.4941,
+            0.495,
+            0.496,
+            0.4969,
+            0.4978,
+            0.4988,
+            0.4997,
+            0.5006,
+            0.5016,
+            0.5025,
+            0.5034,
+            0.5044,
+            0.5053,
+            0.5062,
+            0.5072,
+            0.5081,
+            0.509,
+            0.51,
+            0.5109,
+            0.5118,
+            0.5128,
+            0.5137,
+            0.5146,
+            0.5156,
+            0.5165,
+            0.5174,
+            0.5184,
+            0.5193,
+            0.5202,
+            0.5211,
+            0.5221,
+            0.523,
+            0.5239,
+            0.5248,
+            0.5258,
+            0.5267,
+            0.5276,
+            0.5285,
+            0.5295,
+            0.5304,
+            0.5313,
+            0.5322,
+            0.5332,
+            0.5341,
+            0.535,
+            0.5359,
+            0.5368,
+            0.5378,
+            0.5387,
+            0.5396,
+            0.5405,
+            0.5414,
+            0.5424,
+            0.5433,
+            0.5442,
+            0.5451,
+            0.546,
+            0.5469,
+            0.5479,
+            0.5488,
+            0.5497,
+            0.5506,
+            0.5515,
+            0.5524,
+            0.5533,
+            0.5542,
+            0.5551,
+            0.5561,
+            0.557,
+            0.5579,
+            0.5588,
+            0.5597,
+            0.5606,
+            0.5615,
+            0.5624,
+            0.5633,
+            0.5642,
+            0.5651,
+            0.566,
+            0.5669,
+            0.5678,
+            0.5687,
+            0.5696,
+            0.5705,
+            0.5714,
+            0.5723,
+            0.5732,
+            0.5741,
+            0.575,
+            0.5759,
+            0.5768,
+            0.5777,
+            0.5786,
+            0.5795,
+            0.5804,
+            0.5813,
+            0.5821,
+            0.583,
+            0.5839,
+            0.5848,
+            0.5857,
+            0.5866,
+            0.5875,
+            0.5884,
+            0.5892,
+            0.5901
+        ]
+    }
+}
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/output_dedup_pairs.stats	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,438 @@
+total	1992
+total_unmapped	914
+total_single_sided_mapped	287
+total_mapped	791
+total_dups	9
+total_nodups	782
+cis	597
+trans	185
+pair_types/NN	853
+pair_types/UU	782
+pair_types/NU	234
+pair_types/MU	53
+pair_types/MM	40
+pair_types/NM	21
+pair_types/DD	9
+cis_1kb+	185
+cis_2kb+	171
+cis_4kb+	151
+cis_10kb+	114
+cis_20kb+	80
+cis_40kb+	46
+summary/frac_cis	0.7634271099744245
+summary/frac_cis_1kb+	0.23657289002557544
+summary/frac_cis_2kb+	0.2186700767263427
+summary/frac_cis_4kb+	0.19309462915601022
+summary/frac_cis_10kb+	0.14578005115089515
+summary/frac_cis_20kb+	0.10230179028132992
+summary/frac_cis_40kb+	0.058823529411764705
+summary/frac_dups	0.011378002528445006
+summary/complexity_naive	34495.88583157276
+summary/dist_freq_convergence/convergence_dist	1333521
+summary/dist_freq_convergence/strands_w_max_convergence_dist	++
+summary/dist_freq_convergence/convergence_rel_diff_threshold	0.05
+summary/dist_freq_convergence/n_cis_pairs_below_convergence_dist/++	49
+summary/dist_freq_convergence/n_cis_pairs_below_convergence_dist/--	58
+summary/dist_freq_convergence/n_cis_pairs_below_convergence_dist/-+	65
+summary/dist_freq_convergence/n_cis_pairs_below_convergence_dist/+-	425
+summary/dist_freq_convergence/n_cis_pairs_below_convergence_dist_all_strands	597
+summary/dist_freq_convergence/n_cis_pairs_above_convergence_dist_all_strands	0
+summary/dist_freq_convergence/frac_cis_in_cis_below_convergence_dist/++	0.08207705192629816
+summary/dist_freq_convergence/frac_cis_in_cis_below_convergence_dist/--	0.09715242881072027
+summary/dist_freq_convergence/frac_cis_in_cis_below_convergence_dist/-+	0.10887772194304858
+summary/dist_freq_convergence/frac_cis_in_cis_below_convergence_dist/+-	0.711892797319933
+summary/dist_freq_convergence/frac_cis_in_cis_below_convergence_dist_all_strands	1.0
+summary/dist_freq_convergence/frac_cis_in_cis_above_convergence_dist_all_strands	0.0
+summary/dist_freq_convergence/frac_total_mapped_in_cis_below_convergence_dist/++	0.061946902654867256
+summary/dist_freq_convergence/frac_total_mapped_in_cis_below_convergence_dist/--	0.07332490518331226
+summary/dist_freq_convergence/frac_total_mapped_in_cis_below_convergence_dist/-+	0.08217446270543616
+summary/dist_freq_convergence/frac_total_mapped_in_cis_below_convergence_dist/+-	0.5372945638432364
+summary/dist_freq_convergence/frac_total_mapped_in_cis_below_convergence_dist_all_strands	0.754740834386852
+summary/dist_freq_convergence/frac_total_mapped_in_cis_above_convergence_dist_all_strands	0.0
+summary/dist_freq_convergence/frac_total_nodups_in_cis_below_convergence_dist/++	0.06265984654731457
+summary/dist_freq_convergence/frac_total_nodups_in_cis_below_convergence_dist/--	0.0741687979539642
+summary/dist_freq_convergence/frac_total_nodups_in_cis_below_convergence_dist/-+	0.08312020460358056
+summary/dist_freq_convergence/frac_total_nodups_in_cis_below_convergence_dist/+-	0.5434782608695652
+summary/dist_freq_convergence/frac_total_nodups_in_cis_below_convergence_dist_all_strands	0.7634271099744245
+summary/dist_freq_convergence/frac_total_nodups_in_cis_above_convergence_dist_all_strands	0.0
+chrom_freq/chrIV/chrIV	83
+chrom_freq/chrVII/chrVII	55
+chrom_freq/chrXV/chrXV	53
+chrom_freq/chrXIII/chrXIII	46
+chrom_freq/chrII/chrII	41
+chrom_freq/chrXVI/chrXVI	40
+chrom_freq/chrXIV/chrXIV	37
+chrom_freq/chrX/chrX	37
+chrom_freq/chrXII/chrXII	36
+chrom_freq/chrXI/chrXI	36
+chrom_freq/chrM/chrM	33
+chrom_freq/chrVIII/chrVIII	30
+chrom_freq/chrIX/chrIX	22
+chrom_freq/chrV/chrV	21
+chrom_freq/chrIII/chrIII	12
+chrom_freq/chrVI/chrVI	8
+chrom_freq/chrI/chrI	7
+chrom_freq/chrVII/chrXV	6
+chrom_freq/chrIV/chrXII	6
+chrom_freq/chrIV/chrXIII	6
+chrom_freq/chrVII/chrXII	6
+chrom_freq/chrII/chrVII	5
+chrom_freq/chrXII/chrXIII	5
+chrom_freq/chrIV/chrX	5
+chrom_freq/chrX/chrXIV	4
+chrom_freq/chrII/chrIV	4
+chrom_freq/chrII/chrXVI	4
+chrom_freq/chrXIV/chrXVI	4
+chrom_freq/chrII/chrXIV	4
+chrom_freq/chrVII/chrXIV	4
+chrom_freq/chrXI/chrXV	4
+chrom_freq/chrXI/chrXII	4
+chrom_freq/chrIV/chrVII	4
+chrom_freq/chrXIII/chrXV	3
+chrom_freq/chrXI/chrXVI	3
+chrom_freq/chrII/chrXIII	3
+chrom_freq/chrXI/chrXIII	3
+chrom_freq/chrVII/chrIX	3
+chrom_freq/chrVIII/chrXIII	3
+chrom_freq/chrX/chrXII	3
+chrom_freq/chrX/chrXIII	3
+chrom_freq/chrXIII/chrXIV	3
+chrom_freq/chrV/chrXVI	3
+chrom_freq/chrIV/chrV	3
+chrom_freq/chrIV/chrVIII	3
+chrom_freq/chrIV/chrXI	3
+chrom_freq/chrIV/chrXV	3
+chrom_freq/chrIV/chrXVI	3
+chrom_freq/chrXV/chrXVI	3
+chrom_freq/chrIX/chrXII	3
+chrom_freq/chrXIII/chrXVI	2
+chrom_freq/chrX/chrXVI	2
+chrom_freq/chrIV/chrVI	2
+chrom_freq/chrIV/chrXIV	2
+chrom_freq/chrXI/chrXIV	2
+chrom_freq/chrVII/chrXVI	2
+chrom_freq/chrIX/chrX	2
+chrom_freq/chrVII/chrVIII	2
+chrom_freq/chrIII/chrX	2
+chrom_freq/chrIX/chrXV	2
+chrom_freq/chrIII/chrV	2
+chrom_freq/chrXIV/chrXV	2
+chrom_freq/chrXII/chrXV	2
+chrom_freq/chrV/chrX	2
+chrom_freq/chrI/chrX	2
+chrom_freq/chrII/chrXV	2
+chrom_freq/chrII/chrVIII	1
+chrom_freq/chrXII/chrXIV	1
+chrom_freq/chrXII/chrXVI	1
+chrom_freq/chrII/chrX	1
+chrom_freq/chrI/chrXV	1
+chrom_freq/chrIII/chrXIII	1
+chrom_freq/chrII/chrXI	1
+chrom_freq/chrVI/chrX	1
+chrom_freq/chrIII/chrVIII	1
+chrom_freq/chrIX/chrXI	1
+chrom_freq/chrV/chrM	1
+chrom_freq/chrV/chrVI	1
+chrom_freq/chrV/chrXI	1
+chrom_freq/chrV/chrXIII	1
+chrom_freq/chrV/chrXIV	1
+chrom_freq/chrV/chrXV	1
+chrom_freq/chrVI/chrXI	1
+chrom_freq/chrVIII/chrXV	1
+chrom_freq/chrVI/chrXII	1
+chrom_freq/chrVI/chrXIII	1
+chrom_freq/chrVI/chrXIV	1
+chrom_freq/chrVI/chrXVI	1
+chrom_freq/chrVII/chrXIII	1
+chrom_freq/chrVIII/chrIX	1
+chrom_freq/chrVIII/chrXI	1
+chrom_freq/chrVIII/chrXII	1
+chrom_freq/chrVI/chrVII	1
+dist_freq/0-1/+-	0
+dist_freq/0-1/-+	0
+dist_freq/0-1/--	0
+dist_freq/0-1/++	0
+dist_freq/1-2/+-	0
+dist_freq/1-2/-+	0
+dist_freq/1-2/--	0
+dist_freq/1-2/++	0
+dist_freq/2-3/+-	0
+dist_freq/2-3/-+	0
+dist_freq/2-3/--	0
+dist_freq/2-3/++	0
+dist_freq/3-4/+-	0
+dist_freq/3-4/-+	0
+dist_freq/3-4/--	0
+dist_freq/3-4/++	0
+dist_freq/4-6/+-	0
+dist_freq/4-6/-+	1
+dist_freq/4-6/--	0
+dist_freq/4-6/++	1
+dist_freq/6-7/+-	0
+dist_freq/6-7/-+	0
+dist_freq/6-7/--	0
+dist_freq/6-7/++	0
+dist_freq/7-10/+-	0
+dist_freq/7-10/-+	0
+dist_freq/7-10/--	0
+dist_freq/7-10/++	0
+dist_freq/10-13/+-	0
+dist_freq/10-13/-+	0
+dist_freq/10-13/--	0
+dist_freq/10-13/++	0
+dist_freq/13-18/+-	0
+dist_freq/13-18/-+	0
+dist_freq/13-18/--	0
+dist_freq/13-18/++	0
+dist_freq/18-24/+-	0
+dist_freq/18-24/-+	0
+dist_freq/18-24/--	0
+dist_freq/18-24/++	0
+dist_freq/24-32/+-	0
+dist_freq/24-32/-+	0
+dist_freq/24-32/--	0
+dist_freq/24-32/++	0
+dist_freq/32-42/+-	0
+dist_freq/32-42/-+	0
+dist_freq/32-42/--	0
+dist_freq/32-42/++	0
+dist_freq/42-56/+-	0
+dist_freq/42-56/-+	0
+dist_freq/42-56/--	0
+dist_freq/42-56/++	0
+dist_freq/56-75/+-	0
+dist_freq/56-75/-+	0
+dist_freq/56-75/--	0
+dist_freq/56-75/++	0
+dist_freq/75-100/+-	0
+dist_freq/75-100/-+	1
+dist_freq/75-100/--	0
+dist_freq/75-100/++	0
+dist_freq/100-133/+-	1
+dist_freq/100-133/-+	0
+dist_freq/100-133/--	1
+dist_freq/100-133/++	0
+dist_freq/133-178/+-	6
+dist_freq/133-178/-+	2
+dist_freq/133-178/--	1
+dist_freq/133-178/++	0
+dist_freq/178-237/+-	116
+dist_freq/178-237/-+	3
+dist_freq/178-237/--	0
+dist_freq/178-237/++	0
+dist_freq/237-316/+-	218
+dist_freq/237-316/-+	6
+dist_freq/237-316/--	1
+dist_freq/237-316/++	0
+dist_freq/316-422/+-	32
+dist_freq/316-422/-+	3
+dist_freq/316-422/--	0
+dist_freq/316-422/++	0
+dist_freq/422-562/+-	2
+dist_freq/422-562/-+	4
+dist_freq/422-562/--	0
+dist_freq/422-562/++	0
+dist_freq/562-750/+-	1
+dist_freq/562-750/-+	3
+dist_freq/562-750/--	0
+dist_freq/562-750/++	0
+dist_freq/750-1000/+-	0
+dist_freq/750-1000/-+	8
+dist_freq/750-1000/--	0
+dist_freq/750-1000/++	1
+dist_freq/1000-1334/+-	0
+dist_freq/1000-1334/-+	1
+dist_freq/1000-1334/--	2
+dist_freq/1000-1334/++	0
+dist_freq/1334-1778/+-	0
+dist_freq/1334-1778/-+	4
+dist_freq/1334-1778/--	4
+dist_freq/1334-1778/++	1
+dist_freq/1778-2371/+-	1
+dist_freq/1778-2371/-+	4
+dist_freq/1778-2371/--	1
+dist_freq/1778-2371/++	0
+dist_freq/2371-3162/+-	4
+dist_freq/2371-3162/-+	3
+dist_freq/2371-3162/--	1
+dist_freq/2371-3162/++	0
+dist_freq/3162-4217/+-	1
+dist_freq/3162-4217/-+	2
+dist_freq/3162-4217/--	3
+dist_freq/3162-4217/++	3
+dist_freq/4217-5623/+-	3
+dist_freq/4217-5623/-+	2
+dist_freq/4217-5623/--	3
+dist_freq/4217-5623/++	1
+dist_freq/5623-7499/+-	6
+dist_freq/5623-7499/-+	2
+dist_freq/5623-7499/--	6
+dist_freq/5623-7499/++	2
+dist_freq/7499-10000/+-	3
+dist_freq/7499-10000/-+	2
+dist_freq/7499-10000/--	3
+dist_freq/7499-10000/++	3
+dist_freq/10000-13335/+-	5
+dist_freq/10000-13335/-+	1
+dist_freq/10000-13335/--	3
+dist_freq/10000-13335/++	6
+dist_freq/13335-17783/+-	2
+dist_freq/13335-17783/-+	3
+dist_freq/13335-17783/--	5
+dist_freq/13335-17783/++	4
+dist_freq/17783-23714/+-	5
+dist_freq/17783-23714/-+	0
+dist_freq/17783-23714/--	4
+dist_freq/17783-23714/++	4
+dist_freq/23714-31623/+-	4
+dist_freq/23714-31623/-+	4
+dist_freq/23714-31623/--	4
+dist_freq/23714-31623/++	1
+dist_freq/31623-42170/+-	4
+dist_freq/31623-42170/-+	2
+dist_freq/31623-42170/--	3
+dist_freq/31623-42170/++	6
+dist_freq/42170-56234/+-	2
+dist_freq/42170-56234/-+	2
+dist_freq/42170-56234/--	4
+dist_freq/42170-56234/++	4
+dist_freq/56234-74989/+-	2
+dist_freq/56234-74989/-+	0
+dist_freq/56234-74989/--	4
+dist_freq/56234-74989/++	2
+dist_freq/74989-100000/+-	0
+dist_freq/74989-100000/-+	1
+dist_freq/74989-100000/--	1
+dist_freq/74989-100000/++	3
+dist_freq/100000-133352/+-	1
+dist_freq/100000-133352/-+	0
+dist_freq/100000-133352/--	0
+dist_freq/100000-133352/++	2
+dist_freq/133352-177828/+-	2
+dist_freq/133352-177828/-+	1
+dist_freq/133352-177828/--	1
+dist_freq/133352-177828/++	0
+dist_freq/177828-237137/+-	2
+dist_freq/177828-237137/-+	0
+dist_freq/177828-237137/--	2
+dist_freq/177828-237137/++	2
+dist_freq/237137-316228/+-	1
+dist_freq/237137-316228/-+	0
+dist_freq/237137-316228/--	0
+dist_freq/237137-316228/++	1
+dist_freq/316228-421697/+-	0
+dist_freq/316228-421697/-+	0
+dist_freq/316228-421697/--	0
+dist_freq/316228-421697/++	0
+dist_freq/421697-562341/+-	0
+dist_freq/421697-562341/-+	0
+dist_freq/421697-562341/--	0
+dist_freq/421697-562341/++	1
+dist_freq/562341-749894/+-	1
+dist_freq/562341-749894/-+	0
+dist_freq/562341-749894/--	0
+dist_freq/562341-749894/++	1
+dist_freq/749894-1000000/+-	0
+dist_freq/749894-1000000/-+	0
+dist_freq/749894-1000000/--	0
+dist_freq/749894-1000000/++	0
+dist_freq/1000000-1333521/+-	0
+dist_freq/1000000-1333521/-+	0
+dist_freq/1000000-1333521/--	1
+dist_freq/1000000-1333521/++	0
+dist_freq/1333521-1778279/+-	0
+dist_freq/1333521-1778279/-+	0
+dist_freq/1333521-1778279/--	0
+dist_freq/1333521-1778279/++	0
+dist_freq/1778279-2371374/+-	0
+dist_freq/1778279-2371374/-+	0
+dist_freq/1778279-2371374/--	0
+dist_freq/1778279-2371374/++	0
+dist_freq/2371374-3162278/+-	0
+dist_freq/2371374-3162278/-+	0
+dist_freq/2371374-3162278/--	0
+dist_freq/2371374-3162278/++	0
+dist_freq/3162278-4216965/+-	0
+dist_freq/3162278-4216965/-+	0
+dist_freq/3162278-4216965/--	0
+dist_freq/3162278-4216965/++	0
+dist_freq/4216965-5623413/+-	0
+dist_freq/4216965-5623413/-+	0
+dist_freq/4216965-5623413/--	0
+dist_freq/4216965-5623413/++	0
+dist_freq/5623413-7498942/+-	0
+dist_freq/5623413-7498942/-+	0
+dist_freq/5623413-7498942/--	0
+dist_freq/5623413-7498942/++	0
+dist_freq/7498942-10000000/+-	0
+dist_freq/7498942-10000000/-+	0
+dist_freq/7498942-10000000/--	0
+dist_freq/7498942-10000000/++	0
+dist_freq/10000000-13335214/+-	0
+dist_freq/10000000-13335214/-+	0
+dist_freq/10000000-13335214/--	0
+dist_freq/10000000-13335214/++	0
+dist_freq/13335214-17782794/+-	0
+dist_freq/13335214-17782794/-+	0
+dist_freq/13335214-17782794/--	0
+dist_freq/13335214-17782794/++	0
+dist_freq/17782794-23713737/+-	0
+dist_freq/17782794-23713737/-+	0
+dist_freq/17782794-23713737/--	0
+dist_freq/17782794-23713737/++	0
+dist_freq/23713737-31622777/+-	0
+dist_freq/23713737-31622777/-+	0
+dist_freq/23713737-31622777/--	0
+dist_freq/23713737-31622777/++	0
+dist_freq/31622777-42169650/+-	0
+dist_freq/31622777-42169650/-+	0
+dist_freq/31622777-42169650/--	0
+dist_freq/31622777-42169650/++	0
+dist_freq/42169650-56234133/+-	0
+dist_freq/42169650-56234133/-+	0
+dist_freq/42169650-56234133/--	0
+dist_freq/42169650-56234133/++	0
+dist_freq/56234133-74989421/+-	0
+dist_freq/56234133-74989421/-+	0
+dist_freq/56234133-74989421/--	0
+dist_freq/56234133-74989421/++	0
+dist_freq/74989421-100000000/+-	0
+dist_freq/74989421-100000000/-+	0
+dist_freq/74989421-100000000/--	0
+dist_freq/74989421-100000000/++	0
+dist_freq/100000000-133352143/+-	0
+dist_freq/100000000-133352143/-+	0
+dist_freq/100000000-133352143/--	0
+dist_freq/100000000-133352143/++	0
+dist_freq/133352143-177827941/+-	0
+dist_freq/133352143-177827941/-+	0
+dist_freq/133352143-177827941/--	0
+dist_freq/133352143-177827941/++	0
+dist_freq/177827941-237137371/+-	0
+dist_freq/177827941-237137371/-+	0
+dist_freq/177827941-237137371/--	0
+dist_freq/177827941-237137371/++	0
+dist_freq/237137371-316227766/+-	0
+dist_freq/237137371-316227766/-+	0
+dist_freq/237137371-316227766/--	0
+dist_freq/237137371-316227766/++	0
+dist_freq/316227766-421696503/+-	0
+dist_freq/316227766-421696503/-+	0
+dist_freq/316227766-421696503/--	0
+dist_freq/316227766-421696503/++	0
+dist_freq/421696503-562341325/+-	0
+dist_freq/421696503-562341325/-+	0
+dist_freq/421696503-562341325/--	0
+dist_freq/421696503-562341325/++	0
+dist_freq/562341325-749894209/+-	0
+dist_freq/562341325-749894209/-+	0
+dist_freq/562341325-749894209/--	0
+dist_freq/562341325-749894209/++	0
+dist_freq/749894209-1000000000/+-	0
+dist_freq/749894209-1000000000/-+	0
+dist_freq/749894209-1000000000/--	0
+dist_freq/749894209-1000000000/++	0
+dist_freq/1000000000+/+-	0
+dist_freq/1000000000+/-+	0
+dist_freq/1000000000+/--	0
+dist_freq/1000000000+/++	0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/porechop.log	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,153 @@
+
+Loading reads
+/tmp/tmp4zxnky4h/files/5/c/1/dataset_5c125cad-e633-41bc-8f37-36d6af3f5f0f.dat
+9 reads loaded
+
+
+Looking for known adapter sets
+
0 / 9 (0.0%)
9 / 9 (100.0%)
9 / 9 (100.0%)
+                                        Best               
+                                        read       Best    
+                                        start      read end
+  Set                                   %ID        %ID     
+  SQK-NSK007                                96.4       95.5
+  Rapid                                     62.5        0.0
+  RBK004_upstream                           72.7        0.0
+  SQK-MAP006                                62.2       63.6
+  SQK-MAP006 short                          60.7       60.0
+  PCR adapters 1                            66.7       73.9
+  PCR adapters 2                            66.7       63.6
+  PCR adapters 3                            68.0       72.0
+  1D^2 part 1                               62.1       58.8
+  1D^2 part 2                               79.4       68.8
+  cDNA SSP                                  57.1       61.4
+  Barcode 1 (reverse)                       59.4       66.7
+  Barcode 2 (reverse)                       66.7       63.0
+  Barcode 3 (reverse)                       69.2       72.0
+  Barcode 4 (reverse)                       66.7       63.3
+  Barcode 5 (reverse)                       62.5       66.7
+  Barcode 6 (reverse)                       73.1       62.5
+  Barcode 7 (reverse)                       65.4       65.5
+  Barcode 8 (reverse)                       69.2       58.3
+  Barcode 9 (reverse)                       75.0       66.7
+  Barcode 10 (reverse)                      62.5       60.0
+  Barcode 11 (reverse)                      69.2       60.5
+  Barcode 12 (reverse)                      65.6       64.0
+  Barcode 1 (forward)                       65.4       61.5
+  Barcode 2 (forward)                       69.2       70.4
+  Barcode 3 (forward)                       73.1       68.0
+  Barcode 4 (forward)                       73.1       64.3
+  Barcode 5 (forward)                       62.5       66.7
+  Barcode 6 (forward)                       65.5       65.6
+  Barcode 7 (forward)                       73.1       66.7
+  Barcode 8 (forward)                       62.1       60.7
+  Barcode 9 (forward)                       68.0       70.8
+  Barcode 10 (forward)                      69.2       66.7
+  Barcode 11 (forward)                      65.4       60.7
+  Barcode 12 (forward)                      64.3       66.7
+  Barcode 13 (forward)                      64.3       69.2
+  Barcode 14 (forward)                      63.3       66.7
+  Barcode 15 (forward)                      66.7       66.7
+  Barcode 16 (forward)                      70.8       65.5
+  Barcode 17 (forward)                      69.2       66.7
+  Barcode 18 (forward)                      70.4       70.4
+  Barcode 19 (forward)                      65.5       64.0
+  Barcode 20 (forward)                      65.5       64.0
+  Barcode 21 (forward)                      64.3       66.7
+  Barcode 22 (forward)                      69.2       68.0
+  Barcode 23 (forward)                      61.5       66.7
+  Barcode 24 (forward)                      66.7       65.4
+  Barcode 25 (forward)                      64.0       65.5
+  Barcode 26 (forward)                      72.0       72.0
+  Barcode 27 (forward)                      77.8       60.7
+  Barcode 28 (forward)                      65.5       66.7
+  Barcode 29 (forward)                      62.5       66.7
+  Barcode 30 (forward)                      68.0       65.4
+  Barcode 31 (forward)                      62.5       69.2
+  Barcode 32 (forward)                      68.0       70.8
+  Barcode 33 (forward)                      62.5       70.4
+  Barcode 34 (forward)                      64.0       62.5
+  Barcode 35 (forward)                      65.5       65.4
+  Barcode 36 (forward)                      63.0       63.0
+  Barcode 37 (forward)                      67.9       64.3
+  Barcode 38 (forward)                      64.0       62.1
+  Barcode 39 (forward)                      64.0       69.2
+  Barcode 40 (forward)                      62.5       64.0
+  Barcode 41 (forward)                      68.0       65.5
+  Barcode 42 (forward)                      70.4       69.2
+  Barcode 43 (forward)                      63.3       63.3
+  Barcode 44 (forward)                      60.0       66.7
+  Barcode 45 (forward)                      73.1       65.4
+  Barcode 46 (forward)                      65.4       60.7
+  Barcode 47 (forward)                      65.5       64.0
+  Barcode 48 (forward)                      71.4       62.1
+  Barcode 49 (forward)                      69.2       62.1
+  Barcode 50 (forward)                      66.7       63.0
+  Barcode 51 (forward)                      69.2       64.3
+  Barcode 52 (forward)                      66.7       64.0
+  Barcode 53 (forward)                      67.9       69.0
+  Barcode 54 (forward)                      69.2       64.0
+  Barcode 55 (forward)                      66.7       73.1
+  Barcode 56 (forward)                      66.7       72.0
+  Barcode 57 (forward)                      69.0       60.0
+  Barcode 58 (forward)                      70.4       72.0
+  Barcode 59 (forward)                      56.7       66.7
+  Barcode 60 (forward)                      66.7       66.7
+  Barcode 61 (forward)                      70.8       65.5
+  Barcode 62 (forward)                      66.7       68.0
+  Barcode 63 (forward)                      66.7       60.7
+  Barcode 64 (forward)                      69.2       66.7
+  Barcode 65 (forward)                      61.5       69.0
+  Barcode 66 (forward)                      64.3       63.0
+  Barcode 67 (forward)                      66.7       67.9
+  Barcode 68 (forward)                      67.9       69.2
+  Barcode 69 (forward)                      69.2       75.0
+  Barcode 70 (forward)                      64.3       73.1
+  Barcode 71 (forward)                      64.0       71.4
+  Barcode 72 (forward)                      66.7       62.1
+  Barcode 73 (forward)                      67.7       64.0
+  Barcode 74 (forward)                      64.5       68.0
+  Barcode 75 (forward)                      65.4       65.5
+  Barcode 76 (forward)                      70.4       70.8
+  Barcode 77 (forward)                      65.4       64.3
+  Barcode 78 (forward)                      67.7       63.0
+  Barcode 79 (forward)                      70.8       69.2
+  Barcode 80 (forward)                      71.4       72.0
+  Barcode 81 (forward)                      68.0       66.7
+  Barcode 82 (forward)                      64.7       66.7
+  Barcode 83 (forward)                      69.2       68.0
+  Barcode 84 (forward)                      70.8       67.9
+  Barcode 85 (forward)                      61.5       60.0
+  Barcode 86 (forward)                      64.3       65.4
+  Barcode 87 (forward)                      66.7       65.4
+  Barcode 88 (forward)                      63.3       60.7
+  Barcode 89 (forward)                      69.2       66.7
+  Barcode 90 (forward)                      66.7       64.0
+  Barcode 91 (forward)                      68.0       64.3
+  Barcode 92 (forward)                      65.5       68.0
+  Barcode 93 (forward)                      69.2       73.1
+  Barcode 94 (forward)                      63.0       68.0
+  Barcode 95 (forward)                      64.0       63.3
+  Barcode 96 (forward)                      69.0       68.0
+
+
+Trimming adapters from read ends
+     SQK-NSK007_Y_Top: AATGTACTTCGTTCAGTTACGTATTGCT
+  SQK-NSK007_Y_Bottom: GCAATACGTAACTGAACGAAGT
+
+
0 / 9 (0.0%)
9 / 9 (100.0%)
9 / 9 (100.0%)
+
+4 / 9 reads had adapters trimmed from their start (74 bp removed)
+3 / 9 reads had adapters trimmed from their end (49 bp removed)
+
+
+Splitting reads containing middle adapters
+
0 / 9 (0.0%)
9 / 9 (100.0%)
10 / 9 (111.1%)
9 / 9 (100.0%)
+
+4 / 9 reads were split based on middle adapters
+
+
+Saving trimmed reads to file
+
+Saved result to /tmp/tmp4zxnky4h/job_working_directory/000/2/working/out.fasta
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/snippy.txt	Tue Feb 18 23:17:45 2025 +0000
@@ -0,0 +1,5 @@
+ID	LENGTH	ALIGNED	UNALIGNED	VARIANT	HET	MASKED	LOWCOV
+a	700	51	649	0	0	0	0
+b	700	51	649	1	0	0	0
+c	700	51	649	1	0	0	0
+Reference	700	700	0	0	0	0	0