Mercurial > repos > iuc > hal_hal2fasta
diff hal_hal2fasta.xml @ 0:90503ee992eb draft default tip
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/main/tools/haltools commit 6244b9d15a5ad97ae20191e2f8fbafe2050c3cac
| author | iuc |
|---|---|
| date | Fri, 06 Feb 2026 10:33:50 +0000 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/hal_hal2fasta.xml Fri Feb 06 10:33:50 2026 +0000 @@ -0,0 +1,185 @@ +<tool id="hal_hal2fasta" name="hal2fasta" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> + <description>exports sequences from HAL to FASTA</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <expand macro="stdio"/> + <command detect_errors="aggressive"><![CDATA[ + hal2fasta + #if $mode.export == 'default': + --start $mode.start + --length $mode.length + #else if $mode.export == '--sequence': + --sequence '$mode.sequence' + --start $mode.start + --length $mode.length + #else if $mode.export == '--subtree': + --subtree + #end if + --lineWidth $lineWidth + $upper + $ucscSequenceNames + '$input_hal' '$refGenome' > temp.fasta + #if $compression.type == 'gz': + && gzip -c temp.fasta > '$out_file' + #else if $compression.type == 'bz2': + && bzip2 -c temp.fasta > '$out_file' + #else: + && mv temp.fasta '$out_file' + #end if + ]]></command> + <inputs> + <expand macro="input_hal"/> + <expand macro="params_refGenome"/> + <conditional name="mode"> + <param name="export" type="select" label="Export options"> + <option value="default" selected="true">Export full reference genome (default)</option> + <option value="--sequence">Export a reference sequence (--sequence)</option> + <option value="--subtree">Export all genomes in the reference genome subtree (--subtree)</option> + </param> + <when value="default"> + <expand macro="params_start"/> + <expand macro="params_length"/> + </when> + <when value="--subtree"/> + <when value="--sequence"> + <expand macro="params_sequence"/> + <expand macro="params_start"/> + <expand macro="params_length"/> + </when> + </conditional> + <param argument="--upper" type="boolean" truevalue="--upper" falsevalue="" checked="false" label="Uppercase bases" help="Convert all bases to uppercase"/> + <param argument="--ucscSequenceNames" type="boolean" truevalue="--ucscSequenceNames" falsevalue="" checked="false" label="Use UCSC convention" help="Use the UCSC convention of Genome.Sequence for names. By default, only sequence names are used"/> + <param argument="--lineWidth" type="integer" min="1" value="80" label="Line width" help="Line width for output"/> + <expand macro="params_conditional_compression"/> + </inputs> + <outputs> + <data name="out_file" format="fasta" label="${tool.name} on ${on_string}: Genome FASTA"> + <change_format> + <when input="compression.type" value="gz" format="fasta.gz"/> + <when input="compression.type" value="bz2" format="fasta.bz2"/> + </change_format> + </data> + </outputs> + <tests> + <test expect_num_outputs="1"> + <param name="input_hal" value="halTest.hal"/> + <param name="refGenome" value="Genome_0"/> + <output name="out_file" ftype="fasta"> + <assert_contents> + <has_line line=">Genome_0_seq"/> + <has_line line="CCCGTAACCCAATCCACGGTGCCGGCGGCGAGATGTATTGTCTGGGCGCAAAGCCATTTCGCCACCACATGCTGCGCGAC"/> + <has_n_lines n="23"/> + </assert_contents> + </output> + </test> + <test expect_num_outputs="1"> + <param name="input_hal" value="halTest.hal"/> + <param name="refGenome" value="Genome_0"/> + <conditional name="compression"> + <param name="type" value="gz"/> + </conditional> + <output name="out_file" ftype="fasta.gz" file="hal2fasta_output.fasta.gz"/> + </test> + <test expect_num_outputs="1"> + <param name="input_hal" value="halTest.hal"/> + <param name="refGenome" value="Genome_0"/> + <conditional name="compression"> + <param name="type" value="bz2"/> + </conditional> + <output name="out_file" ftype="fasta.bz2" file="hal2fasta_output.fasta.bz2"/> + </test> + <test expect_num_outputs="1"> + <param name="input_hal" value="halTest.hal"/> + <param name="refGenome" value="Genome_0"/> + <param name="lineWidth" value="40"/> + <param name="upper" value="true"/> + <output name="out_file" ftype="fasta"> + <assert_contents> + <has_line line=">Genome_0_seq"/> + <has_line line="TGCCGCGCGTGAGGTTGACACTCCGTTCGTGTTACATGTC"/> + <has_n_lines n="45"/> + </assert_contents> + </output> + </test> + <test expect_num_outputs="1"> + <param name="input_hal" value="halTest.hal"/> + <param name="refGenome" value="Genome_0"/> + <conditional name="mode"> + <param name="export" value="--sequence"/> + <param name="sequence" value="Genome_0_seq"/> + </conditional> + <output name="out_file" ftype="fasta"> + <assert_contents> + <has_line line=">Genome_0_seq"/> + <has_line line="CCCGTAACCCAATCCACGGTGCCGGCGGCGAGATGTATTGTCTGGGCGCAAAGCCATTTCGCCACCACATGCTGCGCGAC"/> + <has_n_lines n="23"/> + </assert_contents> + </output> + </test> + <test expect_num_outputs="1"> + <param name="input_hal" value="halTest.hal"/> + <param name="refGenome" value="Genome_0"/> + <conditional name="mode"> + <param name="export" value="--subtree"/> + </conditional> + <output name="out_file" ftype="fasta"> + <assert_contents> + <has_line line=">Genome_0_seq"/> + <has_line line=">Genome_1_seq"/> + <has_line line=">Genome_2_seq"/> + <has_line line=">Genome_3_seq"/> + <has_line line="CCCGTAACCCAATCCACGGTGCCGGCGGCGAGATGTATTGTCTGGGCGCAAAGCCATTTCGCCACCACATGCTGCGCGAC"/> + <has_n_lines n="226"/> + </assert_contents> + </output> + </test> + <test expect_num_outputs="1"> + <param name="input_hal" value="halTest.hal"/> + <param name="refGenome" value="Genome_2"/> + <conditional name="mode"> + <param name="export" value="--sequence"/> + <param name="sequence" value="Genome_2_seq"/> + <param name="start" value="50"/> + <param name="length" value="10"/> + </conditional> + <param name="ucscSequenceNames" value="true"/> + <output name="out_file" ftype="fasta"> + <assert_contents> + <has_line line=">Genome_2.Genome_2_seq"/> + <has_line line="GAGGTTGACA"/> + <has_n_lines n="2"/> + </assert_contents> + </output> + </test> + <!-- + Does not pass currently due to a bug - that was fixed but not avalaible as release yet (16.12.2025) + https://github.com/ComparativeGenomicsToolkit/hal/issues/324 + + <test expect_num_outputs="1"> + <param name="input_hal" value="halTest.hal"/> + <param name="genome" value="Genome_0"/> + <conditional name="mode"> + <param name="export" value="default"/> + <param name="start" value="50"/> + <param name="length" value="10"/> + </conditional> + <param name="ucscSequenceNames" value="true"/> + <output name="out_file" ftype="fasta"> + <assert_contents> + <has_line line=">Genome_0.Genome_0_seq"/> + <has_line line="GAGGTTGACA"/> + </assert_contents> + </output> + </test> + --> + </tests> + <help><![CDATA[ +hal2fasta exports sequence data from an input HAL file to an output FASTA file. +It can export a full genome, a single sequence of that genome, or all genomes in the entire subtree rooted of that genome. +When exporting the full genome or a single sequence of that genome, the exported range can be limited using start and length. + ]]></help> + <expand macro="citation"/> + <expand macro="creator"/> +</tool> \ No newline at end of file