Mercurial > repos > iuc > hal_hal2fasta
comparison hal_hal2fasta.xml @ 0:90503ee992eb draft default tip
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/main/tools/haltools commit 6244b9d15a5ad97ae20191e2f8fbafe2050c3cac
| author | iuc |
|---|---|
| date | Fri, 06 Feb 2026 10:33:50 +0000 |
| parents | |
| children |
comparison
equal
deleted
inserted
replaced
| -1:000000000000 | 0:90503ee992eb |
|---|---|
| 1 <tool id="hal_hal2fasta" name="hal2fasta" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> | |
| 2 <description>exports sequences from HAL to FASTA</description> | |
| 3 <macros> | |
| 4 <import>macros.xml</import> | |
| 5 </macros> | |
| 6 <expand macro="requirements"/> | |
| 7 <expand macro="stdio"/> | |
| 8 <command detect_errors="aggressive"><![CDATA[ | |
| 9 hal2fasta | |
| 10 #if $mode.export == 'default': | |
| 11 --start $mode.start | |
| 12 --length $mode.length | |
| 13 #else if $mode.export == '--sequence': | |
| 14 --sequence '$mode.sequence' | |
| 15 --start $mode.start | |
| 16 --length $mode.length | |
| 17 #else if $mode.export == '--subtree': | |
| 18 --subtree | |
| 19 #end if | |
| 20 --lineWidth $lineWidth | |
| 21 $upper | |
| 22 $ucscSequenceNames | |
| 23 '$input_hal' '$refGenome' > temp.fasta | |
| 24 #if $compression.type == 'gz': | |
| 25 && gzip -c temp.fasta > '$out_file' | |
| 26 #else if $compression.type == 'bz2': | |
| 27 && bzip2 -c temp.fasta > '$out_file' | |
| 28 #else: | |
| 29 && mv temp.fasta '$out_file' | |
| 30 #end if | |
| 31 ]]></command> | |
| 32 <inputs> | |
| 33 <expand macro="input_hal"/> | |
| 34 <expand macro="params_refGenome"/> | |
| 35 <conditional name="mode"> | |
| 36 <param name="export" type="select" label="Export options"> | |
| 37 <option value="default" selected="true">Export full reference genome (default)</option> | |
| 38 <option value="--sequence">Export a reference sequence (--sequence)</option> | |
| 39 <option value="--subtree">Export all genomes in the reference genome subtree (--subtree)</option> | |
| 40 </param> | |
| 41 <when value="default"> | |
| 42 <expand macro="params_start"/> | |
| 43 <expand macro="params_length"/> | |
| 44 </when> | |
| 45 <when value="--subtree"/> | |
| 46 <when value="--sequence"> | |
| 47 <expand macro="params_sequence"/> | |
| 48 <expand macro="params_start"/> | |
| 49 <expand macro="params_length"/> | |
| 50 </when> | |
| 51 </conditional> | |
| 52 <param argument="--upper" type="boolean" truevalue="--upper" falsevalue="" checked="false" label="Uppercase bases" help="Convert all bases to uppercase"/> | |
| 53 <param argument="--ucscSequenceNames" type="boolean" truevalue="--ucscSequenceNames" falsevalue="" checked="false" label="Use UCSC convention" help="Use the UCSC convention of Genome.Sequence for names. By default, only sequence names are used"/> | |
| 54 <param argument="--lineWidth" type="integer" min="1" value="80" label="Line width" help="Line width for output"/> | |
| 55 <expand macro="params_conditional_compression"/> | |
| 56 </inputs> | |
| 57 <outputs> | |
| 58 <data name="out_file" format="fasta" label="${tool.name} on ${on_string}: Genome FASTA"> | |
| 59 <change_format> | |
| 60 <when input="compression.type" value="gz" format="fasta.gz"/> | |
| 61 <when input="compression.type" value="bz2" format="fasta.bz2"/> | |
| 62 </change_format> | |
| 63 </data> | |
| 64 </outputs> | |
| 65 <tests> | |
| 66 <test expect_num_outputs="1"> | |
| 67 <param name="input_hal" value="halTest.hal"/> | |
| 68 <param name="refGenome" value="Genome_0"/> | |
| 69 <output name="out_file" ftype="fasta"> | |
| 70 <assert_contents> | |
| 71 <has_line line=">Genome_0_seq"/> | |
| 72 <has_line line="CCCGTAACCCAATCCACGGTGCCGGCGGCGAGATGTATTGTCTGGGCGCAAAGCCATTTCGCCACCACATGCTGCGCGAC"/> | |
| 73 <has_n_lines n="23"/> | |
| 74 </assert_contents> | |
| 75 </output> | |
| 76 </test> | |
| 77 <test expect_num_outputs="1"> | |
| 78 <param name="input_hal" value="halTest.hal"/> | |
| 79 <param name="refGenome" value="Genome_0"/> | |
| 80 <conditional name="compression"> | |
| 81 <param name="type" value="gz"/> | |
| 82 </conditional> | |
| 83 <output name="out_file" ftype="fasta.gz" file="hal2fasta_output.fasta.gz"/> | |
| 84 </test> | |
| 85 <test expect_num_outputs="1"> | |
| 86 <param name="input_hal" value="halTest.hal"/> | |
| 87 <param name="refGenome" value="Genome_0"/> | |
| 88 <conditional name="compression"> | |
| 89 <param name="type" value="bz2"/> | |
| 90 </conditional> | |
| 91 <output name="out_file" ftype="fasta.bz2" file="hal2fasta_output.fasta.bz2"/> | |
| 92 </test> | |
| 93 <test expect_num_outputs="1"> | |
| 94 <param name="input_hal" value="halTest.hal"/> | |
| 95 <param name="refGenome" value="Genome_0"/> | |
| 96 <param name="lineWidth" value="40"/> | |
| 97 <param name="upper" value="true"/> | |
| 98 <output name="out_file" ftype="fasta"> | |
| 99 <assert_contents> | |
| 100 <has_line line=">Genome_0_seq"/> | |
| 101 <has_line line="TGCCGCGCGTGAGGTTGACACTCCGTTCGTGTTACATGTC"/> | |
| 102 <has_n_lines n="45"/> | |
| 103 </assert_contents> | |
| 104 </output> | |
| 105 </test> | |
| 106 <test expect_num_outputs="1"> | |
| 107 <param name="input_hal" value="halTest.hal"/> | |
| 108 <param name="refGenome" value="Genome_0"/> | |
| 109 <conditional name="mode"> | |
| 110 <param name="export" value="--sequence"/> | |
| 111 <param name="sequence" value="Genome_0_seq"/> | |
| 112 </conditional> | |
| 113 <output name="out_file" ftype="fasta"> | |
| 114 <assert_contents> | |
| 115 <has_line line=">Genome_0_seq"/> | |
| 116 <has_line line="CCCGTAACCCAATCCACGGTGCCGGCGGCGAGATGTATTGTCTGGGCGCAAAGCCATTTCGCCACCACATGCTGCGCGAC"/> | |
| 117 <has_n_lines n="23"/> | |
| 118 </assert_contents> | |
| 119 </output> | |
| 120 </test> | |
| 121 <test expect_num_outputs="1"> | |
| 122 <param name="input_hal" value="halTest.hal"/> | |
| 123 <param name="refGenome" value="Genome_0"/> | |
| 124 <conditional name="mode"> | |
| 125 <param name="export" value="--subtree"/> | |
| 126 </conditional> | |
| 127 <output name="out_file" ftype="fasta"> | |
| 128 <assert_contents> | |
| 129 <has_line line=">Genome_0_seq"/> | |
| 130 <has_line line=">Genome_1_seq"/> | |
| 131 <has_line line=">Genome_2_seq"/> | |
| 132 <has_line line=">Genome_3_seq"/> | |
| 133 <has_line line="CCCGTAACCCAATCCACGGTGCCGGCGGCGAGATGTATTGTCTGGGCGCAAAGCCATTTCGCCACCACATGCTGCGCGAC"/> | |
| 134 <has_n_lines n="226"/> | |
| 135 </assert_contents> | |
| 136 </output> | |
| 137 </test> | |
| 138 <test expect_num_outputs="1"> | |
| 139 <param name="input_hal" value="halTest.hal"/> | |
| 140 <param name="refGenome" value="Genome_2"/> | |
| 141 <conditional name="mode"> | |
| 142 <param name="export" value="--sequence"/> | |
| 143 <param name="sequence" value="Genome_2_seq"/> | |
| 144 <param name="start" value="50"/> | |
| 145 <param name="length" value="10"/> | |
| 146 </conditional> | |
| 147 <param name="ucscSequenceNames" value="true"/> | |
| 148 <output name="out_file" ftype="fasta"> | |
| 149 <assert_contents> | |
| 150 <has_line line=">Genome_2.Genome_2_seq"/> | |
| 151 <has_line line="GAGGTTGACA"/> | |
| 152 <has_n_lines n="2"/> | |
| 153 </assert_contents> | |
| 154 </output> | |
| 155 </test> | |
| 156 <!-- | |
| 157 Does not pass currently due to a bug - that was fixed but not avalaible as release yet (16.12.2025) | |
| 158 https://github.com/ComparativeGenomicsToolkit/hal/issues/324 | |
| 159 | |
| 160 <test expect_num_outputs="1"> | |
| 161 <param name="input_hal" value="halTest.hal"/> | |
| 162 <param name="genome" value="Genome_0"/> | |
| 163 <conditional name="mode"> | |
| 164 <param name="export" value="default"/> | |
| 165 <param name="start" value="50"/> | |
| 166 <param name="length" value="10"/> | |
| 167 </conditional> | |
| 168 <param name="ucscSequenceNames" value="true"/> | |
| 169 <output name="out_file" ftype="fasta"> | |
| 170 <assert_contents> | |
| 171 <has_line line=">Genome_0.Genome_0_seq"/> | |
| 172 <has_line line="GAGGTTGACA"/> | |
| 173 </assert_contents> | |
| 174 </output> | |
| 175 </test> | |
| 176 --> | |
| 177 </tests> | |
| 178 <help><![CDATA[ | |
| 179 hal2fasta exports sequence data from an input HAL file to an output FASTA file. | |
| 180 It can export a full genome, a single sequence of that genome, or all genomes in the entire subtree rooted of that genome. | |
| 181 When exporting the full genome or a single sequence of that genome, the exported range can be limited using start and length. | |
| 182 ]]></help> | |
| 183 <expand macro="citation"/> | |
| 184 <expand macro="creator"/> | |
| 185 </tool> |
