Mercurial > repos > greg > gmap
changeset 0:aab7154e8d50 default tip
Uploaded
author | greg |
---|---|
date | Tue, 08 Nov 2011 15:23:51 -0500 |
parents | |
children | |
files | gmap-72ab00e732c3/.hg_archival.txt gmap-72ab00e732c3/gmap/README gmap-72ab00e732c3/gmap/gmap.xml gmap-72ab00e732c3/gmap/gmap_build.xml gmap-72ab00e732c3/gmap/gsnap.xml gmap-72ab00e732c3/gmap/iit_store.xml gmap-72ab00e732c3/gmap/lib/galaxy/datatypes/gmap.py gmap-72ab00e732c3/gmap/snpindex.xml gmap-72ab00e732c3/tool-data/gmap_indices.loc.sample |
diffstat | 9 files changed, 2105 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gmap-72ab00e732c3/.hg_archival.txt Tue Nov 08 15:23:51 2011 -0500 @@ -0,0 +1,5 @@ +repo: d58d272914e7e7da99c097334899ffd6b60b4ab6 +node: 72ab00e732c306395e6f4d3b890ae81039418627 +branch: default +latesttag: null +latesttagdistance: 4
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gmap-72ab00e732c3/gmap/README Tue Nov 08 15:23:51 2011 -0500 @@ -0,0 +1,60 @@ +GMAP applications and citation info are available from: http://research-pub.gene.com/gmap/ + + + Installation instructions are in the README file in the download, + and online: http://research-pub.gene.com/gmap/src/README + + These galaxy tools assume gmap is configured and built with goby support. + These tools were consistent with gmap version: 2011-10-07 + + +GMAP and GSNAP use added datatypes: + + add datatype definition file: lib/galaxy/datatypes/gmap.py + + add the following import line to: lib/galaxy/datatypes/registry.py + import gmap # added for gmap tools + + add to datatypes_conf.xml + <!-- Start GMAP Datatypes --> + <datatype extension="gmapdb" type="galaxy.datatypes.gmap:GmapDB" display_in_upload="False"/> + <datatype extension="gmapsnpindex" type="galaxy.datatypes.gmap:GmapSnpIndex" display_in_upload="False"/> + <datatype extension="iit" type="galaxy.datatypes.gmap:IntervalIndexTree" display_in_upload="True"/> + <datatype extension="splicesites.iit" type="galaxy.datatypes.gmap:SpliceSitesIntervalIndexTree" display_in_upload="True"/> + <datatype extension="introns.iit" type="galaxy.datatypes.gmap:IntronsIntervalIndexTree" display_in_upload="True"/> + <datatype extension="snps.iit" type="galaxy.datatypes.gmap:SNPsIntervalIndexTree" display_in_upload="True"/> + <datatype extension="gmap_annotation" type="galaxy.datatypes.gmap:IntervalAnnotation" display_in_upload="False"/> + <datatype extension="gmap_splicesites" type="galaxy.datatypes.gmap:SpliceSiteAnnotation" display_in_upload="True"/> + <datatype extension="gmap_introns" type="galaxy.datatypes.gmap:IntronAnnotation" display_in_upload="True"/> + <datatype extension="gmap_snps" type="galaxy.datatypes.gmap:SNPAnnotation" display_in_upload="True"/> + <!-- End GMAP tools --> + +Tools: + GMAP_Build - create a GmapDB set of index files for a reference sequence and optional set of annotations + GMAP - map sequences to a reference sequence GmapDB index + GSNAP - align sequences to a reference and detect splicing + + Add to tool_conf.xml ( probably in the "NGS: Mapping" section ) + <tool file="gmap/gmap.xml" /> + <tool file="gmap/gsnap.xml" /> + <tool file="gmap/gmap_build.xml" /> + <tool file="gmap/snpindex.xml" /> + <tool file="gmap/iit_store.xml" /> + +Admin built cached gmapdb indexes defined in tool-data/gmap_indices.loc + + +TODO: + Add classes to gmap.py + CmetIndex - an index created by cmetindex + AtoiIndex - an index created by atoiindex + + Possibly add Tools: + get_genome - retrieves from a gmapdb + cmetindex - create methylcytosine index + atoiindex - create A-to-I RNA editing index + + + + +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gmap-72ab00e732c3/gmap/gmap.xml Tue Nov 08 15:23:51 2011 -0500 @@ -0,0 +1,442 @@ +<tool id="gmap" name="GMAP" version="2.0.0"> + <description>Genomic Mapping and Alignment Program for mRNA and EST sequences</description> + <requirements> + <requirement type="binary">gmap</requirement> + <!-- proposed tag for added datatype dependencies --> + <requirement type="datatype">gmapdb</requirement> + <requirement type="datatype">gmap_annotation</requirement> + <requirement type="datatype">gmap_splicesites</requirement> + <requirement type="datatype">gmap_introns</requirement> + <requirement type="datatype">gmap_snps</requirement> + </requirements> + <version_string>gmap --version</version_string> + <command> + #import os,os.path + gmap + --nthreads=4 --ordered + #if $refGenomeSource.genomeSource == "history": + --gseg=$refGenomeSource.ownFile + #elif $refGenomeSource.genomeSource == "gmapdb": + #set $gmapdb = $os.listdir($refGenomeSource.gmapdb.extra_files_path)[0] + --dir=$refGenomeSource.gmapdb.extra_files_path --db=$gmapdb + #if $refGenomeSource.kmer != None and len($refGenomeSource.kmer.__str__) == 2: + --kmer=$refGenomeSource.kmer + #end if + #else: + --dir=$os.path.dirname($refGenomeSource.gmapindex.value) --db=$os.path.basename($refGenomeSource.gmapindex.value) + #if $refGenomeSource.kmer != None and len($refGenomeSource.kmer.__str__) == 2: + --kmer=$refGenomeSource.kmer + #end if + #end if + #if $result.format == "summary": + --summary + #elif $result.format == "align": + --align + #elif $result.format == "continuous": + --continuous + #elif $result.format == "continuous-by-exon": + --continuous-by-exon + #elif $result.format == "compress": + --compress + #elif $result.format == "exons_dna": + --exons=cdna + #elif $result.format == "exons_gen": + --exons=genomic + #elif $result.format == "protein_dna": + --protein_dna + #elif $result.format == "protein_gen": + --protein_gen + #elif $result.format == "sam": + --format=$result.sam_paired_read + $result.no_sam_headers + #if len($result.noncanonical_splices.__str__) > 0 + --noncanonical-splices=$result.noncanonical_splices + #end if + #if len($result.read_group_id.__str__) > 0 + --read-group-id=$result.read_group_id + #end if + #if len($result.read_group_name.__str__) > 0 + --read-group-name=$result.read_group_name + #end if + #if len($result.read_group_library.__str__) > 0 + --read-group-library=$result.read_group_library + #end if + #if len($result.read_group_platform.__str__) > 0 + --read-group-platform=$result.read_group_platform + #end if + #elif $result.format != "gmap": + --format=$result.format + #end if + #if $computation.options == "advanced": + $computation.nosplicing + $computation.cross_species + --min-intronlength=$computation.min_intronlength + --intronlength=$computation.intronlength + --localsplicedist=$computation.localsplicedist + --totallength=$computation.totallength + --trimendexons=$computation.trimendexons + --direction=$computation.direction + --canonical-mode=$computation.canonical + --prunelevel=$computation.prunelevel + --allow-close-indels=$computation.allow_close_indels + --microexon-spliceprob=$computation.microexon_spliceprob + #if int($computation.chimera_margin) >= 0: + --chimera-margin=$computation.chimera_margin + #end if + #end if + #if $advanced.options == "used": + #if int($advanced.npaths) >= 0: + --npaths=$advanced.npaths + #end if + #if int($advanced.chimera_overlap) > 0: + --chimera_overlap=$advanced.chimera_overlap + #end if + $advanced.protein + $advanced.tolerant + $advanced.nolengths + $advanced.invertmode + #if int($advanced.introngap) > 0: + --introngap=$advanced.introngap + #end if + #if int($advanced.wraplength) > 0: + --wraplength=$advanced.wraplength + #end if + #end if + #if $split_output == True + $split_output + #end if + #if len($quality_protocol.__str__) > 0: + --quality-protocol=$quality_protocol + #end if + $input + #for $i in $inputs: + ${i.added_input} + #end for + #if $split_output == True + 2> $gmap_stderr + #else + 2> $gmap_stderr > $output + #end if + </command> + <inputs> + <!-- Input data --> + <param name="input" type="data" format="fasta,fastqsanger,fastqillumina" label="<H2>Input Sequences</H2>Select an mRNA or EST dataset to map" /> + <repeat name="inputs" title="addtional mRNA or EST dataset to map"> + <param name="added_input" type="data" format="fasta,fastqsanger,fastqillumina" label=""/> + </repeat> + <param name="quality_protocol" type="select" label="Protocol for input quality scores"> + <option value="">No quality scores</option> + <option value="sanger">Sanger quality scores</option> + <option value="illumina">Illumina quality scores</option> + </param> + + <!-- GMAPDB for mapping --> + <conditional name="refGenomeSource"> + <param name="genomeSource" type="select" label="<HR><H2>Map To</H2>Will you map to a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> + <option value="indexed">Use a built-in index</option> + <option value="gmapdb">Use gmapdb from the history</option> + <option value="history">Use a fasta reference sequence from the history</option> + </param> + <when value="indexed"> + <param name="gmapindex" type="select" label="Select a reference genome" help="if your genome of interest is not listed - contact Galaxy team"> + <options from_file="gmap_indices.loc"> + <column name="uid" index="0" /> + <column name="dbkey" index="1" /> + <column name="name" index="2" /> + <column name="kmers" index="3" /> + <column name="maps" index="4" /> + <column name="snps" index="5" /> + <column name="value" index="6" /> + </options> + </param> + <param name="kmer" type="select" data_ref="gmapindex" label="kmer size" help="Defaults to highest available kmer size"> + <options from_file="gmap_indices.loc"> + <column name="name" index="3"/> + <column name="value" index="3"/> + <filter type="param_value" ref="gmapindex" column="6"/> + <filter type="multiple_splitter" column="3" separator=","/> + <filter type="add_value" name="" value=""/> + <filter type="sort_by" column="3"/> + </options> + </param> + <param name="map" type="select" data_ref="gmapindex" label="Look for splicing involving known sites or known introns" help=""> + <options from_file="gmap_indices.loc"> + <column name="name" index="4"/> + <column name="value" index="4"/> + <filter type="param_value" ref="gmapindex" column="6"/> + <filter type="multiple_splitter" column="4" separator=","/> + <filter type="add_value" name="" value=""/> + <filter type="sort_by" column="4"/> + </options> + </param> + </when> + <when value="gmapdb"> + <param name="gmapdb" type="data" format="gmapdb" metadata_name="dbkey" label="Select a gmapdb" + help="A GMAP database built with GMAP Build"/> + <param name="kmer" type="select" data_ref="gmapdb" label="kmer size" help="Defaults to highest available kmer size"> + <options> + <filter type="data_meta" ref="gmapdb" key="kmers" multiple="True" separator=","/> + </options> + </param> + <param name="map" type="select" data_ref="gmapdb" label="Use map for splicing involving known sites or known introns" help=""> + <options> + <filter type="data_meta" ref="gmapdb" key="maps" multiple="True"/> + </options> + </param> + </when> + <when value="history"> + <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" + help="Fasta containing genomic DNA sequence"/> + </when> + </conditional> + + + <!-- Computation options --> + <conditional name="computation"> + <param name="options" type="select" label="<HR>Computational Settings" help=""> + <option value="default">Use default settings</option> + <option value="advanced">Set Computation Options</option> + </param> + <when value="default"/> + <when value="advanced"> + <param name="nosplicing" type="boolean" truevalue="--nosplicing" falsevalue="" checked="false" label="Turn off splicing" help="(useful for aligning genomic sequences onto a genome)"/> + <param name="min_intronlength" type="integer" value="9" label="Min length for one internal intron (default 9)." help="Below this size, a genomic gap will be considered a deletion rather than an intron." /> + <param name="intronlength" type="integer" value="1000000" label="Max length for one intron (default 1000000)" /> + <param name="localsplicedist" type="integer" value="200000" label="Max length for known splice sites at ends of sequence (default 200000)" /> + <param name="totallength" type="integer" value="2400000" label="Max total intron length (default 2400000)" /> + <param name="chimera_margin" type="integer" value="40" label="Amount of unaligned sequence that triggers search for a chimera (default is 40, 0 is off)" /> + <param name="direction" type="select" label="cDNA direction"> + <option value="auto">auto</option> + <option value="sense_force">sense_force</option> + <option value="antisense_force">antisense_force</option> + <option value="sense_filter">sense_filter</option> + <option value="antisense_filter">antisense_filter</option> + </param> + <param name="trimendexons" type="integer" value="12" label="Trim end exons with fewer than given number of matches (in nt, default 12)" /> + <param name="cross_species" type="boolean" truevalue="--cross-species" falsevalue="" checked="false" label="Cross-species alignment" help="For cross-species alignments, use a more sensitive search for canonical splicing"/> + + <param name="canonical" type="select" label="Reward for canonical and semi-canonical introns"> + <option value="1">high reward (default)</option> + <option value="0">low reward</option> + <option value="2">low reward for high-identity sequences</option> + </param> + <param name="allow_close_indels" type="select" label="Allow an insertion and deletion close to each other"> + <option value="1" selected="true">yes (default)</option> + <option value="0">no</option> + <option value="2">only for high-quality alignments</option> + </param> + <param name="microexon_spliceprob" type="float" value="0.90" label="Allow microexons only if one of the splice site probabilities is greater than this value (default 0.90)" > + <validator type="in_range" message="slice probability between 0.00 and 1.00" min="0" max="1"/> + </param> + <param name="prunelevel" type="select" label="Pruning level"> + <option value="0">no pruning (default)</option> + <option value="1">poor sequences</option> + <option value="2">repetitive sequences</option> + <option value="3">poor and repetitive sequences</option> + </param> + <!-- could do this as a config file + <param name="chrsubsetfile" type="data" format="fasta" label="User-supplied chromosome subset file" /> + <param name="chrsubset" type="text" label="Chromosome subset to search" /> + --> + </when> + </conditional> + + <!-- Advanced Settings --> + <conditional name="advanced"> + <param name="options" type="select" label="<HR>Advanced Settings" help=""> + <option value="default">Use default settings</option> + <option value="used">Set Options</option> + </param> + <when value="default"/> + <when value="used"> + <param name="nolengths" type="boolean" checked="false" truevalue="--nolengths=true" falsevalue="" label="No intron lengths in alignment"/> + <param name="invertmode" type="select" label=" Mode for alignments to genomic (-) strand" help=""> + <option value="">Don't invert the cDNA (default)</option> + <option value="--invertmode=1">Invert cDNA and print genomic (-) strand</option> + <option value="--invertmode=2">Invert cDNA and print genomic (+) strand</option> + </param> + <param name="introngap" type="integer" value="3" label="Nucleotides to show on each end of intron (default=3)" /> + <param name="wraplength" type="integer" value="50" label="Line Wrap length for alignment (default=50)" /> + <param name="npaths" type="integer" value="-1" optional="true" + label="Maximum number of paths to show. Ignored if negative. If 0, prints two paths if chimera detected, else one." /> + <param name="chimera_overlap" type="integer" value="0" label="Overlap to show, if any, at chimera breakpoint" /> + <param name="tolerant" type="boolean" checked="false" truevalue="--tolerant=true" falsevalue="" + label="Translates cDNA with corrections for frameshifts"/> + <param name="protein" type="select" label="Protein alignment" help=""> + <option value="">default</option> + <option value="--fulllength=true">Assume full-length protein, starting with Met</option> + <option value="--truncate=true">Truncate alignment around full-length protein, Met to Stop</option> + </param> + </when> + </conditional> + + <!-- Output data --> + <conditional name="result"> + <param name="format" type="select" label="<HR><H2>Output</H2>Select the output format" help=""> + <option value="gmap">GMAP default output</option> + <option value="summary">Summary of alignments</option> + <option value="align">Alignment</option> + <option value="continuous">Alignment in three continuous lines</option> + <option value="continuous-by-exon">Alignment in three lines per exon</option> + <option value="compress">Print output in compressed format</option> + <option value="exons_dna">Print exons cDNA</option> + <option value="exons_gen">Print exons genomic</option> + <option value="protein_dna">Print protein sequence (cDNA)</option> + <option value="protein_gen">Print protein sequence (genomic)</option> + <option value="psl">PSL (BLAT) format</option> + <option value="gff3_gene">GFF3 gene format</option> + <option value="gff3_match_cdna">GFF3 match cDNA format</option> + <option value="gff3_match_est">GFF3 match EST format</option> + <option value="splicesites">splicesites output (for GSNAP)</option> + <option value="introns">introns output (for GSNAP)</option> + <option value="map_exons">IIT FASTA exon map format</option> + <option value="map_genes">IIT FASTA map format</option> + <option value="coords">coords in table format</option> + <option value="sam" selected="true">SAM format</option> + </param> + <when value="gmap"/> + <when value="summary"/> + <when value="align"> + + </when> + <when value="continuous"> + </when> + <when value="continuous-by-exon"> + </when> + <when value="compress"/> + <when value="exons_dna"/> + <when value="exons_gen"/> + <when value="protein_dna"/> + <when value="protein_gen"/> + <when value="psl"/> + <when value="gff3_gene"/> + <when value="gff3_match_cdna"/> + <when value="gff3_match_est"/> + <when value="splicesites"/> + <when value="introns"/> + <when value="map_exons"/> + <when value="map_genes"/> + <when value="coords"/> + <when value="sam"> + <param name="sam_paired_read" type="boolean" truevalue="sampe" falsevalue="samse" checked="false" label="SAM paired reads"/> + <param name="no_sam_headers" type="boolean" truevalue="--no-sam-headers" falsevalue="" checked="false" label="Do not print headers beginning with '@'"/> + <param name="noncanonical_splices" type="select" label="Print non-canonical genomic gaps greater than 20 nt in CIGAR string as STRING."> + <option value="">Use default</option> + <option value="N">N</option> + <option value="D">D</option> + </param> + <param name="read_group_id" type="text" value="" label="Value to put into read-group id (RG-ID) field"/> + <param name="read_group_name" type="text" value="" label="Value to put into read-group name (RG-SM) field"/> + <param name="read_group_library" type="text" value="" label="Value to put into read-group library (RG-LB) field"/> + <param name="read_group_platform" type="text" value="" label="Value to put into read-group library platform (RG-PL) field"/> + </when> + </conditional> <!-- name="result" --> + + <param name="split_output" type="boolean" truevalue="--split-output=gmap_out" falsevalue="" checked="false" label="Separate outputs for nomapping, uniq, mult, and chimera" help="(chimera only when chimera-margin is selected)"/> + + + <!-- + map=iitfile Map file. If argument is '?' (with the quotes), this lists available map files. + mapexons Map each exon separately + mapboth Report hits from both strands of genome + flanking=INT Show flanking hits (default 0) + print-comment Show comment line for each hit + --> + + + </inputs> + <outputs> + <data format="txt" name="gmap_stderr" label="${tool.name} on ${on_string}: stderr"/> + <data format="txt" name="output" label="${tool.name} on ${on_string} ${result.format}" > + <filter>(split_output == False)</filter> + <change_format> + <when input="result['format']" value="gff3_gene" format="gff3"/> + <when input="result['format']" value="gff3_match_cdna" format="gff3"/> + <when input="result['format']" value="gff3_match_est" format="gff3"/> + <when input="result['format']" value="sam" format="sam"/> + <when input="result['format']" value="splicesites" format="gmap_splicesites"/> + <when input="result['format']" value="introns" format="gmap_introns"/> + <when input="result['format']" value="map_genes" format="gmap_annotation"/> + <when input="result['format']" value="map_exons" format="gmap_annotation"/> + </change_format> + </data> + <data format="txt" name="uniq" label="${tool.name} on ${on_string} uniq.${result.format}" from_work_dir="gmap_out.uniq"> + <filter>(split_output == True)</filter> + <change_format> + <when input="result['format']" value="gff3_gene" format="gff3"/> + <when input="result['format']" value="gff3_match_cdna" format="gff3"/> + <when input="result['format']" value="gff3_match_est" format="gff3"/> + <when input="result['format']" value="sam" format="sam"/> + <when input="result['format']" value="splicesites" format="gmap_splicesites"/> + <when input="result['format']" value="introns" format="gmap_introns"/> + <when input="result['format']" value="map_genes" format="gmap_annotation"/> + <when input="result['format']" value="map_exons" format="gmap_annotation"/> + </change_format> + </data> + <data format="txt" name="transloc" label="${tool.name} on ${on_string} transloc.${result.format}" from_work_dir="gmap_out.transloc"> + <filter>(split_output == True)</filter> + <change_format> + <when input="result['format']" value="gff3_gene" format="gff3"/> + <when input="result['format']" value="gff3_match_cdna" format="gff3"/> + <when input="result['format']" value="gff3_match_est" format="gff3"/> + <when input="result['format']" value="sam" format="sam"/> + <when input="result['format']" value="splicesites" format="gmap_splicesites"/> + <when input="result['format']" value="introns" format="gmap_introns"/> + <when input="result['format']" value="map_genes" format="gmap_annotation"/> + <when input="result['format']" value="map_exons" format="gmap_annotation"/> + </change_format> + </data> + <data format="txt" name="nomapping" label="${tool.name} on ${on_string} nomapping.${result.format}" from_work_dir="gmap_out.nomapping"> + <filter>(split_output == True)</filter> + <change_format> + <when input="result['format']" value="gff3_gene" format="gff3"/> + <when input="result['format']" value="gff3_match_cdna" format="gff3"/> + <when input="result['format']" value="gff3_match_est" format="gff3"/> + <when input="result['format']" value="sam" format="sam"/> + <when input="result['format']" value="splicesites" format="gmap_splicesites"/> + <when input="result['format']" value="introns" format="gmap_introns"/> + <when input="result['format']" value="map_genes" format="gmap_annotation"/> + <when input="result['format']" value="map_exons" format="gmap_annotation"/> + </change_format> + </data> + <data format="txt" name="mult" label="${tool.name} on ${on_string} mult.${result.format}" from_work_dir="gmap_out.mult"> + <filter>(split_output == True)</filter> + <change_format> + <when input="result['format']" value="gff3_gene" format="gff3"/> + <when input="result['format']" value="gff3_match_cdna" format="gff3"/> + <when input="result['format']" value="gff3_match_est" format="gff3"/> + <when input="result['format']" value="sam" format="sam"/> + <when input="result['format']" value="splicesites" format="gmap_splicesites"/> + <when input="result['format']" value="introns" format="gmap_introns"/> + <when input="result['format']" value="map_genes" format="gmap_annotation"/> + <when input="result['format']" value="map_exons" format="gmap_annotation"/> + </change_format> + </data> + </outputs> + <tests> + </tests> + + <help> + +**What it does** + +GMAP_ (Genomic Mapping and Alignment Program) The functionality provided by gmap allows a user to: (1) map and align a single cDNA interactively against a large genome in about a second, without the startup time of several minutes typically needed by existing mapping programs; (2) switch arbitrarily among different genomes, without the need for a preloaded server dedicated to each genome; (3) run the program on computers with as little as 128 MB of RAM (random access memory); (4) perform high-throughput batch processing of cDNAs by using memory mapping and multithreading when appropriate memory and hardware are available; (5) generate accurate gene models, even in the presence of substantial polymorphisms and sequence errors; (6) locate splice sites accurately without the use of probabilistic splice site models, allowing generalized use of the program across species; (7) detect statistically significant microexons and incorporate them into the alignment; and (8) handle mapping and alignment tasks on genomes having alternate assemblies, linkage groups or strains. It is developed by Thomas D. Wu of Genentech, Inc. + +Publication_ citation: Thomas D. Wu, Colin K. Watanabe Bioinformatics 2005 21(9):1859-1875; doi:10.1093/bioinformatics/bti310 + +.. _GMAP: http://research-pub.gene.com/gmap/ +.. _Publication: http://bioinformatics.oxfordjournals.org/cgi/content/full/21/9/1859 + +------ + +**Know what you are doing** + +.. class:: warningmark + +You will want to read the README_ + +.. _README: http://research-pub.gene.com/gmap/src/README + + </help> +</tool> +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gmap-72ab00e732c3/gmap/gmap_build.xml Tue Nov 08 15:23:51 2011 -0500 @@ -0,0 +1,177 @@ +<tool id="gmap_build" name="GMAP Build" version="2.0.0"> + <description>a database genome index for GMAP and GSNAP</description> + <requirements> + <requirement type="binary">gmap_build</requirement> + <!-- proposed tag for added datatype dependencies --> + <requirement type="datatype">gmapdb</requirement> + <requirement type="datatype">gmap_snps</requirement> + </requirements> + <version_string>gmap --version</version_string> + <command interpreter="command"> /bin/bash $shscript 2>1 1> $output </command> + <inputs> + <!-- Name for this gmapdb --> + <param name="refname" type="text" label="Name you want to give this gmap database" help=""> + <validator type="empty_field" message="A database name is required."/> + </param> + <!-- Input data --> + <repeat name="inputs" title="Reference Sequence" min="1"> + <param name="input" type="data" format="fasta" label="reference sequence fasta" /> + </repeat> + + <param name="kmer" type="select" multiple="true" force_select="true" label="kmer size" help=""> + <option value="12">12</option> + <option value="13">13</option> + <option value="14">14</option> + <option value="15" selected="true">15</option> + </param> + <param name="cmetindex" type="boolean" checked="true" truevalue="yes" falsevalue="no" label="Create cmetindex to process reads from bisulfite-treated DNA"/> + <param name="atoiindex" type="boolean" checked="true" truevalue="yes" falsevalue="no" label="Create atoiindex to process reads under RNA-editing tolerance"/> + <conditional name="splicesite"> + <param name="splice_source" type="select" label="Add splice and intron info from" > + <option value="none"></option> + <option value="refGeneTable">refGenes table from UCSC table browser</option> + <option value="gtf">GTF</option> + <option value="gff3">GFF3</option> + </param> + <when value="none"/> + <when value="refGeneTable"> + <param name="refGenes" type="data" format="tabular" optional="true" label="UCSC refGenes table" help="Example: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/refGene.txt.gz" /> + <param name="col_skip" type="integer" value="1" label="Columns to skip before the id/name column (default 1)" + help="Note that alignment tracks in UCSC sometimes have an extra column on the left."> + <validator type="in_range" message="The number of colmumns to skip must >= 0." min="0."/> + </param> + + </when> + <when value="gtf"> + <param name="gtfGenes" type="data" format="gtf" optional="true" label="Genes as GTF" help="" /> + </when> + <when value="gff3"> + <param name="gff3Genes" type="data" format="gff3" optional="true" label="Genes in GFF3 format" help="" /> + </when> + </conditional> + <conditional name="dbsnp"> + <param name="snp_source" type="select" label="Add SNP info from" > + <option value="none"></option> + <option value="snpTable">UCSC SNP Table</option> + <option value="snpFile">GMAP SNP File</option> + </param> + <when value="none"/> + <when value="snpTable"> + <param name="snps" type="data" format="tabular" optional="true" label="UCSC SNPs table" help="Example: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/snp130.txt.gz" /> + <param name="snpsex" type="data" format="tabular" optional="true" label="UCSC SNP Exceptions table" help="Example: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/snp130Exceptions.txt.gz" /> + <param name="weight" type="select" label="Include SNPs with at least Confidence Level" help=""> + <option value="1" selected="true">1 (High)</option> + <option value="2">2 (Medium)</option> + <option value="3">3 (All)</option> + </param> + </when> + <when value="snpFile"> + <param name="snps" type="data" format="gmap_snps" optional="true" label="GMAP SNPs file" + help="Format (3 columns): + <br>>rs62211261 21:14379270 CG + <br>>rs62211262 21:14379281 CG + <br>Each line must start with a > character, then be followed by an + identifier (which may have duplicates). Then there should be the + chromosomal coordinate of the SNP. (Coordinates are all 1-based, so + the first character of a chromosome is number 1.) Finally, there + should be the two possible alleles: ( AC AG AT CG CT GT or AN CN GN TN) + <br>These alleles must correspond to the possible nucleotides on the plus strand of the genome. + If the one of these two letters does not match the allele in the reference + sequence, that SNP will be ignored in subsequent processing as a probable error. + The N stands for any other allele." /> + </when> + </conditional> + </inputs> + <outputs> + <!-- + <data format="txt" name="log" label="${tool.name} on ${on_string}: log"/> + --> + <data format="gmapdb" name="output" label="${tool.name} on ${on_string} gmapdb ${refname}" /> + </outputs> + <configfiles> + <configfile name="shscript"> +#!/bin/bash +#set $ds = chr(36) +#set $gt = chr(62) +#set $lt = chr(60) +#set $ad = chr(38) +## #set $ref_files = '' +## #for $i in $inputs: + ## #set $ref_files = $ref_files $i.input +## #end for +## echo $ref_files +#import os.path +#set $gmapdb = $output.extra_files_path +#set $mapsdir = $os.path.join($os.path.join($gmapdb,str($refname)), str($refname) + '.maps') +mkdir -p $gmapdb +## export GMAPDB required for cmetindex and atoiindex +export GMAPDB=$gmapdb +#for $k in $kmer.__str__.split(','): +gmap_build -D $gmapdb -d $refname -s numeric-alpha -k $k #for i in $inputs# ${i.input}#end for# +#end for +get-genome -D $gmapdb -d '?' | sed 's/^Available .*/gmap db: /' +echo "kmers: " $kmer +#if $splicesite.splice_source == 'refGeneTable': +#if $splicesite.refGenes.__str__ != 'None': +cat $splicesite.refGenes | psl_splicesites -s $splicesite.col_skip | iit_store -o $os.path.join($mapsdir,'splicesites') +cat $splicesite.refGenes | psl_introns -s $splicesite.col_skip | iit_store -o $os.path.join($mapsdir,'introns') +#end if +#elif $splicesite.splice_source == 'gtf': +#if $splicesite.gtfGenes.__str__ != 'None': +cat $splicesite.gtfGenes | gtf_splicesites | iit_store -o $os.path.join($mapsdir,'splicesites') +cat $splicesite.gtfGenes | gtf_introns | iit_store -o $os.path.join($mapsdir,'introns') +#end if +#elif $splicesite.splice_source == 'gff3': +#if $splicesite.gff3Genes.__str__ != 'None': +cat $splicesite.gff3Genes | gff3_splicesites | iit_store -o $os.path.join($mapsdir,'splicesites') +cat $splicesite.gff3Genes | gff3_introns | iit_store -o $os.path.join($mapsdir,'introns') +#end if +#end if +#if $dbsnp.snp_source != 'none' and $dbsnp.snps.__str__ != 'None': +#if $dbsnp.snp_source == 'snpTable': +#if $dbsnp.snpsex.__str__ != 'None': +cat $dbsnp.snps | dbsnp_iit -w $dbsnp.weight -e $dbsnp.snpsex | iit_store -o $os.path.join($mapsdir,'snps') +#else: +cat $dbsnp.snps | dbsnp_iit -w $dbsnp.weight | iit_store -o $os.path.join($mapsdir,'snps') +#end if +#else: +cat $dbsnp.snps | iit_store -o $os.path.join($mapsdir,'snps') +#end if +snpindex -d $refname -v snps +echo "snpindex" -d $refname -v snps +#end if +#if $cmetindex.__str__ == 'yes': +cmetindex -d $refname +echo "cmetindex" -d $refname +#end if +#if $atoiindex.__str__ == 'yes': +atoiindex -d $refname +echo "atoiindex" -d $refname +#end if +get-genome -D $gmapdb -d $refname -m '?' | sed 's/^Available maps .*/maps: /' + </configfile> + </configfiles> + + <tests> + </tests> + + <help> + + +**GMAP Build** + +GMAP Build creates an index of a genomic sequence for mapping and alignment using GMAP_ (Genomic Mapping and Alignment Program for mRNA and EST sequences) and GSNAP_ (Genomic Short-read Nucleotide Alignment Program). (GMAP Build uses GMSP commands: gmap_build, iit_store, psl_splicesites, psl_introns, gtf_splicesites, gtf_introns, gff3_splicesites, gff3_introns, dbsnp_iit, snpindex, cmetindex, and atoiindex.) + +You will want to read the README_ + +Publication_ citation: Thomas D. Wu, Colin K. Watanabe Bioinformatics 2005 21(9):1859-1875; doi:10.1093/bioinformatics/bti310 + +.. _GMAP: http://research-pub.gene.com/gmap/ +.. _GSNAP: http://research-pub.gene.com/gmap/ +.. _README: http://research-pub.gene.com/gmap/src/README +.. _Publication: http://bioinformatics.oxfordjournals.org/cgi/content/full/21/9/1859 + + + </help> +</tool> +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gmap-72ab00e732c3/gmap/gsnap.xml Tue Nov 08 15:23:51 2011 -0500 @@ -0,0 +1,658 @@ +<tool id="gsnap" name="GSNAP" version="2.0.0"> + <description>Genomic Short-read Nucleotide Alignment Program</description> + <requirements> + <requirement type="binary">gsnap</requirement> + <!-- proposed tag for added datatype dependencies --> + <requirement type="datatype">gmapdb</requirement> + <requirement type="datatype">gmapsnpindex</requirement> + <requirement type="datatype">splicesites.iit</requirement> + <requirement type="datatype">introns.iit</requirement> + </requirements> + <version_string>gsnap --version</version_string> + <command> + #import os.path, re + gsnap + --nthreads="4" --ordered + #if $refGenomeSource.genomeSource == "gmapdb": + #set $gmapdb = $os.listdir($refGenomeSource.gmapdb.extra_files_path)[0] + --dir=$refGenomeSource.gmapdb.extra_files_path --db=$refGenomeSource.gmapdb.metadata.db_name + #else: + --dir=$os.path.dirname($refGenomeSource.gmapindex.value) --db=$os.path.basename($refGenomeSource.gmapindex.value) + #end if + #if $refGenomeSource.kmer != None and len($refGenomeSource.kmer.__str__) == 2: + --kmer=$refGenomeSource.kmer + #end if + #if $refGenomeSource.use_splicing.src == 'gmapdb': + #if $refGenomeSource.use_splicing.splicemap != None and len($refGenomeSource.use_splicing.splicemap.__str__) > 0: + -s $refGenomeSource.use_splicing.splicemap.value + #end if + #elif $refGenomeSource.use_splicing.src == 'history': + #if $refGenomeSource.use_splicing.splicemap != None and len($refGenomeSource.use_splicing.splicemap.__str__) > 0: + -S $os.path.dirname($refGenomeSource.use_splicing.splicemap) -s $os.path.basename($refGenomeSource.use_splicing.splicemap) + #end if + #end if + #if $refGenomeSource.use_snps.src == 'gmapdb': + #if $refGenomeSource.use_snps.snpindex != None and len($refGenomeSource.use_snps.snpindex.__str__) > 0: + -v $refGenomeSource.use_snps.snpindex.value + #end if + #elif $refGenomeSource.use_snps.src == 'history': + #if $refGenomeSource.use_snps.snpindex != None and len($refGenomeSource.use_snps.snpindex.__str__) > 0: + -V $refGenomeSource.use_snps.snpindex.extra_files_path -v $refGenomeSource.use_snps.snpindex.metadata.snps_name + #end if + #end if + #if $mode.__str__ != '': + --mode=$mode + #end if + #if $computation.options == "advanced": + #if $computation.max_mismatches.__str__ != '': + --max-mismatches=$computation.max_mismatches + #end if + $computation.query_unk_mismatch + $computation.genome_unk_mismatch + #if $computation.terminal_threshold.__str__ != '': + --terminal-threshold=$computation.terminal_threshold + #end if + #if $computation.indel_penalty.__str__ != '': + --indel-penalty=$computation.indel_penalty + #end if + #if $computation.indel_endlength.__str__ != '': + --indel-endlength=$computation.indel_endlength + #end if + #if $computation.max_middle_insertions.__str__ != '': + --max-middle-insertions=$computation.max_middle_insertions + #end if + #if $computation.max_middle_deletions.__str__ != '': + --max-middle-deletions=$computation.max_middle_deletions + #end if + #if $computation.max_end_insertions.__str__ != '': + --max-end-insertions=$computation.max_end_insertions + #end if + #if $computation.max_end_deletions.__str__ != '': + --max-end-deletions=$computation.max_end_deletions + #end if + #if $computation.suboptimal_levels.__str__ != '': + --suboptimal-levels=$computation.suboptimal_levels + #end if + #if $computation.adapter_strip.__str__ != '': + --adapter-strip=$computation.adapter_strip + #end if + ## gmap options + #if $computation.gmap_mode.__str__ != '' and $computation.gmap_mode.__str__ != 'None': + --gmap-mode='$computation.gmap_mode' + #end if + #if $computation.trigger_score_for_gmap.__str__ != '': + --trigger-score-for-gmap=$computation.trigger_score_for_gmap + #end if + #if $computation.max_gmap_pairsearch.__str__ != '' and $re.search("pairsearch",$computation.gmap_mode): + --max-gmap-pairsearch=$computation.max_gmap_pairsearch + #end if + #if $computation.max_gmap_terminal.__str__ != '' and $re.search("terminal",$computation.gmap_mode): + --max-gmap-terminal=$computation.max_gmap_terminal + #end if + #if $computation.max_gmap_improvement.__str__ != '' and $re.search("improv",$computation.gmap_mode): + --max-gmap-improvement=$computation.max_gmap_improvement + #end if + #if $computation.microexon_spliceprob.__str__ != '': + --microexon-spliceprob=$computation.microexon_spliceprob + #end if + #end if + #if $splicing.options == "advanced": + $splicing.novelsplicing + #if $splicing.localsplicedist.__str__ != '': + --localsplicedist=$splicing.localsplicedist + #end if + #if $splicing.local_splice_penalty.__str__ != '': + --local-splice-penalty=$splicing.local_splice_penalty + #end if + #if $splicing.distant_splice_penalty.__str__ != '': + --distant-splice-penalty=$splicing.distant_splice_penalty + #end if + #if $splicing.local_splice_endlength.__str__ != '': + --local-splice-endlength=$splicing.local_splice_endlength + #end if + #if $splicing.distant_splice_endlength.__str__ != '': + --distant-splice-endlength=$splicing.distant_splice_endlength + #end if + #if $splicing.distant_splice_identity.__str__ != '': + --distant-splice-identity=$splicing.distant_splice_identity + #end if + #end if + #if $output.options == "advanced": + #if $output.npath.__str__ != '': + --npath=$output.npath + #end if + $output.quiet_if_excessive + $output.show_refdiff + $output.clip_overlap + #end if + #if $result.format == "sam": + --format=sam + $result.no_sam_headers + #if $result.read_group_id.__str__.strip != '': + --read-group-id='$result.read_group_id' + #end if + #if $result.read_group_name.__str__ != '': + --read-group-name='$result.read_group_name' + #end if + #if $result.read_group_library.__str__ != '': + --read-group-library='$result.read_group_library' + #end if + #if $result.read_group_platform.__str__ != '': + --read-group-platform='$result.read_group_platform' + #end if + #if $result.quality_shift.__str__ != '': + --quality-shift=$result.quality_shift + #end if + #elif $result.format == "goby": + #if $result.goby_output.__str__ != '': + --goby-output='$result.goby_output' + #end if + #if $result.creads_window_start.__str__ != '': + --creads-window-start=$result.creads_window_start + #end if + #if $result.creads_window_end.__str__ != '': + --creads-window-end=$result.creads_window_end + #end if + $result.creads_complement + #end if + ## TODO - do we need these options (Is it tally XOR runlength?): + ## --tallydir= --use-tally=tally + ## --runlengthdir --use-runlength=runlength + #if $seq.format == "gsnap_fasta": + $seq.circularinput $seq.gsnap + #else if $seq.format == "fastq": + #if $seq.barcode_length.__str__ != '': + --barcode-length=$seq.barcode_length + #end if + #if $seq.fastq_id_start.__str__ != '': + --fastq-id-start=$seq.fastq_id_start + #end if + #if $seq.fastq_id_end.__str__ != '': + --fastq-id-end=$seq.fastq_id_end + #end if + #if $seq.filter_chastity.__str__ != 'off': + --filter-chastity=$seq.filter_chastity + #end if + #if $seq.paired.ispaired.__str__ == "yes": + #if $seq.paired.pairmax_dna.__str__ != '': + --pairmax-dna=$seq.paired.pairmax_dna + #end if + #if $seq.paired.pairmax_rna.__str__ != '': + --pairmax-rna=$seq.paired.pairmax_rna + #end if + $seq.fastq $seq.paired.fastq + #else + $seq.fastq + #end if + #end if + #if $split_output == True + 2> $gsnap_stderr + #else + 2> $gsnap_stderr > $results + #end if + + </command> + <inputs> + <!-- Input data --> + <conditional name="seq"> + <param name="format" type="select" label="<H2>Input Sequences</H2>Select the input format" help=""> + <option value="fastq">Fastq</option> + <option value="gsnap_fasta">GNSAP fasta</option> + </param> + <when value="fastq"> + <param name="fastq" type="data" format="fastq" label="Select a fastq dataset" /> + <conditional name="paired"> + <param name="ispaired" type="boolean" truevalue="yes" falsevalue="no" checked="false" label="Paired Reads"/> + <when value="no"/> + <when value="yes"> + <param name="fastq" type="data" format="fastq" label="Select the paired reads reverse dataset" /> + <param name="orientation" type="select" label="Orientation of paired-end reads" help=""> + <option value="FR">fwd-rev, typical Illumina default</option> + <option value="RF">rev-fwd, for circularized inserts</option> + <option value="FF">fwd-fwd, same strand</option> + </param> + <param name="pairmax_dna" type="integer" value="" optional="true" label="Max total genomic length for DNA-Seq paired reads, or other reads without splicing (default 1000)." help="Used if no splice file is provided and novelsplicing is off."/> + <param name="pairmax_rna" type="integer" value="" optional="true" label="Max total genomic length for RNA-Seq paired reads, or other reads that could have a splice (default 200000)." help="Used novelspliceing is specified or a splice file is provided. Should probably match the value for localsplicedist."/> + </when> + </conditional> + <param name="barcode_length" type="integer" value="" optional="true" label="Amount of barcode to remove from start of read (default 0)" /> + <param name="fastq_id_start" type="integer" value="" optional="true" label="Starting field of identifier in FASTQ header, space-delimited, starting from 1" /> + <param name="fastq_id_end" type="integer" value="" optional="true" label="Ending field of identifier in FASTQ header, space-delimited, starting from 1" + help="Examples: + <br>@HWUSI-EAS100R:6:73:941:1973#0/1 + <br> . start=1, end=1 (default) => identifier is HWUSI-EAS100R:6:73:941:1973#0/1 + <br>@SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36 + <br> . start=1, end=1 => identifier is SRR001666.1 + <br> . start=2, end=2 => identifier is 071112_SLXA-EAS1_s_7:5:1:817:345 + <br> . start=1, end=2 => identifier is SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345" + /> + <param name="filter_chastity" type="select" label="Skip reads marked by the Illumina chastity program" + help="String after the accession having a 'Y' after the first colon, like this: + <br>@accession 1:Y:0:CTTGTA + <br>where the 'Y' signifies filtering by chastity. + <br> For 'either', a 'Y' on either end of a paired-end read will be filtered. + <br> For 'both', a 'Y' is required on both ends of a paired-end read (or on the only end of a single-end read)" + > + <option value="off">off - no filtering</option> + <option value="either">either - a 'Y' on either end of a paired-end read</option> + <option value="both">both - a 'Y' is required on both ends of a paired-end read or the only end of a single-end read</option> + </param> + </when> + <when value="gsnap_fasta"> + <param name="gsnap" type="data" format="fasta" label="Select a single-end dataset" help="GSNAP fasta must have the sequence entirely on one line, a second line is interpreted as the paired-end sequence"/> + <param name="circularinput" type="boolean" checked="false" truevalue="--circular-input=true" falsevalue="" label="Circular-end data (paired reads are on same strand)"/> + </when> + </conditional> + + <param name="mode" type="select" label="Alignment mode" help="Assumes cmetindex and atoiindex were run on the gmap datatbase."> + <option value="">standard</option> + <option value="cmet-stranded">cmet-stranded for bisulfite-treated DNA reads (tolerance to C-to-T changes)</option> + <option value="cmet-nonstranded">cmet-nonstranded for bisulfite-treated DNA reads (tolerance to C-to-T changes)</option> + <option value="atoi-stranded">atoi-stranded for RNA-editing tolerance (A-to-G changes)</option> + <option value="atoi-nonstranded">atoi-nonstranded for RNA-editing tolerance (A-to-G changes)</option> + </param> + + <!-- GMAPDB for alignment --> + <conditional name="refGenomeSource"> + <param name="genomeSource" type="select" label="<HR><H2>Align To</H2>Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> + <option value="indexed">Use a built-in index</option> + <option value="gmapdb">Use a gmapdb from your history</option> + </param> + <when value="indexed"> + <param name="gmapindex" type="select" label="Select a reference genome" help="if your genome of interest is not listed - contact Galaxy team"> + <options from_file="gmap_indices.loc"> + <column name="uid" index="0" /> + <column name="dbkey" index="1" /> + <column name="name" index="2" /> + <column name="kmers" index="3" /> + <column name="maps" index="4" /> + <column name="snps" index="5" /> + <column name="value" index="6" /> + </options> + </param> + + <param name="kmer" type="select" data_ref="gmapindex" label="kmer size" help="Defaults to highest available kmer size"> + <options from_file="gmap_indices.loc"> + <column name="name" index="3"/> + <column name="value" index="3"/> + <filter type="param_value" ref="gmapindex" column="6"/> + <filter type="multiple_splitter" column="3" separator=","/> + <filter type="add_value" name="" value=""/> + <filter type="sort_by" column="3"/> + </options> + </param> + + <conditional name="use_splicing"> + <param name="src" type="select" label="Known Splicesite and Introns" + help="Look for splicing involving known sites or known introns at short or long distances + See README instructions for the distinction between known sites and known introns"> + <option value="none" selected="true">None</option> + <option value="gmapdb">From the GMAP Database</option> + <option value="history">A Map in your history</option> + </param> + <when value="none"/> + <when value="history"> + <param name="splicemap" type="data" format="splicesites.iit,introns.iit" metadata_name="dbkey" label="Select a splicesite map" + help="built with GMAP IIT"/> + </when> + <when value="gmapdb"> + <param name="splicemap" type="select" data_ref="gmapindex" label="Use map for splicing involving known sites or known introns" help=""> + <options from_file="gmap_indices.loc"> + <column name="name" index="4"/> + <column name="value" index="4"/> + <filter type="param_value" ref="gmapindex" column="6"/> + <filter type="multiple_splitter" column="4" separator=","/> + <filter type="add_value" name="" value=""/> + <filter type="sort_by" column="4"/> + </options> + </param> + </when> + </conditional> + + <conditional name="use_snps"> + <param name="src" type="select" label="Known SNPs" help="for SNP tolerant alignments"> + <option value="none" selected="true">None</option> + <option value="gmapdb">From the GMAP Database</option> + <option value="history">A SNP Index in your history</option> + </param> + <when value="none"/> + <when value="history"> + <param name="snpindex" type="data" format="gmapsnpindex" metadata_name="dbkey" label="Select a snpindex" + help="built with GMAP SNP Index"/> + </when> + <when value="gmapdb"> + <param name="snpindex" type="select" data_ref="gmapindex" label="Use database containing known SNPs" help=""> + <options from_file="gmap_indices.loc"> + <column name="name" index="5"/> + <column name="value" index="5"/> + <filter type="param_value" ref="gmapindex" column="6"/> + <filter type="multiple_splitter" column="5" separator=","/> + <filter type="add_value" name="" value=""/> + <filter type="sort_by" column="5"/> + </options> + </param> + </when> + </conditional> + + </when> + <when value="gmapdb"> + <param name="gmapdb" type="data" format="gmapdb" metadata_name="dbkey" label="Select a gmapdb" + help="A GMAP database built with GMAP Build"/> + <param name="kmer" type="select" data_ref="gmapdb" label="kmer size" help="Defaults to highest available kmer size"> + <options> + <filter type="data_meta" ref="gmapdb" key="kmers" multiple="True" separator=","/> + </options> + </param> + + <conditional name="use_splicing"> + <param name="src" type="select" label="Known Splicesite and Introns" + help="Look for splicing involving known sites or known introns at short or long distances + See README instructions for the distinction between known sites and known introns"> + <option value="none" selected="true">None</option> + <option value="gmapdb">From the GMAP Database</option> + <option value="history">A Map in your history</option> + </param> + <when value="none"/> + <when value="history"> + <param name="splicemap" type="data" format="splicesites.iit,introns.iit" metadata_name="dbkey" label="Select a splicesite map" + help="built with GMAP IIT"/> + </when> + <when value="gmapdb"> + <param name="splicemap" type="select" data_ref="gmapdb" label="Use map for splicing involving known sites or known introns" help=""> + <options> + <filter type="data_meta" ref="gmapdb" key="maps" multiple="True"/> + </options> + </param> + </when> + </conditional> + + <conditional name="use_snps"> + <param name="src" type="select" label="Known SNPs" help="for SNP tolerant alignments"> + <option value="none" selected="true">None</option> + <option value="gmapdb">From the GMAP Database</option> + <option value="history">A SNP Index in your history</option> + </param> + <when value="none"/> + <when value="history"> + <param name="snpindex" type="data" format="gmapsnpindex" metadata_name="dbkey" label="Select a snpindex" + help="built with GMAP SNP Index"/> + </when> + <when value="gmapdb"> + <param name="snpindex" type="select" data_ref="gmapdb" label="Use database containing known SNPs" help=""> + <options> + <filter type="data_meta" ref="gmapdb" key="snps" multiple="True" separator=","/> + </options> + </param> + </when> + </conditional> + + </when> + </conditional> + + <!-- Computation options --> + <conditional name="computation"> + <param name="options" type="select" label="<HR>Computational Settings" help=""> + <option value="default">Use default settings</option> + <option value="advanced">Set Computation Options</option> + </param> + <when value="default"/> + <when value="advanced"> + <param name="max_mismatches" type="float" value="" optional="true" label="Maximum number of mismatches allowed (uses default when negative)" + help="Defaults to the ultrafast level of ((readlength+2)/12 - 2)). + If specified between 0.0 and 1.0, then treated as a fraction + of each read length. Otherwise, treated as an integral number + of mismatches (including indel and splicing penalties) + For RNA-Seq, you may need to increase this value slightly + to align reads extending past the ends of an exon."> + <validator type="in_range" message="The mismatches must >= 0." min="0."/> + </param> + <param name="query_unk_mismatch" type="boolean" checked="false" truevalue="--query-unk-mismatch=1" falsevalue="" label="Count unknown (N) characters in the query as a mismatch"/> + <param name="genome_unk_mismatch" type="boolean" checked="true" truevalue="" falsevalue="--genome-unk-mismatch=0" label="Count unknown (N) characters in the genome as a mismatch"/> + <param name="terminal_threshold" type="integer" value="" optional="true" label="Threshold for searching for a terminal alignment (default 3)" + help="(from one end of the read to the best possible position at the other end). To turn off terminal alignments, set this to a high value." /> + <param name="indel_penalty" type="integer" value="" optional="true" label="Penalty for an indel (default 2)" + help="Counts against mismatches allowed. To find indels, make indel-penalty less than or equal to max-mismatches. A value < 2 can lead to false positives at read ends" /> + <param name="indel_endlength" type="integer" value="" optional="true" label="Minimum length at end required for indel alignments (default 4)" /> + <param name="max_middle_insertions" type="integer" value="" optional="true" label="Maximum number of middle insertions allowed (default 9)" /> + <param name="max_middle_deletions" type="integer" value="" optional="true" label="Maximum number of middle deletions allowed (default 30)" /> + <param name="max_end_insertions" type="integer" value="" optional="true" label="Maximum number of end insertions allowed (default 3)" /> + <param name="max_end_deletions" type="integer" value="" optional="true" label="Maximum number of end deletions allowed (default 6)" /> + <param name="suboptimal_levels" type="integer" value="" optional="true" label="Report suboptimal hits beyond best hit (default 0)" + help="All hits with best score plus suboptimal-levels are reported" /> + <param name="adapter_strip" type="select" label="Method for removing adapters from reads" + help="paired removes adapters from paired-end reads if a concordant or paired alignment cannot be found from the original read"> + <option value="paired" selected="true">paired</option> + <option value="off">off</option> + </param> + <param name="trim_mismatch_score" type="integer" value="" optional="true" label="Score to use for mismatches when trimming at ends (default is -3)" + help="to turn off trimming, specify 0"/> + + <!-- Options for GMAP alignment within GSNAP --> + <param name="gmap_mode" type="select" multiple="true" optional="true" label="Cases to use GMAP for complex alignments containing multiple splices or indels" help=""> + <option value="pairsearch">pairsearch</option> + <option value="terminal">terminal</option> + <option value="improve">improve</option> + </param> + <param name="trigger_score_for_gmap" type="integer" value="" optional="true" label="GMAP pairsearch threshold (default 5)" + help="Try GMAP pairsearch on nearby genomic regions if best score (the total of both ends if paired-end) exceeds this value (default 5)" /> + <param name="max_gmap_pairsearch" type="integer" value="" optional="true" label="GMAP pairsearch threshold (default 3)" + help="Perform GMAP pairsearch on nearby genomic regions up to this many candidate ends (default 3)." /> + <param name="max_gmap_terminal" type="integer" value="" optional="true" label="GMAP terminal threshold (default 3)" + help="Perform GMAP terminal on nearby genomic regions up to this many candidate ends (default 3)." /> + <param name="max_gmap_improvement" type="integer" value="" optional="true" label="GMAP improvement threshold (default 3)" + help="Perform GMAP improvement on nearby genomic regions up to this many candidate ends (default 3)." /> + <param name="microexon_spliceprob" type="float" value="" optional="true" label="GMAP microexons threshold (default .90)" + help="Allow microexons only if one of the splice site probabilities is greater than this value." > + <validator type="in_range" message="The microexons probability must be between 0. and 1." min="0." max="1."/> + </param> + </when> + </conditional> + + <conditional name="splicing"> + <param name="options" type="select" label="<HR>Splicing options for RNA-Seq" help=""> + <option value="default">Use default settings</option> + <option value="advanced">Set Splicing Options</option> + </param> + <when value="default"/> + <when value="advanced"> + <!-- Splicing options for RNA-Seq --> + <!-- use-splices This should be either a select list from the gmapdb maps or a data type using splicesdir and use-splices --> + <!-- Neither novel splicing (-N) nor known splicing (-s) turned on => assume reads are DNA-Seq (genomic) --> + <param name="novelsplicing" type="boolean" checked="false" truevalue="--novelsplicing=1" falsevalue="" label="Look for novel splicing "/> + <param name="localsplicedist" type="integer" value="" optional="true" label="Definition of local novel splicing event (default 200000)"/> + <param name="local_splice_penalty" type="integer" value="" optional="true" label="Penalty for a local splice (default 0). Counts against mismatches allowed"/> + <param name="distant_splice_penalty" type="integer" value="" optional="true" label="Penalty for a distant splice (default 3). Counts against mismatches allowed"/> + <param name="local_splice_endlength" type="integer" value="" optional="true" label="Minimum length at end required for local spliced alignments (default 15, min is 14)"/> + <param name="distant_splice_endlength" type="integer" value="" optional="true" label="Minimum length at end required for distant spliced alignments (default 16, min is 14)"/> + <param name="shortend_splice_endlength" type="integer" value="" optional="true" label="Minimum length at end required for distant spliced alignments (default 16, min is 14)"/> + <param name="distant_splice_identity" type="float" value="" optional="true" label="Minimum identity at end required for distant spliced alignments (default 0.95)"/> + </when> + </conditional> + + <!-- Output data --> + <conditional name="output"> + <param name="options" type="select" label="<HR><H2>Output</H2>Output options for RNA-Seq" help=""> + <option value="default">Use default settings</option> + <option value="advanced">Set Output Options</option> + </param> + <when value="default"/> + <when value="advanced"> + <param name="npath" type="integer" value="" optional="true" label="Maximum number of paths to print (default 100)"/> + <param name="quiet_if_excessive" type="boolean" checked="false" truevalue="--quiet-if-excessive" falsevalue="" label="Quiet if Excessive" + help="If more than maximum number of paths are found, then nothing is printed."/> + <param name="show_refdiff" type="boolean" checked="false" truevalue="--show-refdiff" falsevalue="" label="Show SNP-tolerant alignment" + help="For GSNAP output in SNP-tolerant alignment, shows all differences relative to the reference genome as lower case (otherwise, it shows all differences relative to both the reference and alternate genome)"/> + <param name="clip_overlap" type="boolean" checked="false" truevalue="--clip-overlap" falsevalue="" label="Clip Overlap" + help="For paired-end reads whose alignments overlap, clip the overlapping region."/> + </when> + </conditional> + <conditional name="result"> + <param name="format" type="select" label="Select the output format" help=""> + <option value="sam">SAM</option> + <option value="goby">Goby</option> + <option value="gsnap">GSNAP default output</option> + </param> + <when value="gsnap"/> + <when value="sam"> + <param name="no_sam_headers" type="boolean" truevalue="--no-sam-headers" falsevalue="" checked="false" label="Do not print headers beginning with '@'"/> + <param name="read_group_id" type="text" value="" optional="true" label="Value to put into read-group id (RG-ID) field"/> + <param name="read_group_name" type="text" value="" optional="true" label="Value to put into read-group name (RG-SM) field"/> + <param name="read_group_library" type="text" value="" optional="true" label="Value to put into read-group library (RG-LB) field"/> + <param name="read_group_platform" type="text" value="" optional="true" label="Value to put into read-group library platform (RG-PL) field"/> + <param name="quality_shift" type="integer" value="" optional="true" label="Shift FASTQ quality scores by this amount in SAM output (default -31)"/> + </when> + <when value="goby"> + <param name="goby_output" type="text" value="" label="Basename for Goby output files"/> + <param name="creads_window_start" type="integer" value="" optional="true" label="Compact reads window start (default: 0=start of file)"/> + <param name="creads_window_end" type="integer" value="" optional="true" label="Compact reads window end (default: 0=end of file)"/> + <param name="creads_complement" type="boolean" truevalue="--creads-complement" falsevalue="" checked="false" label="Complement read sequences (without reversing)"/> + </when> + </conditional> + <param name="split_output" type="boolean" truevalue="--split-output=gsnap_out" falsevalue="" checked="false" label="Separate outputs" + help="Separate outputs for: nomapping, halfmapping_uniq, halfmapping_mult, unpaired_uniq, unpaired_mult, paired_uniq, paired_mult, concordant_uniq, and concordant_mult results"/> + </inputs> + <outputs> + <data format="txt" name="gsnap_stderr" label="${tool.name} on ${on_string}: stderr"/> + <data format="txt" name="results" label="${tool.name} on ${on_string} ${result.format}" > + <filter>(split_output == False)</filter> + <change_format> + <when input="result['format']" value="sam" format="sam"/> + </change_format> + </data> + <!-- nomapping, halfmapping_uniq, halfmapping_mult, unpaired_uniq, unpaired_mult, paired_uniq, paired_mult, concordant_uniq, concordant_mult --> + <data format="txt" name="concordant_mult" label="${tool.name} on ${on_string} uniq.${result.format}" from_work_dir="gsnap_out.concordant_mult"> + <filter>(split_output == True)</filter> + <change_format> + <when input="result['format']" value="sam" format="sam"/> + </change_format> + </data> + <data format="txt" name="concordant_uniq" label="${tool.name} on ${on_string} uniq.${result.format}" from_work_dir="gsnap_out.concordant_uniq"> + <filter>(split_output == True)</filter> + <change_format> + <when input="result['format']" value="sam" format="sam"/> + </change_format> + </data> + <data format="txt" name="paired_mult" label="${tool.name} on ${on_string} uniq.${result.format}" from_work_dir="gsnap_out.paired_mult"> + <filter>(split_output == True)</filter> + <change_format> + <when input="result['format']" value="sam" format="sam"/> + </change_format> + </data> + <data format="txt" name="paired_uniq" label="${tool.name} on ${on_string} uniq.${result.format}" from_work_dir="gsnap_out.paired_uniq"> + <filter>(split_output == True)</filter> + <change_format> + <when input="result['format']" value="sam" format="sam"/> + </change_format> + </data> + <data format="txt" name="unpaired_mult" label="${tool.name} on ${on_string} uniq.${result.format}" from_work_dir="gsnap_out.unpaired_mult"> + <filter>(split_output == True)</filter> + <change_format> + <when input="result['format']" value="sam" format="sam"/> + </change_format> + </data> + <data format="txt" name="unpaired_uniq" label="${tool.name} on ${on_string} uniq.${result.format}" from_work_dir="gsnap_out.unpaired_uniq"> + <filter>(split_output == True)</filter> + <change_format> + <when input="result['format']" value="sam" format="sam"/> + </change_format> + </data> + <data format="txt" name="halfmapping_mult" label="${tool.name} on ${on_string} uniq.${result.format}" from_work_dir="gsnap_out.halfmapping_mult"> + <filter>(split_output == True)</filter> + <change_format> + <when input="result['format']" value="sam" format="sam"/> + </change_format> + </data> + <data format="txt" name="halfmapping_uniq" label="${tool.name} on ${on_string} uniq.${result.format}" from_work_dir="gsnap_out.halfmapping_uniq"> + <filter>(split_output == True)</filter> + <change_format> + <when input="result['format']" value="sam" format="sam"/> + </change_format> + </data> + <data format="txt" name="nomapping" label="${tool.name} on ${on_string} uniq.${result.format}" from_work_dir="gsnap_out.nomapping"> + <filter>(split_output == True)</filter> + <change_format> + <when input="result['format']" value="sam" format="sam"/> + </change_format> + </data> + + </outputs> + <tests> + </tests> + + <help> + +**What it does** + +GSNAP_ (Genomic Short-read Nucleotide Alignment Program) is a short read aligner which can align both single- and paired-end reads as short as 14nt and of arbitrarily long length. It can detect short- and long-distance splicing, including interchromosomal splicing, in individual reads, using probabilistic models or a database of known splice sites. Our program also permits SNP-tolerant alignment to a reference space of all possible combinations of major and minor alleles, and can align reads from bisulfite-treated DNA for the study of methylation state. It is developed by Thomas D. Wu of Genentech, Inc. +Publication_ citation: Thomas D. Wu, Serban Nacu "Fast and SNP-tolerant detection of complex variants and splicing in short reads. Bioinformatics. 2010 Apr 1;26(7):873-81. Epub 2010 Feb 10. + +.. _GSNAP: http://research-pub.gene.com/gmap/ +.. _Publication: http://bioinformatics.oupjournals.org/cgi/content/full/26/7/873 +http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2844994/?tool=pubmed + +------ + +**Know what you are doing** + +.. class:: warningmark + +You will want to read the README_ + +.. _README: http://research-pub.gene.com/gmap/src/README + +------ + +**Input formats** + +Input to GSNAP should be either in FASTQ or FASTA format. + +The FASTQ input may include quality scores, which will then be included in SAM +output, if that output format is selected. + +For FASTA format, you should include one line per read (or end of a +paired-end read). The same FASTA file can have a mixture of +single-end and paired-end reads of varying lengths, if desired. + +Single-end reads: + +Each FASTA entry should contain one short read per line, like this + +>Header information +AAAACATTCTCCTCCGCATAAGCCTGCGTCAGATTA + +Each short read can have a different length. However, the entire read +needs to be on a single line, and may not wrap around multiple lines. +If it extends to a second line, GSNAP will think that the read is +paired-end. + + +Paired-end reads: + +Each FASTA entry should contain two short reads, one per line, like +this + +>Header information +AAAACATTCTCCTCCGCATAAGCCTAGTAGATTA +GGCGTAGGTAGAAGTAGAGGTTAAGGCGCGTCAG + +By default, the program assumes that the second end is in the reverse +complement direction compared with the first end. If they are in the +same direction, you may need to use the --circular-input (or -c) flag. + +( The Galaxy tool: "FASTA Width formatter" can be used to reformat fasta files to have single line sequences. ) + +------ + +**Output formats in GSNAP** + +SAM output format + +Default GSNAP format + See the README_ + + + + + </help> +</tool> +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gmap-72ab00e732c3/gmap/iit_store.xml Tue Nov 08 15:23:51 2011 -0500 @@ -0,0 +1,188 @@ +<tool id="gmap_iit_store" name="GMAP IIT" version="2.0.0"> + <description>Create a map store for known genes or SNPs</description> + <requirements> + <requirement type="binary">iit_store</requirement> + <!-- proposed tag for added datatype dependencies --> + <requirement type="datatype">gmap_annotation</requirement> + <requirement type="datatype">gmap_snps</requirement> + <requirement type="datatype">iit</requirement> + <requirement type="datatype">splicesites.iit</requirement> + <requirement type="datatype">introns.iit</requirement> + <requirement type="datatype">snps.iit</requirement> + </requirements> + <version_string>iit_store --version</version_string> + <command interpreter="command"> /bin/bash $shscript 2> $log </command> + <inputs> + <!-- Input data --> + <conditional name="map"> + <param name="type" type="select" label="Make map for" > + <option value="genes">Introns and Splice sites</option> + <option value="snps">SNPs</option> + <option value="gmap">GMAP Annotation</option> + </param> + <when value="genes"> + <conditional name="src"> + <param name="src_format" type="select" label="Add splice and intron info from" > + <option value="refGeneTable">refGenes table from UCSC table browser</option> + <option value="gtf">GTF</option> + <option value="gff3">GFF3</option> + </param> + <when value="refGeneTable"> + <param name="genes" type="data" format="tabular" label="UCSC refGenes table" help="Example: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/refGene.txt.gz" /> + <param name="col_skip" type="integer" value="1" label="Columns to skip before the id/name column (default 1)" + help="Note that alignment tracks in UCSC sometimes have an extra column on the left."> + <validator type="in_range" message="The number of colmumns to skip must >= 0." min="0."/> + </param> + </when> + <when value="gtf"> + <param name="genes" type="data" format="gtf" label="Genes as GTF" help="" /> + </when> + <when value="gff3"> + <param name="genes" type="data" format="gff3" label="Genes in GFF3 format" help="" /> + </when> + </conditional> + <param name="maps" type="select" display="checkboxes" multiple="true" force_select="true" label="Add splice and intron info from" > + <option value="splicesites" selected="true">splicesites.iit</option> + <option value="introns" selected="false">introns.iit</option> + </param> + </when> + <when value="snps"> + <conditional name="src"> + <param name="src_format" type="select" label="Add SNP info from" > + <option value="snpTable">UCSC SNP Table</option> + <option value="snpFile">GMAP SNP File</option> + </param> + <when value="snpTable"> + <param name="snps" type="data" format="tabular" label="UCSC SNPs table" help="Example: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/snp130.txt.gz" /> + <param name="snpsex" type="data" format="tabular" optional="true" label="UCSC SNP Exceptions table" help="Example: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/snp130Exceptions.txt.gz" /> + <param name="weight" type="select" label="Include SNPs with at least Confidence Level" help=""> + <option value="1" selected="true">1 (High)</option> + <option value="2">2 (Medium)</option> + <option value="3">3 (All)</option> + </param> + </when> + <when value="snpFile"> + <param name="snps" type="data" format="gmap_snps" optional="true" label="GMAP SNPs file" + help="Format (3 columns):<B> + <br>>rs62211261 21:14379270 CG + <br>>rs62211262 21:14379281 CG + </B> + <br>Each line must start with a > character, then be followed by an + identifier (which may have duplicates). Then there should be the + chromosomal coordinate of the SNP. (Coordinates are all 1-based, so + the first character of a chromosome is number 1.) Finally, there + should be the two possible alleles: ( AC AG AT CG CT GT or AN CN GN TN) + <br>These alleles must correspond to the possible nucleotides on the plus strand of the genome. + If the one of these two letters does not match the allele in the reference + sequence, that SNP will be ignored in subsequent processing as a probable error. + The N stands for any other allele." /> + </when> + </conditional> + </when> + <when value="gmap"> + <param name="annotation" type="data" format="gmap_annotation" label="GMAP mapfile" + help="Format (2 or columns): <B> + <br>>label coords optional_tag + <br>optional_annotation (which may be zero, one, or multiple lines) + </B> + <br>Each line must start with a > character, then be followed by an identifier (which may have duplicates). + <br>Then there should be the chromosomal coordinate range. (Coordinates are all 1-based, so the first character of a chromosome is number 1.) + <br>The coords should be of the form + <br> chr:position + <br> chr:startposition..endposition + <br>The term chr:position is equivalent to chr:position..position. + <br>If you want to indicate that the interval is on the minus strand or reverse direction, then endposition may be less than startposition. + " /> + </when> + </conditional> + </inputs> + <outputs> + <data format="txt" name="log" label="${tool.name} on ${on_string}: log"/> + <data format="splicesites.iit" name="splicesites_iit" label="${tool.name} on ${on_string} splicesites.iit"> + <filter>(map['type'] == 'genes' and 'splicesites' in map['maps'])</filter> + </data> + <data format="introns.iit" name="introns_iit" label="${tool.name} on ${on_string} introns.iit"> + <filter>(map['type'] == 'genes' and 'introns' in map['maps'])</filter> + </data> + <data format="snps.iit" name="snps_iit" label="${tool.name} on ${on_string} snps.iit"> + <filter>(map['type'] == 'snps')</filter> + </data> + <data format="iit" name="map_iit" label="${tool.name} on ${on_string} map.iit"> + <filter>(map['type'] == 'gmap')</filter> + </data> + </outputs> + <configfiles> + <configfile name="shscript"> +#!/bin/bash +#set $catcmd = 'gzcat -f' +#set $catcmd = 'cat' +#set $ds = chr(36) +#set $gt = chr(62) +#set $lt = chr(60) +#set $ad = chr(38) +#set $ep = chr(33) +#set $toerr = ''.join([$gt,$ad,'2']) +#import os.path +#if $map.type == 'genes': +if [ $ep -e $map.src.genes ]; then echo "$map.src.genes does not exist" $toerr; exit 1; fi +if [ $ep -s $map.src.genes ]; then echo "$map.src.genes is empty" $toerr; exit 2; fi + #if $map.src.src_format == 'refGeneTable': + #if 'splicesites' in [ $map.maps.__str__ ]: + $catcmd $map.src.genes | psl_splicesites -s $map.src.col_skip | iit_store -o $splicesites_iit + #end if + #if 'introns' in [ $map.maps.__str__ ]: + $catcmd $map.src.genes | psl_introns -s $map.src.col_skip | iit_store -o $introns_iit + #end if + #elif $map.src.src_format == 'gtf': + #if 'splicesites' in [ $map.maps.__str__ ]: + $catcmd $map.src.genes | gtf_splicesites | iit_store -o $splicesites_iit + #end if + #if 'introns' in [ $map.maps.__str__ ]: + $catcmd $map.src.genes | gtf_introns | iit_store -o $introns_iit + #end if + #elif $map.src.src_format == 'gff3': + #if 'splicesites' in [ $map.maps.__str__ ]: + $catcmd $map.src.genes | gff3_splicesites | iit_store -o $splicesites_iit + #end if + #if 'introns' in [ $map.maps.__str__ ]: + $catcmd $map.src.genes | gff3_introns | iit_store -o $introns_iit + #end if + #end if +#elif $map.type == 'snps': +if [ $ep -s $map.src.snps ]; then echo "$map.src.snps is empty" $toerr; exit 2; fi + #if $map.src.snpsex.__str__ != 'None': + $catcmd $map.src.snps | dbsnp_iit -w $map.src.weight -e $map.src.snpsex | iit_store -o $snps_iit + #else: + $catcmd $map.src.snps | dbsnp_iit -w $map.src.weight | iit_store -o $snps_iit + #end if +#else: + $catcmd $map.src.snps | iit_store -o $map_iit +#end if + </configfile> + </configfiles> + + <tests> + </tests> + + <help> + + +**iit_store** + +GMAP IIT creates an Interval Index Tree map of known splice sites, introns, or SNPs (it uses iit_store described in the GMAP documentation). The maps can be used in GMAP_ (Genomic Mapping and Alignment Program for mRNA and EST sequences) and GSNAP_ (Genomic Short-read Nucleotide Alignment Program). Maps are typically used for known splice sites, introns, or SNPs. + +You will want to read the README_ + +Publication_ citation: Thomas D. Wu, Colin K. Watanabe Bioinformatics 2005 21(9):1859-1875; doi:10.1093/bioinformatics/bti310 + +.. _GMAP: http://research-pub.gene.com/gmap/ +.. _GSNAP: http://research-pub.gene.com/gmap/ +.. _README: http://research-pub.gene.com/gmap/src/README +.. _Publication: http://bioinformatics.oxfordjournals.org/cgi/content/full/21/9/1859 + + +**inputs** + + </help> +</tool> +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gmap-72ab00e732c3/gmap/lib/galaxy/datatypes/gmap.py Tue Nov 08 15:23:51 2011 -0500 @@ -0,0 +1,424 @@ +""" +GMAP indexes +""" +import logging +import os,os.path,re +import data +from data import Text +from galaxy import util +from metadata import MetadataElement + +log = logging.getLogger(__name__) + +class GmapDB( Text ): + """ + A GMAP DB for indexes + """ + MetadataElement( name="db_name", desc="The db name for this index set", default='unknown', set_in_upload=True, readonly=True ) + MetadataElement( name="basesize", default="12", desc="The basesize for offsetscomp", visible=True, readonly=True ) + MetadataElement( name="kmers", default=[''], desc="The kmer sizes for indexes", visible=True, no_value=[''], readonly=True ) + MetadataElement( name="map_dir", desc="The maps directory", default='unknown', set_in_upload=True, readonly=True ) + MetadataElement( name="maps", default=[''], desc="The names of maps stored for this gmap gmapdb", visible=True, no_value=[''], readonly=True ) + MetadataElement( name="snps", default=[''], desc="The names of SNP indexes stored for this gmapdb", visible=True, no_value=[''], readonly=True ) + MetadataElement( name="cmet", default=False, desc="Has a cmet index", visible=True, readonly=True ) + MetadataElement( name="atoi", default=False, desc="Has a atoi index", visible=True, readonly=True ) + + file_ext = 'gmapdb' + is_binary = True + composite_type = 'auto_primary_file' + allow_datatype_change = False + + def generate_primary_file( self, dataset = None ): + """ + This is called only at upload to write the html file + cannot rename the datasets here - they come with the default unfortunately + """ + return '<html><head></head><body>AutoGenerated Primary File for Composite Dataset</body></html>' + + def regenerate_primary_file(self,dataset): + """ + cannot do this until we are setting metadata + """ + bn = dataset.metadata.db_name + log.info( "GmapDB regenerate_primary_file %s" % (bn)) + rval = ['<html><head><title>GMAPDB %s</title></head><p/><H3>GMAPDB %s</H3><p/>cmet %s<br>atoi %s<H4>Maps:</H4><ul>' % (bn,bn,dataset.metadata.cmet,dataset.metadata.atoi)] + for i,name in enumerate(dataset.metadata.maps): + rval.append( '<li>%s' % name) + rval.append( '</ul></html>' ) + f = file(dataset.file_name,'w') + f.write("\n".join( rval )) + f.write('\n') + f.close() + + def set_peek( self, dataset, is_multi_byte=False ): + log.info( "GmapDB set_peek %s" % (dataset)) + if not dataset.dataset.purged: + dataset.peek = "GMAPDB index %s\n cmet %s\n atoi %s\n maps %s" % ( dataset.metadata.db_name,dataset.metadata.cmet,dataset.metadata.atoi,dataset.metadata.maps ) + dataset.blurb = "GMAPDB %s" % ( dataset.metadata.db_name ) + else: + dataset.peek = 'file does not exist' + dataset.blurb = 'file purged from disk' + def display_peek( self, dataset ): + try: + return dataset.peek + except: + return "GMAP index file" + + def sniff( self, filename ): + return False + def set_meta( self, dataset, overwrite = True, **kwd ): + """ + Expecting: + extra_files_path/<db_name>/db_name>.ref<basesize><kmer>3<index> + extra_files_path/db_name/db_name.ref1[2345]1[2345]3offsetscomp + extra_files_path/db_name/db_name.ref1[2345]1[2345]3positions + extra_files_path/db_name/db_name.ref1[2345]1[2345]3gammaptrs + index maps: + extra_files_path/db_name/db_name.maps/*.iit + """ + log.info( "GmapDB set_meta %s %s" % (dataset,dataset.extra_files_path)) + pat = '(.*)\.((ref)|(met)[atgc][atgc]|(a2i)[atgc][atgc])((\d\d)(\d\d))?3positions(\.(.+))?' + efp = dataset.extra_files_path + flist = os.listdir(efp) + for i,fname in enumerate(flist): + log.info( "GmapDB set_meta %s %s" % (i,fname)) + fpath = os.path.join(efp,fname) + if os.path.isdir(fpath): + ilist = os.listdir(fpath) + kmers = {'':'default'} # HACK '' empty key added so user has default choice when selecting kmer from metadata + for j,iname in enumerate(ilist): + log.info( "GmapDB set_meta file %s %s" % (j,iname)) + ipath = os.path.join(fpath,iname) + if os.path.isdir(ipath): # find maps + dataset.metadata.map_dir = iname + for mapfile in os.listdir(ipath): + mapname = mapfile.replace('.iit','') + log.info( "GmapDB set_meta map %s %s" % (mapname,mapfile)) + dataset.metadata.maps.append(mapname) + else: + m = re.match(pat,iname) + if m: + log.info( "GmapDB set_meta m %s %s " % (iname, m)) + assert len(m.groups()) == 10 + dataset.metadata.db_name = fname + if m.groups()[2] == 'ref': + if m.groups()[-1] != None: + dataset.metadata.snps.append(m.groups()[-1]) + else: + if m.groups()[-3] != None: + k = int(m.groups()[-3]) + kmers[k] = k + if m.groups()[-4] != None: + dataset.metadata.basesize = int( m.groups()[-4]) + elif m.groups()[3] == 'met': + dataset.metadata.cmet = True + elif m.groups()[4] == 'a2i': + dataset.metadata.atoi = True + dataset.metadata.kmers = kmers.keys() + +class GmapSnpIndex( Text ): + """ + A GMAP SNP index created by snpindex + """ + MetadataElement( name="db_name", desc="The db name for this index set", default='unknown', set_in_upload=True, readonly=True ) + MetadataElement( name="snps_name", default='snps', desc="The name of SNP index", visible=True, no_value='', readonly=True ) + + file_ext = 'gmapsnpindex' + is_binary = True + composite_type = 'auto_primary_file' + allow_datatype_change = False + + def generate_primary_file( self, dataset = None ): + """ + This is called only at upload to write the html file + cannot rename the datasets here - they come with the default unfortunately + """ + return '<html><head></head><body>AutoGenerated Primary File for Composite Dataset</body></html>' + + def regenerate_primary_file(self,dataset): + """ + cannot do this until we are setting metadata + """ + bn = dataset.metadata.db_name + log.info( "GmapDB regenerate_primary_file %s" % (bn)) + rval = ['<html><head><title>GMAPDB %s</title></head><p/><H3>GMAPDB %s</H3><p/>cmet %s<br>atoi %s<H4>Maps:</H4><ul>' % (bn,bn,dataset.metadata.cmet,dataset.metadata.atoi)] + for i,name in enumerate(dataset.metadata.maps): + rval.append( '<li>%s' % name) + rval.append( '</ul></html>' ) + f = file(dataset.file_name,'w') + f.write("\n".join( rval )) + f.write('\n') + f.close() + def set_peek( self, dataset, is_multi_byte=False ): + log.info( "GmapSnpIndex set_peek %s" % (dataset)) + if not dataset.dataset.purged: + dataset.peek = "GMAP SNPindex %s on %s\n" % ( dataset.metadata.snps_name,dataset.metadata.db_name) + dataset.blurb = "GMAP SNPindex %s on %s\n" % ( dataset.metadata.snps_name,dataset.metadata.db_name) + else: + dataset.peek = 'file does not exist' + dataset.blurb = 'file purged from disk' + def display_peek( self, dataset ): + try: + return dataset.peek + except: + return "GMAP SNP index" + + def sniff( self, filename ): + return False + def set_meta( self, dataset, overwrite = True, **kwd ): + """ + Expecting: + extra_files_path/snp_name.iit + extra_files_path/db_name/db_name.ref1[2345]1[2345]3offsetscomp.snp_name + extra_files_path/db_name/db_name.ref1[2345]1[2345]3positions.snp_name + extra_files_path/db_name/db_name.ref1[2345]1[2345]3gammaptrs.snp_name + """ + log.info( "GmapSnpIndex set_meta %s %s" % (dataset,dataset.extra_files_path)) + pat = '(.*)\.(ref((\d\d)(\d\d))?3positions)\.(.+)?' + efp = dataset.extra_files_path + flist = os.listdir(efp) + for i,fname in enumerate(flist): + m = re.match(pat,fname) + if m: + assert len(m.groups()) == 6 + dataset.metadata.db_name = m.groups()[0] + dataset.metadata.snps_name = m.groups()[-1] + + + + +class IntervalIndexTree( Text ): + """ + A GMAP Interval Index Tree Map + created by iit_store + (/path/to/map)/(mapname).iit + """ + file_ext = 'iit' + is_binary = True + +class SpliceSitesIntervalIndexTree( IntervalIndexTree ): + """ + A GMAP Interval Index Tree Map + created by iit_store + """ + file_ext = 'splicesites.iit' + +class IntronsIntervalIndexTree( IntervalIndexTree ): + """ + A GMAP Interval Index Tree Map + created by iit_store + """ + file_ext = 'introns.iit' + +class SNPsIntervalIndexTree( IntervalIndexTree ): + """ + A GMAP Interval Index Tree Map + created by iit_store + """ + file_ext = 'snps.iit' + +class IntervalAnnotation( Text ): + """ + Class describing a GMAP Interval format: + >label coords optional_tag + optional_annotation (which may be zero, one, or multiple lines) + The coords should be of the form: + chr:position + chr:startposition..endposition + """ + file_ext = 'gmap_annotation' + """Add metadata elements""" + MetadataElement( name="annotations", default=0, desc="Number of interval annotations", readonly=True, optional=True, visible=False, no_value=0 ) + + def set_meta( self, dataset, **kwd ): + """ + Set the number of annotations and the number of data lines in dataset. + """ + data_lines = 0 + annotations = 0 + for line in file( dataset.file_name ): + line = line.strip() + if line and line.startswith( '>' ): + annotations += 1 + data_lines +=1 + else: + data_lines += 1 + dataset.metadata.data_lines = data_lines + dataset.metadata.annotations = annotations + def set_peek( self, dataset, is_multi_byte=False ): + if not dataset.dataset.purged: + dataset.peek = data.get_file_peek( dataset.file_name, is_multi_byte=is_multi_byte ) + if dataset.metadata.annotations: + dataset.blurb = "%s annotations" % util.commaify( str( dataset.metadata.annotations ) ) + else: + dataset.blurb = data.nice_size( dataset.get_size() ) + else: + dataset.peek = 'file does not exist' + dataset.blurb = 'file purged from disk' + + def sniff( self, filename ): + """ + Determines whether the file is a gmap annotation file + Format: + >label coords optional_tag + optional_annotation (which may be zero, one, or multiple lines) + For example, the label may be an EST accession, with the coords + representing its genomic position. Labels may be duplicated if + necessary. + The coords should be of the form + chr:position + chr:startposition..endposition + The term "chr:position" is equivalent to "chr:position..position". If + you want to indicate that the interval is on the minus strand or + reverse direction, then <endposition> may be less than <startposition>. + """ + try: + pat = '>(\S+)\s((\S+):(\d+)(\.\.(\d+))?(\s.(.+))?$' #>label chr:position[..endposition][ optional_tag] + fh = open( filename ) + count = 0 + while True and count < 10: + line = fh.readline() + if not line: + break #EOF + line = line.strip() + if line: #first non-empty line + if line.startswith( '>' ): + count += 1 + if re.match(pat,line) == None: # Failed to match + return False + finally: + fh.close() + return False + +class SpliceSiteAnnotation(IntervalAnnotation): + file_ext = 'gmap_splicesites' + """ + Example: + >NM_004448.ERBB2.exon1 17:35110090..35110091 donor 6678 + >NM_004448.ERBB2.exon2 17:35116768..35116769 acceptor 6678 + >NM_004448.ERBB2.exon2 17:35116920..35116921 donor 1179 + >NM_004448.ERBB2.exon3 17:35118099..35118100 acceptor 1179 + >NM_004449.ERG.exon1 21:38955452..38955451 donor 783 + >NM_004449.ERG.exon2 21:38878740..38878739 acceptor 783 + >NM_004449.ERG.exon2 21:38878638..38878637 donor 360 + >NM_004449.ERG.exon3 21:38869542..38869541 acceptor 360 + Each line must start with a ">" character, then be followed by an + identifier, which may have duplicates and can have any format, with + the gene name or exon number shown here only as a suggestion. Then + there should be the chromosomal coordinates which straddle the + exon-intron boundary, so one coordinate is on the exon and one is on + the intron. (Coordinates are all 1-based, so the first character of a + chromosome is number 1.) Finally, there should be the splice type: + "donor" or "acceptor". You may optionally store the intron distance + at the end. GSNAP can use this intron distance, if it is longer than + its value for --localsplicedist, to look for long introns at that + splice site. The same splice site may have different intron distances + in the database; GSNAP will use the longest intron distance reported + in searching for long introns. + """ + def sniff( self, filename ): # TODO + """ + Determines whether the file is a gmap splice site annotation file + """ + try: + pat = '>(\S+\.intron\d+)\s((\S+):(\d+)\.\.(\d+))\s(donor|acceptor)(\s(\d+))?$' #>label chr:position..position donor|acceptor[ intron_dist] + fh = open( filename ) + count = 0 + while True and count < 10: + line = fh.readline() + if not line: + break #EOF + line = line.strip() + if line: #first non-empty line + count += 1 + if re.match(pat,line) == None: # Failed to match + return False + finally: + fh.close() + return False + +class IntronAnnotation(IntervalAnnotation): + file_ext = 'gmap_introns' + """ + Example: + >NM_004448.ERBB2.intron1 17:35110090..35116769 + >NM_004448.ERBB2.intron2 17:35116920..35118100 + >NM_004449.ERG.intron1 21:38955452..38878739 + >NM_004449.ERG.intron2 21:38878638..38869541 + The coordinates are 1-based, and specify the exon coordinates + surrounding the intron, with the first coordinate being from the donor + exon and the second one being from the acceptor exon. + """ + def sniff( self, filename ): # TODO + """ + Determines whether the file is a gmap Intron annotation file + """ + try: + pat = '>(\S+\.intron\d+)\s((\S+):(\d+)\.\.(\d+)(\s(.)+)?$' #>label chr:position + fh = open( filename ) + count = 0 + while True and count < 10: + line = fh.readline() + if not line: + break #EOF + line = line.strip() + if line: #first non-empty line + count += 1 + if re.match(pat,line) == None: # Failed to match + return False + finally: + fh.close() + return False + +class SNPAnnotation(IntervalAnnotation): + file_ext = 'gmap_snps' + """ + Example: + >rs62211261 21:14379270 CG + >rs62211262 21:14379281 AT + >rs62211263 21:14379298 WN + Each line must start with a ">" character, then be followed by an + identifier (which may have duplicates). Then there should be the + chromosomal coordinate of the SNP. (Coordinates are all 1-based, so + the first character of a chromosome is number 1.) Finally, there + should be the two possible alleles. (Previous versions required that + these be in alphabetical order: "AC", "AG", "AT", "CG", "CT", or "GT", + but that is no longer a requirement.) These alleles must correspond + to the possible nucleotides on the plus strand of the genome. If the + one of these two letters does not match the allele in the reference + sequence, that SNP will be ignored in subsequent processing as a + probable error. + + GSNAP also supports the idea of a wildcard SNP. A wildcard SNP allows + all nucleotides to match at that position, not just a given reference + and alternate allele. It is essentially as if an "N" were recorded at + that genomic location, although the index files still keep track of + the reference allele. To indicate that a position has a wildcard SNP, + you can indicate the genotype as "WN", where "W" is the reference + allele. Another indication of a wildcard SNP is to provide two + separate lines at that position with the genotypes "WX" and "WY", + where "W" is the reference allele and "X" and "Y" are two different + alternate alleles. + """ + def sniff( self, filename ): + """ + Determines whether the file is a gmap SNP annotation file + """ + try: + pat = '>(\S+)\s((\S+):(\d+)\s([TACGW][TACGN])$' #>label chr:position ATCG + fh = open( filename ) + count = 0 + while True and count < 10: + line = fh.readline() + if not line: + break #EOF + line = line.strip() + if line: #first non-empty line + count += 1 + if re.match(pat,line) == None: # Failed to match + return False + finally: + fh.close() + return False + +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gmap-72ab00e732c3/gmap/snpindex.xml Tue Nov 08 15:23:51 2011 -0500 @@ -0,0 +1,141 @@ +<tool id="gmap_snpindex" name="GMAP SNP Index" version="2.0.0"> + <description>build index files for known SNPs</description> + <requirements> + <requirement type="binary">snpindex</requirement> + <!-- proposed tag for added datatype dependencies --> + <requirement type="datatype">gmapsnpindex</requirement> + <requirement type="datatype">gmapdb</requirement> + <requirement type="datatype">gmap_snps</requirement> + <requirement type="datatype">snps.iit</requirement> + </requirements> + <version_string>snpindex --version</version_string> + <command interpreter="command"> /bin/bash $shscript 2>1 1> $output </command> + <inputs> + <conditional name="refGenomeSource"> + <param name="genomeSource" type="select" label="Will you map to a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> + <option value="indexed">Use a built-in index</option> + <option value="gmapdb">Use gmapdb from the history</option> + </param> + <when value="indexed"> + <param name="gmapindex" type="select" label="Select a reference genome" help="if your genome of interest is not listed - contact Galaxy team"> + <options from_file="gmap_indices.loc"> + <column name="uid" index="0" /> + <column name="dbkey" index="1" /> + <column name="name" index="2" /> + <column name="kmers" index="3" /> + <column name="maps" index="4" /> + <column name="snps" index="5" /> + <column name="value" index="6" /> + </options> + </param> + </when> + <when value="gmapdb"> + <param name="gmapdb" type="data" format="gmapdb" metadata_name="dbkey" label="Select a gmapdb" + help="A GMAP database built with GMAP Build"/> + </when> + </conditional> + <conditional name="dbsnp"> + <param name="snp_source" type="select" label="Add SNP info from" > + <option value="snpTable">UCSC SNP Table</option> + <option value="snpFile">GMAP SNP File</option> + <option value="snpIIT">"GMAP SNPs map from GMAP iit store</option> + </param> + <when value="snpTable"> + <param name="snps" type="data" format="tabular" label="UCSC SNPs table" help="Example: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/snp130.txt.gz" /> + <param name="snpsex" type="data" format="tabular" optional="true" label="UCSC SNP Exceptions table" help="Example: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/snp130Exceptions.txt.gz" /> + <param name="weight" type="select" label="Include SNPs with at least Confidence Level" help=""> + <option value="1" selected="true">1 (High)</option> + <option value="2">2 (Medium)</option> + <option value="3">3 (All)</option> + </param> + </when> + <when value="snpFile"> + <param name="snps" type="data" format="gmap_snps" label="GMAP SNPs file" + help="Format (3 columns): + <br>>rs62211261 21:14379270 CG + <br>>rs62211262 21:14379281 CG + <br>Each line must start with a > character, then be followed by an + identifier (which may have duplicates). Then there should be the + chromosomal coordinate of the SNP. (Coordinates are all 1-based, so + the first character of a chromosome is number 1.) Finally, there + should be the two possible alleles: ( AC AG AT CG CT GT or AN CN GN TN) + <br>These alleles must correspond to the possible nucleotides on the plus strand of the genome. + If the one of these two letters does not match the allele in the reference + sequence, that SNP will be ignored in subsequent processing as a probable error. + The N stands for any other allele." /> + </when> + <when value="snpIIT"> + <param name="snpIIT" type="data" format="snps.iit" label="GMAP SNPs map" help="Created by: GMAP iit store" /> + </when> + </conditional> + <param name="snps_name" type="text" value="snps" label="Name for this SNP index" help="no white space characters"> + </param> + </inputs> + <outputs> + <!-- + <data format="txt" name="log" label="${tool.name} on ${on_string}: log"/> + --> + <data format="gmapsnpindex" name="output" label="${tool.name} on ${on_string} snpindex" /> + </outputs> + <configfiles> + <configfile name="shscript"> +#!/bin/bash +#set $ds = chr(36) +#set $gt = chr(62) +#set $lt = chr(60) +#set $ad = chr(38) +#import os.path +#if $refGenomeSource.genomeSource == "gmapdb": +#set $gmapdb = $refGenomeSource.gmapdb.extra_files_path +#set $refname = $refGenomeSource.gmapdb.metadata.db_name +#else: +#set $gmapdb = $os.path.dirname($refGenomeSource.gmapindex.value) +$refname = $os.path.basename($refGenomeSource.gmapindex.value) +#end if +#set $gmapsnpdir = $output.extra_files_path +mkdir -p $gmapsnpdir +#set $snpsname = $snps_name.__str__ +#set $snpsiit = '.'.join([$snpsname,'iit']) +#set $pathsnps = $os.path.join($gmapsnpdir,$snpsname) +#set $pathsnpsiit = $os.path.join($gmapsnpdir,$snpsiit) +#if $dbsnp.snp_source != 'none' and $dbsnp.snps.__str__ != 'None': +#if $dbsnp.snp_source == 'snpTable': +#if $dbsnp.snpsex.__str__ != 'None': +cat $dbsnp.snps | dbsnp_iit -w $dbsnp.weight -e $dbsnp.snpsex | iit_store -o $pathsnps +#else: +cat $dbsnp.snps | dbsnp_iit -w $dbsnp.weight | iit_store -o $pathsnps +#end if +#elif $dbsnp.snp_source == 'snpFile': +cat $dbsnp.snps | iit_store -o $pathsnps +#elif $dbsnp.snp_source == 'snpIIT': +cat $dbsnp.snps > $pathsnpsiit +#end if +snpindex -D $gmapdb -d $refname -V $output.extra_files_path -v $snpsname $pathsnpsiit +echo snpindex -D $gmapdb -d $refname -V $output.extra_files_path -v $snpsname $pathsnpsiit +#end if + </configfile> + </configfiles> + + <tests> + </tests> + + <help> + + +**GMAP SNP Index** + +GMAP SNP Index (snpindex in the GMAP documentaion) creates an index for known SNPs allowing for SNP tolerant mapping and alignment when using GMAP_ (Genomic Mapping and Alignment Program for mRNA and EST sequences) and GSNAP_ (Genomic Short-read Nucleotide Alignment Program). + +You will want to read the README_ + +Publication_ citation: Thomas D. Wu, Colin K. Watanabe Bioinformatics 2005 21(9):1859-1875; doi:10.1093/bioinformatics/bti310 + +.. _GMAP: http://research-pub.gene.com/gmap/ +.. _GSNAP: http://research-pub.gene.com/gmap/ +.. _README: http://research-pub.gene.com/gmap/src/README +.. _Publication: http://bioinformatics.oxfordjournals.org/cgi/content/full/21/9/1859 + + + </help> +</tool> +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gmap-72ab00e732c3/tool-data/gmap_indices.loc.sample Tue Nov 08 15:23:51 2011 -0500 @@ -0,0 +1,10 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of GMAPDB indexed sequences data files. You will need +#to create these data files using gmap_build and then create a gmap_indices.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The gmap_indices.loc +#file has this format (white space characters are TAB characters): +# +#<unique_build_id> <dbkey> <display_name> <kmers> <map,map> <snp,snp> <file_base_path> +#hg18 hg18 hg18 (cmet atoi) 12,13,14,15 splicesites,introns snps /depot/data2/galaxy/gmap/hg18 +#hg19 hg19 hg19 (cmet atoi) 12,13,14,15 splicesites,introns,snps snps,dbsnp /depot/data2/galaxy/gmap/hg19