annotate test-data/citrus_genome.fasta @ 1:b4e68390233d draft

planemo upload for repository https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/tripal commit 35c5eff77b573a66f3611b4906417df9a440c857
author gga
date Tue, 05 Mar 2019 05:11:04 -0500
parents 8f30dbcce8c8
children
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
0
8f30dbcce8c8 planemo upload for repository https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/tripal commit 690532f4a8e36a334b2d4e15b832532fc1bb8d39
gga
parents:
diff changeset
1 >scaffold00001 length=5927163
8f30dbcce8c8 planemo upload for repository https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/tripal commit 690532f4a8e36a334b2d4e15b832532fc1bb8d39
gga
parents:
diff changeset
2 TTTTGTATTCTATGTCCTCTGATCTTTATACTTCTTCATTTTGTCTTTGCAAGAACCGGA
8f30dbcce8c8 planemo upload for repository https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/tripal commit 690532f4a8e36a334b2d4e15b832532fc1bb8d39
gga
parents:
diff changeset
3 ATTATGGGTACATCACAAATTCTCTAGGTGTGACTTGTGTTGTGGGGCCTTTTTTTtACA
8f30dbcce8c8 planemo upload for repository https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/tripal commit 690532f4a8e36a334b2d4e15b832532fc1bb8d39
gga
parents:
diff changeset
4 TTTCCATATTGCAAGTATTTTTTTGCTACCATTGGTATATTTGTCTGTTAAAATCAATCT
8f30dbcce8c8 planemo upload for repository https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/tripal commit 690532f4a8e36a334b2d4e15b832532fc1bb8d39
gga
parents:
diff changeset
5 GCTTTCACTTATGTTCGTGCGTTCTTGTTCCCTCGCCTTGCAATTGCATATCTCAAATTA
8f30dbcce8c8 planemo upload for repository https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/tripal commit 690532f4a8e36a334b2d4e15b832532fc1bb8d39
gga
parents:
diff changeset
6 TCTTTCTTACTTTGATTTAGATGGCCAAGGTTTTAAGCTAACTTTTTACAATGCCAATTT
8f30dbcce8c8 planemo upload for repository https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/tripal commit 690532f4a8e36a334b2d4e15b832532fc1bb8d39
gga
parents:
diff changeset
7 TTAAATGGTTTTCTAATGCTGTTCAAAGTTGCAGCCTTTACTTCGTATATTTGTCAGGTT
8f30dbcce8c8 planemo upload for repository https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/tripal commit 690532f4a8e36a334b2d4e15b832532fc1bb8d39
gga
parents:
diff changeset
8 CTGACGGGTGCGGTCGGCGGCGGGGGCTATAGCATGCGGTCTCGAGAGCCGCAAAGAAAA
8f30dbcce8c8 planemo upload for repository https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/tripal commit 690532f4a8e36a334b2d4e15b832532fc1bb8d39
gga
parents:
diff changeset
9 ATGGGTGGTTTTCCCGGTTTCGGCCATAACTCGTGATCGGGGCCTCCGATTCTGGTTCCG
8f30dbcce8c8 planemo upload for repository https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/tripal commit 690532f4a8e36a334b2d4e15b832532fc1bb8d39
gga
parents:
diff changeset
10 TTTCGTCCCACGGGACCAGCCGGGCGGGGGCATCGGATTGCAAAAGTCTTTAAATTTGAA