Mercurial > repos > gga > tripal_analysis_sync
annotate test-data/citrus_genome.fasta @ 6:1bc5858e164e draft
planemo upload for repository https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/tripal commit 35c5eff77b573a66f3611b4906417df9a440c857
| author | gga |
|---|---|
| date | Tue, 05 Mar 2019 05:07:15 -0500 |
| parents | 20198c88e07e |
| children |
| rev | line source |
|---|---|
|
0
20198c88e07e
planemo upload for repository https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/tripal commit f745b23c84a615bf434d717c8c0e553a012f0268
gga
parents:
diff
changeset
|
1 >scaffold00001 length=5927163 |
|
20198c88e07e
planemo upload for repository https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/tripal commit f745b23c84a615bf434d717c8c0e553a012f0268
gga
parents:
diff
changeset
|
2 TTTTGTATTCTATGTCCTCTGATCTTTATACTTCTTCATTTTGTCTTTGCAAGAACCGGA |
|
20198c88e07e
planemo upload for repository https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/tripal commit f745b23c84a615bf434d717c8c0e553a012f0268
gga
parents:
diff
changeset
|
3 ATTATGGGTACATCACAAATTCTCTAGGTGTGACTTGTGTTGTGGGGCCTTTTTTTtACA |
|
20198c88e07e
planemo upload for repository https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/tripal commit f745b23c84a615bf434d717c8c0e553a012f0268
gga
parents:
diff
changeset
|
4 TTTCCATATTGCAAGTATTTTTTTGCTACCATTGGTATATTTGTCTGTTAAAATCAATCT |
|
20198c88e07e
planemo upload for repository https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/tripal commit f745b23c84a615bf434d717c8c0e553a012f0268
gga
parents:
diff
changeset
|
5 GCTTTCACTTATGTTCGTGCGTTCTTGTTCCCTCGCCTTGCAATTGCATATCTCAAATTA |
|
20198c88e07e
planemo upload for repository https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/tripal commit f745b23c84a615bf434d717c8c0e553a012f0268
gga
parents:
diff
changeset
|
6 TCTTTCTTACTTTGATTTAGATGGCCAAGGTTTTAAGCTAACTTTTTACAATGCCAATTT |
|
20198c88e07e
planemo upload for repository https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/tripal commit f745b23c84a615bf434d717c8c0e553a012f0268
gga
parents:
diff
changeset
|
7 TTAAATGGTTTTCTAATGCTGTTCAAAGTTGCAGCCTTTACTTCGTATATTTGTCAGGTT |
|
20198c88e07e
planemo upload for repository https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/tripal commit f745b23c84a615bf434d717c8c0e553a012f0268
gga
parents:
diff
changeset
|
8 CTGACGGGTGCGGTCGGCGGCGGGGGCTATAGCATGCGGTCTCGAGAGCCGCAAAGAAAA |
|
20198c88e07e
planemo upload for repository https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/tripal commit f745b23c84a615bf434d717c8c0e553a012f0268
gga
parents:
diff
changeset
|
9 ATGGGTGGTTTTCCCGGTTTCGGCCATAACTCGTGATCGGGGCCTCCGATTCTGGTTCCG |
|
20198c88e07e
planemo upload for repository https://github.com/galaxy-genome-annotation/galaxy-tools/tree/master/tools/tripal commit f745b23c84a615bf434d717c8c0e553a012f0268
gga
parents:
diff
changeset
|
10 TTTCGTCCCACGGGACCAGCCGGGCGGGGGCATCGGATTGCAAAAGTCTTTAAATTTGAA |
