Mercurial > repos > galaxyp > regex_find_replace
comparison regex.xml @ 0:002f95cf9d6e draft
planemo upload for repository https://github.com/galaxyproteomics/tools-galaxyp/tree/master/tools/regex_find_replace commit 568a615b191482c54ecb31399ba27f78d6c71510
| author | galaxyp | 
|---|---|
| date | Wed, 18 Jan 2017 17:45:06 -0500 | 
| parents | |
| children | bf0c0905fd60 | 
   comparison
  equal
  deleted
  inserted
  replaced
| -1:000000000000 | 0:002f95cf9d6e | 
|---|---|
| 1 <tool id="regex1" name="Regex Find And Replace" version="1.0.0"> | |
| 2 <description></description> | |
| 3 <command interpreter="python">regex.py --input '$input' --output '$out_file1' --input_display_name '$input.display_name' | |
| 4 #for $check in $checks: | |
| 5 --pattern='$check.pattern' --replacement='$check.replacement' | |
| 6 #end for | |
| 7 </command> | |
| 8 <inputs> | |
| 9 <param format="txt" name="input" type="data" label="Select lines from"/> | |
| 10 <repeat name="checks" title="Check"> | |
| 11 <param name="pattern" size="40" type="text" value="chr([0-9A-Za-z])+" label="Find Regex" help="here you can enter text or regular expression (for syntax check lower part of this frame)"> | |
| 12 <sanitizer> | |
| 13 <valid> | |
| 14 <add preset="string.printable"/> | |
| 15 <remove value="\" /> | |
| 16 <remove value="'" /> | |
| 17 </valid> | |
| 18 <mapping initial="none"> | |
| 19 <add source="\" target="__backslash__" /> | |
| 20 <add source="'" target="__sq__"/> | |
| 21 </mapping> | |
| 22 </sanitizer> | |
| 23 </param> | |
| 24 <param name="replacement" size="40" type="text" value="newchr\1" label="Replacement"> | |
| 25 <sanitizer> | |
| 26 <valid> | |
| 27 <add preset="string.printable"/> | |
| 28 <remove value="\" /> | |
| 29 <remove value="'" /> | |
| 30 </valid> | |
| 31 <mapping initial="none"> | |
| 32 <add source="\" target="__backslash__" /> | |
| 33 <add source="'" target="__sq__"/> | |
| 34 </mapping> | |
| 35 </sanitizer> | |
| 36 </param> | |
| 37 </repeat> | |
| 38 </inputs> | |
| 39 <outputs> | |
| 40 <data format="input" name="out_file1" metadata_source="input"/> | |
| 41 </outputs> | |
| 42 <tests> | |
| 43 <test> | |
| 44 <param name="input" value="find1.txt"/> | |
| 45 <param name="pattern" value="(T\w+)"/> | |
| 46 <param name="replacement" value="\1 \1" /> | |
| 47 <output name="out_file1" file="replace1.txt"/> | |
| 48 </test> | |
| 49 <test> | |
| 50 <param name="input" value="find1.txt"/> | |
| 51 <param name="pattern" value="f"/> | |
| 52 <param name="replacement" value="'"" /> | |
| 53 <output name="out_file1" file="replace2.txt"/> | |
| 54 </test> | |
| 55 <test> | |
| 56 <param name="input" value="find1.txt"/> | |
| 57 <param name="checks_0|pattern" value="a test file"/> | |
| 58 <param name="checks_0|replacement" value="a file named #{input_name}" /> | |
| 59 <param name="checks_1|pattern" value="see here"/> | |
| 60 <param name="checks_1|replacement" value="see #{input_name}" /> | |
| 61 <param name="checks_2|pattern" value="see (find1).txt"/> | |
| 62 <param name="checks_2|replacement" value="see \1" /> | |
| 63 <output name="out_file1" file="replace3.txt"/> | |
| 64 </test> | |
| 65 </tests> | |
| 66 <help> | |
| 67 This tool goes line by line through the specified input file and | |
| 68 replaces text which matches the specified regular expression patterns | |
| 69 with its corresponding specified replacement. | |
| 70 | |
| 71 This tool uses Python regular expressions. More information about | |
| 72 Python regular expressions can be found here: | |
| 73 http://docs.python.org/library/re.html. | |
| 74 | |
| 75 To convert an Ilumina FATSQ sequence id from the CAVASA 8 format:: | |
| 76 | |
| 77 @EAS139:136:FC706VJ:2:2104:15343:197393 1:Y:18:ATCACG | |
| 78 GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC | |
| 79 +EAS139:136:FC706VJ:2:2104:15343:197393 1:Y:18:ATCACG | |
| 80 IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC | |
| 81 | |
| 82 To the CASAVA 7 format:: | |
| 83 | |
| 84 @EAS139_FC706VJ:2:2104:15343:197393#0/1 | |
| 85 GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC | |
| 86 +EAS139_FC706VJ:2:2104:15343:197393#0/1 | |
| 87 IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC | |
| 88 | |
| 89 Use Settings:: | |
| 90 | |
| 91 Find Regex: ^([@+][A-Z0-9]+):\d+:(\S+)\s(\d).*$ | |
| 92 Replacement: \1_\2#0/\3 | |
| 93 | |
| 94 Note that the parentheses **()** capture patterns in the text that can be used in the replacement text by using a backslash-number reference: **\\1** | |
| 95 | |
| 96 The regex **^([@+][A-Z0-9]+):\d+:(\S+) (\d).*$** means:: | |
| 97 | |
| 98 ^ - start the match at the beginning of the line of text | |
| 99 ( - start a group (1), that is a string of matched text, that can be back-referenced in the replacement as \1 | |
| 100 [@+] - matches either a @ or + character | |
| 101 [A-Z0-9]+ - matches an uppercase letter or a digit, the plus sign means to match 1 or more such characters | |
| 102 ) - end a group (1), that is a string of matched text, that can be back-referenced in the replacement as \1 | |
| 103 :\d+: - matches a colon followed by one or more digits followed by a colon character | |
| 104 (\S+) - matches one or more non-whitespace charcters, the enclosing parentheses make this a group (2) that can back-referenced in the replacement text as \2 | |
| 105 \s - matches a whitespace character | |
| 106 (\d) - matches a single digit character, the enclosing parentheses make this a group (3) that can back-referenced in the replacement text as \3 | |
| 107 .* - dot means match any character, asterisk means zero more more matches | |
| 108 $ - the regex must match to the end of the line of text | |
| 109 | |
| 110 In the replacement pattern, use the special token #{input_name} to insert the input dataset's display name. | |
| 111 The name can be modified by a second find/replace check. Suppose you want to insert the sample id of your dataset, | |
| 112 named **Sample ABC123**, into the dataset itself, which currently contains the lines:: | |
| 113 Data 1 | |
| 114 Data 2 | |
| 115 Data 3 | |
| 116 | |
| 117 You can use the following checks:: | |
| 118 Find Regex: Data | |
| 119 Replacement: #{input_name} Data | |
| 120 | |
| 121 Find Regex: Sample (\S+) | |
| 122 Replacement: \1 | |
| 123 | |
| 124 The result will be:: | |
| 125 ABC123 Data 1 | |
| 126 ABC123 Data 2 | |
| 127 ABC123 Data 3 | |
| 128 | |
| 129 | |
| 130 | |
| 131 Galaxy aggressively escapes input supplied to tools, so if something | |
| 132 is not working please let us know and we can look into whether this is | |
| 133 the cause. Also if you would like help constructing regular | |
| 134 expressions for your inputs, please let us know at help@msi.umn.edu. | |
| 135 </help> | |
| 136 </tool> | 
