# HG changeset patch # User fubar # Date 1307481205 14400 # Node ID ea6678917716b5da04015ebff3a6b0900957e2e2 Migrated tool version 0.1 from old tool shed archive to new tool shed repository diff -r 000000000000 -r ea6678917716 rgweblogo/README --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/rgweblogo/README Tue Jun 07 17:13:25 2011 -0400 @@ -0,0 +1,30 @@ +This is a Galaxy tool wrapper for weblogo3 already available as a web app at the site below but neat as a Galaxy tool + +It generates sequence logos from fasta files such as the alignments generated by clustalw + +Note that the image for the help must be in static/images for it to show up on the tool form - it's the same image as goes in test-data + +**Installation** + +Make sure weblogo3 is installed in your system python and is available on the path for all your nodes + +Move the test data files to your galaxy root test-data +Move the xml file to a subdirectory of your tools folder (eg rgenetics/) and then add a line in your tool_conf.xml to point there. +Run +sh run_functional_tests.sh -id weblogo3 +to make sure the tests work + +then restart Galaxy and you should be good to go. + + +**Attribution** + +Source for the weblogo3 python executable is at http://weblogo.berkeley.edu + +Written by Ross Lazarus for the Rgenetics project + +Copyright Ross Lazarus at gmail com 2011 + +All rights reserved. + +Released under the LGPL - see http://www.gnu.org/copyleft/lesser.html diff -r 000000000000 -r ea6678917716 rgweblogo/rgClustal_testout.fasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/rgweblogo/rgClustal_testout.fasta Tue Jun 07 17:13:25 2011 -0400 @@ -0,0 +1,48 @@ +>c_briggsae-chrII_+_ +---ATGAGCTTCCACAAAAGCATGAGCTTT +CTCAGCTTCTGCCACATCAGCATTCAAATG +ATC +>c_brenneri-Cbre_Contig60_+_ +---ATGAGCCTCCACAACAGCATGATTTTT +CTCGGCTTCCGCCACATCCGCATTCAAATG +ATC +>c_remanei-Crem_Contig172_-_ +---ATGAGCCTCTACAACCGCATGATTCTT +TTCAGCCTCTGCCACGTCCGCATTCAAATG +CTC +>c_elegans-II_+_ +---ATGAGCCTCTACTACAGCATGATTCTT +CTCAGCTTCTGCAACGTCAGCATTCAGATG +ATC +>c_briggsae-chrII_+_bar +---CCGGAGTCGATCCCTGAAT-------- +------------------------------ +--- +>c_brenneri-Cbre_Contig60fee_+_ +---ACGAAGTCGATCCCTGAAA-------- +-TCAGATGAGCGGTTGACCA---GAGAACA +ACC +>c_remanei-Crem_Contig172zot_-_ +---ACGAAGTCGGTCCCTATAAGGTATGAT +TTTATATGA----TGTACCATAAGGAAATA +GTC +>c_elegans-II_+_meh +---ACGAAGTCGGTCCCTGAAC--AATTAT +TT----TGA----TATA---GAAAGAAACG +GTA +>c_briggsae-chrIfooI_+_ +CGCACAAATATGATGCACAAATCCACAACC +TAAAGCATCTCCGATAACGTTGACCGAAGT +--- +>c_brenneri-Cbre_Contig60gak_+_ +CGCACAAATGTAGTGGACAAATCCGCATCC +CAAAGCGTCTCCGATAACATTTACCGAAGT +--- +>c_remanei-Crem_Contig172foo_-_ +AGCACAAATGTAATGAACGAATCCGCATCC +CAACGCATCGCCAATCACATTCACAGATGT +--- +>c_elegans-II_+_more +TGCACAAATGTGATGAACGAATCCACATCC +CAATGCATCACCGATCACATTGACAGATGT +--- diff -r 000000000000 -r ea6678917716 rgweblogo/rgWebLogo3.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/rgweblogo/rgWebLogo3.xml Tue Jun 07 17:13:25 2011 -0400 @@ -0,0 +1,90 @@ + + generator for fasta (eg Clustal alignments) + + weblogo -F $outformat -s $size -f $input -o $output -t "$logoname" + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +**Note** + +This tool uses Weblogo3_ in Galaxy to generate a sequence logo. The input file must be a fasta file in your current history. + +A typical output looks like this + +.. image:: ./static/images/rgWebLogo3_test.jpg + +---- + +**Why use WebLogo in Galaxy?** + +Weblogo3_ is a good example of an easy to use tool and there are plenty of other web accessible weblogo generator sites available. + +However, none of those offer the combination of: + +1) persistence of analyses and data in multiple shareable histories, pages and libraries + +2) convenient access to shared data libraries, workflows and user controlled pages, and to 3rd party data sources like UCSC tables. + +3) analyses integrated with many other applicable generic and specialized tools already available for downstream processing. + +that you get for free when you use Galaxy. No muss; no fuss. + +---- + +**Attribution** + +Weblogo attribution and associated documentation are available at Weblogo3_ + +This wrapper was written by Ross Lazarus for the rgenetics project and the source code is licensed under the LGPL_ like other rgenetics artefacts + +.. _Weblogo3: http://weblogo.berkeley.edu/ + +.. _LGPL: http://www.gnu.org/copyleft/lesser.html + + + + + + diff -r 000000000000 -r ea6678917716 rgweblogo/rgWebLogo3_test.jpg Binary file rgweblogo/rgWebLogo3_test.jpg has changed