Mercurial > repos > fubar > shrnaseq_test

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/hairpinTool.R	Mon Jan 19 22:14:10 2015 -0500
@@ -0,0 +1,1069 @@
+#!/usr/bin/env Rscript
+# ARGS: 1.inputType         -String specifying format of input (fastq or table)
+#    IF inputType is "fastq" or "pairedFastq:
+#       2*.fastqPath        -One or more strings specifying path to fastq files
+#       2.annoPath          -String specifying path to hairpin annotation table
+#       3.samplePath        -String specifying path to sample annotation table
+#       4.barStart          -Integer specifying starting position of barcode
+#       5.barEnd            -Integer specifying ending position of barcode
+#    ###
+#    IF inputType is "pairedFastq":
+#       6.barStartRev       -Integer specifying starting position of barcode
+#                            on reverse end
+#       7.barEndRev         -Integer specifying ending position of barcode
+#                            on reverse end
+#    ###
+#       8.hpStart           -Integer specifying startins position of hairpin
+#                            unique region
+#       9.hpEnd             -Integer specifying ending position of hairpin
+#                            unique region
+#    IF inputType is "counts":
+#       2.countPath         -String specifying path to count table
+#       3.annoPath          -String specifying path to hairpin annotation table
+#       4.samplePath        -String specifying path to sample annotation table
+#    ###
+#       10.secFactName      -String specifying name of secondary factor
+#       11.cpmReq           -Float specifying cpm requirement
+#       12.sampleReq        -Integer specifying cpm requirement
+#       13.readReq          -Integer specifying read requirement
+#       14.fdrThresh        -Float specifying the FDR requirement
+#       15.lfcThresh        -Float specifying the log-fold-change requirement
+#       16.workMode         -String specifying exact test or GLM usage
+#       17.htmlPath         -String specifying path to HTML file
+#       18.folderPath       -String specifying path to folder for output
+#    IF workMode is "classic" (exact test)
+#       19.pairData[2]      -String specifying first group for exact test
+#       20.pairData[1]      -String specifying second group for exact test
+#    ###
+#    IF workMode is "glm"
+#       19.contrastData     -String specifying contrasts to be made
+#       20.roastOpt         -String specifying usage of gene-wise tests
+#       21.hairpinReq       -String specifying hairpin requirement for gene-
+#                            wise test
+#       22.selectOpt        -String specifying type of selection for barcode
+#                            plots
+#       23.selectVals       -String specifying members selected for barcode
+#                            plots
+#    ###
+#
+# OUT:  Bar Plot of Counts Per Index
+#       Bar Plot of Counts Per Hairpin
+#       MDS Plot
+#       BCV Plot
+#       Smear Plot
+#       Barcode Plots (If Genewise testing was selected)
+#       Top Expression Table
+#       Feature Counts Table
+#       HTML file linking to the ouputs
+#
+# Author: Shian Su - registertonysu@gmail.com - Jan 2014
+
+# Record starting time
+timeStart <- as.character(Sys.time())
+options(bitmapType='cairo')
+# needed to prevent missing x11 errors for png()
+# Loading and checking required packages
+library(methods, quietly=TRUE, warn.conflicts=FALSE)
+library(statmod, quietly=TRUE, warn.conflicts=FALSE)
+library(splines, quietly=TRUE, warn.conflicts=FALSE)
+library(edgeR, quietly=TRUE, warn.conflicts=FALSE)
+library(limma, quietly=TRUE, warn.conflicts=FALSE)
+
+if (packageVersion("edgeR") < "3.7.17") {
+  stop("Please update 'edgeR' to version >= 3.7.17 to run this tool")
+}
+
+if (packageVersion("limma")<"3.21.16") {
+  message("Update 'limma' to version >= 3.21.16 to see updated barcode graphs")
+}
+
+################################################################################
+### Function declarations
+################################################################################
+
+# Function to load libaries without messages
+silentLibrary <- function(...) {
+  list <- c(...)
+  for (package in list){
+    suppressPackageStartupMessages(library(package, character.only=TRUE))
+  }
+}
+
+# Function to sanitise contrast equations so there are no whitespaces
+# surrounding the arithmetic operators, leading or trailing whitespace
+sanitiseEquation <- function(equation) {
+  equation <- gsub(" *[+] *", "+", equation)
+  equation <- gsub(" *[-] *", "-", equation)
+  equation <- gsub(" *[/] *", "/", equation)
+  equation <- gsub(" *[*] *", "*", equation)
+  equation <- gsub("^\\s+|\\s+$", "", equation)
+  return(equation)
+}
+
+# Function to sanitise group information
+sanitiseGroups <- function(string) {
+  string <- gsub(" *[,] *", ",", string)
+  string <- gsub("^\\s+|\\s+$", "", string)
+  return(string)
+}
+
+# Function to change periods to whitespace in a string
+unmake.names <- function(string) {
+  string <- gsub(".", " ", string, fixed=TRUE)
+  return(string)
+}
+
+# Function has string input and generates an output path string
+makeOut <- function(filename) {
+  return(paste0(folderPath, "/", filename))
+}
+
+# Function has string input and generates both a pdf and png output strings
+imgOut <- function(filename) {
+  assign(paste0(filename, "Png"), makeOut(paste0(filename,".png")),
+         envir=.GlobalEnv)
+  assign(paste0(filename, "Pdf"), makeOut(paste0(filename,".pdf")),
+         envir=.GlobalEnv)
+}
+
+# Create cat function default path set, default seperator empty and appending
+# true by default (Ripped straight from the cat function with altered argument
+# defaults)
+cata <- function(..., file=htmlPath, sep="", fill=FALSE, labels=NULL,
+                 append=TRUE) {
+  if (is.character(file))
+    if (file == "")
+      file <- stdout()
+  else if (substring(file, 1L, 1L) == "|") {
+    file <- pipe(substring(file, 2L), "w")
+    on.exit(close(file))
+  }
+  else {
+    file <- file(file, ifelse(append, "a", "w"))
+    on.exit(close(file))
+  }
+  .Internal(cat(list(...), file, sep, fill, labels, append))
+}
+
+# Function to write code for html head and title
+HtmlHead <- function(title) {
+  cata("<head>\n")
+  cata("<title>", title, "</title>\n")
+  cata("</head>\n")
+}
+
+# Function to write code for html links
+HtmlLink <- function(address, label=address) {
+  cata("<a href=\"", address, "\" target=\"_blank\">", label, "</a><br />\n")
+}
+
+# Function to write code for html images
+HtmlImage <- function(source, label=source, height=600, width=600) {
+  cata("<img src=\"", source, "\" alt=\"", label, "\" height=\"", height)
+  cata("\" width=\"", width, "\"/>\n")
+}
+
+# Function to write code for html list items
+ListItem <- function(...) {
+  cata("<li>", ..., "</li>\n")
+}
+
+TableItem <- function(...) {
+  cata("<td>", ..., "</td>\n")
+}
+
+TableHeadItem <- function(...) {
+  cata("<th>", ..., "</th>\n")
+}
+################################################################################
+### Input Processing
+################################################################################
+
+# Grabbing arguments from command line
+argv <- commandArgs(T)
+
+inputType <- as.character(argv[1])
+if (inputType == "fastq") {
+
+  fastqPath <- as.character(gsub("fastq::", "", argv[grepl("fastq::", argv)],
+                                 fixed=TRUE))
+
+  # Remove fastq paths
+  argv <- argv[!grepl("fastq::", argv, fixed=TRUE)]
+
+  fastqPathRev <- NULL
+  annoPath <- as.character(argv[2])
+  samplePath <- as.character(argv[3])
+  barStart <- as.numeric(argv[4])
+  barEnd <- as.numeric(argv[5])
+  barStartRev <- NULL
+  barStartRev <- NULL
+  hpStart <- as.numeric(argv[8])
+  hpEnd <- as.numeric(argv[9])
+} else if (inputType=="pairedFastq") {
+
+  fastqPath <- as.character(gsub("fastq::", "", argv[grepl("fastq::", argv)],
+                                 fixed=TRUE))
+
+  fastqPathRev <- as.character(gsub("fastqRev::", "",
+                               argv[grepl("fastqRev::", argv)], fixed=TRUE))
+
+  # Remove fastq paths
+  argv <- argv[!grepl("fastq::", argv, fixed=TRUE)]
+  argv <- argv[!grepl("fastqRev::", argv, fixed=TRUE)]
+
+  annoPath <- as.character(argv[2])
+  samplePath <- as.character(argv[3])
+  barStart <- as.numeric(argv[4])
+  barEnd <- as.numeric(argv[5])
+  barStartRev <- as.numeric(argv[6])
+  barEndRev <- as.numeric(argv[7])
+  hpStart <- as.numeric(argv[8])
+  hpEnd <- as.numeric(argv[9])
+} else if (inputType == "counts") {
+  countPath <- as.character(argv[2])
+  annoPath <- as.character(argv[3])
+  samplePath <- as.character(argv[4])
+}
+
+secFactName <- as.character(argv[10])
+cpmReq <- as.numeric(argv[11])
+sampleReq <- as.numeric(argv[12])
+readReq <- as.numeric(argv[13])
+fdrThresh <- as.numeric(argv[14])
+lfcThresh <- as.numeric(argv[15])
+selectDirection <- as.character(argv[16])
+workMode <- as.character(argv[17])
+htmlPath <- as.character(argv[18])
+folderPath <- as.character(argv[19])
+
+if (workMode == "classic") {
+  pairData <- character()
+  pairData[2] <- as.character(argv[20])
+  pairData[1] <- as.character(argv[21])
+} else if (workMode == "glm") {
+  contrastData <- as.character(argv[20])
+  roastOpt <- as.character(argv[21])
+  hairpinReq <- as.numeric(argv[22])
+  selectOpt <- as.character(argv[23])
+  selectVals <- as.character(argv[24])
+}
+
+# Read in inputs
+
+samples <- read.table(samplePath, header=TRUE, sep="\t")
+
+anno <- read.table(annoPath, header=TRUE, sep="\t")
+
+if (inputType == "counts") {
+  counts <- read.table(countPath, header=TRUE, sep="\t")
+}
+
+###################### Check inputs for correctness ############################
+samples$ID <- make.names(samples$ID)
+
+if ( !any(grepl("group", names(samples))) ) {
+  stop("'group' column not specified in sample annotation file")
+} # Check if grouping variable has been specified
+
+if (secFactName != "none") {
+  if ( !any(grepl(secFactName, names(samples))) ) {
+  tempStr <- paste0("Second factor specified as \"", secFactName, "\" but ",
+                    "no such column name found in sample annotation file")
+  stop(tempStr)
+  } # Check if specified secondary factor is present
+}
+
+
+if ( any(table(samples$ID) > 1) ){
+  tab <- table(samples$ID)
+  offenders <- paste(names(tab[tab > 1]), collapse=", ")
+  offenders <- unmake.names(offenders)
+  stop("'ID' column of sample annotation must have unique values, values ",
+       offenders, " are repeated")
+} # Check that IDs in sample annotation are unique
+
+if (inputType == "fastq" || inputType == "pairedFastq") {
+
+  if ( any(table(anno$ID) > 1) ){
+    tab <- table(anno$ID)
+    offenders <- paste(names(tab[tab>1]), collapse=", ")
+    stop("'ID' column of hairpin annotation must have unique values, values ",
+    offenders, " are repeated")
+  } # Check that IDs in hairpin annotation are unique
+
+} else if (inputType == "counts") {
+  # The first element of the colnames will be 'ID' and should not match
+  idFromSample <- samples$ID
+  idFromTable <- colnames(counts)[-1]
+  if (any(is.na(match(idFromTable, idFromSample)))) {
+    stop("not all samples have groups specified")
+  } # Check that a group has be specifed for each sample
+
+  if ( any(table(counts$ID) > 1) ){
+    tab <- table(counts$ID)
+    offenders <- paste(names(tab[tab>1]), collapse=", ")
+    stop("'ID' column of count table must have unique values, values ",
+    offenders, " are repeated")
+  } # Check that IDs in count table are unique
+}
+if (workMode == "glm") {
+  if (roastOpt == "yes") {
+    if (is.na(match("Gene", colnames(anno)))) {
+      tempStr <- paste("Gene-wise tests selected but'Gene' column not",
+                       "specified in hairpin annotation file")
+      stop(tempStr)
+    }
+  }
+}
+
+if (secFactName != "none") {
+  if (workMode != "glm") {
+    tempStr <- paste("only glm analysis type possible when secondary factor",
+                     "used, please change appropriate option.")
+  }
+}
+
+################################################################################
+
+# Process arguments
+if (workMode == "glm") {
+  if (roastOpt == "yes") {
+    wantRoast <- TRUE
+  } else {
+    wantRoast <- FALSE
+  }
+}
+
+# Split up contrasts seperated by comma into a vector and replace spaces with
+# periods
+if (exists("contrastData")) {
+  contrastData <- unlist(strsplit(contrastData, split=","))
+  contrastData <- sanitiseEquation(contrastData)
+  contrastData <- gsub(" ", ".", contrastData, fixed=TRUE)
+}
+
+# Replace spaces with periods in pair data
+if (exists("pairData")) {
+  pairData <- make.names(pairData)
+}
+
+# Generate output folder and paths
+dir.create(folderPath, showWarnings=FALSE)
+
+# Generate links for outputs
+imgOut("barHairpin")
+imgOut("barIndex")
+imgOut("mds")
+imgOut("bcv")
+if (workMode == "classic") {
+  smearPng <- makeOut(paste0("smear(", pairData[2], "-", pairData[1],").png"))
+  smearPdf <- makeOut(paste0("smear(", pairData[2], "-", pairData[1],").pdf"))
+  topOut <- makeOut(paste0("toptag(", pairData[2], "-", pairData[1],").tsv"))
+} else if (workMode == "glm") {
+  smearPng <- character()
+  smearPdf <- character()
+  topOut <- character()
+  roastOut <- character()
+  barcodePng <- character()
+  barcodePdf <- character()
+  for (i in 1:length(contrastData)) {
+    smearPng[i] <- makeOut(paste0("smear(", contrastData[i], ").png"))
+    smearPdf[i] <- makeOut(paste0("smear(", contrastData[i], ").pdf"))
+    topOut[i] <- makeOut(paste0("toptag(", contrastData[i], ").tsv"))
+    roastOut[i] <- makeOut(paste0("gene_level(", contrastData[i], ").tsv"))
+    barcodePng[i] <- makeOut(paste0("barcode(", contrastData[i], ").png"))
+    barcodePdf[i] <- makeOut(paste0("barcode(", contrastData[i], ").pdf"))
+  }
+}
+countsOut <- makeOut("counts.tsv")
+sessionOut <- makeOut("session_info.txt")
+
+# Initialise data for html links and images, table with the link label and
+# link address
+linkData <- data.frame(Label=character(), Link=character(),
+                       stringsAsFactors=FALSE)
+imageData <- data.frame(Label=character(), Link=character(),
+                        stringsAsFactors=FALSE)
+
+# Initialise vectors for storage of up/down/neutral regulated counts
+upCount <- numeric()
+downCount <- numeric()
+flatCount <- numeric()
+
+################################################################################
+### Data Processing
+################################################################################
+
+# Transform gene selection from string into index values for mroast
+if (workMode == "glm") {
+  if (selectOpt == "rank") {
+    selectVals <- gsub(" ", "", selectVals, fixed=TRUE)
+    selectVals <- unlist(strsplit(selectVals, ","))
+
+    for (i in 1:length(selectVals)) {
+      if (grepl(":", selectVals[i], fixed=TRUE)) {
+        temp <- unlist(strsplit(selectVals[i], ":"))
+        selectVals <- selectVals[-i]
+        a <- as.numeric(temp[1])
+        b <- as.numeric(temp[2])
+        selectVals <- c(selectVals, a:b)
+      }
+    }
+    selectVals <- as.numeric(unique(selectVals))
+  } else {
+    selectVals <- gsub(" ", "", selectVals, fixed=TRUE)
+    selectVals <- unlist(strsplit(selectVals, ","))
+  }
+}
+
+if (inputType == "fastq" || inputType == "pairedFastq") {
+  # Use EdgeR hairpin process and capture outputs
+
+  hpReadout <- capture.output(
+  data <- processAmplicons(readfile=fastqPath, readfile2=fastqPathRev,
+                            barcodefile=samplePath,
+                            hairpinfile=annoPath,
+                            barcodeStart=barStart, barcodeEnd=barEnd,
+                            barcodeStartRev=barStartRev,
+                            barcodeEndRev=barEndRev,
+                            hairpinStart=hpStart, hairpinEnd=hpEnd,
+                            verbose=TRUE)
+  )
+
+  # Remove function output entries that show processing data or is empty
+  hpReadout <- hpReadout[hpReadout!=""]
+  hpReadout <- hpReadout[!grepl("Processing", hpReadout)]
+  hpReadout <- hpReadout[!grepl("in file", hpReadout)]
+  hpReadout <- gsub(" -- ", "", hpReadout, fixed=TRUE)
+
+  # Make the names of groups syntactically valid (replace spaces with periods)
+  data$samples$group <- make.names(data$samples$group)
+  if (secFactName != "none") {
+    data$samples[[secFactName]] <- make.names(data$samples[[secFactName]])
+  }
+} else if (inputType == "counts") {
+  # Process counts information, set ID column to be row names
+  rownames(counts) <- counts$ID
+  counts <- counts[ , !(colnames(counts) == "ID")]
+  countsRows <- nrow(counts)
+
+  # Process group information
+  sampleNames <- colnames(counts)
+  matchedIndex <- match(sampleNames, samples$ID)
+  factors <- samples$group[matchedIndex]
+
+  if (secFactName != "none") {
+    secFactors <- samples[[secFactName]][matchedIndex]
+  }
+
+  annoRows <- nrow(anno)
+  anno <- anno[match(rownames(counts), anno$ID), ]
+  annoMatched <- sum(!is.na(anno$ID))
+
+  if (any(is.na(anno$ID))) {
+    warningStr <- paste("count table contained more hairpins than",
+                        "specified in hairpin annotation file")
+    warning(warningStr)
+  }
+
+  # Filter out rows with zero counts
+  sel <- rowSums(counts)!=0
+  counts <- counts[sel, ]
+  anno <- anno[sel, ]
+
+  # Create DGEList
+  data <- DGEList(counts=counts, lib.size=colSums(counts),
+                  norm.factors=rep(1,ncol(counts)), genes=anno, group=factors)
+
+  # Make the names of groups syntactically valid (replace spaces with periods)
+  data$samples$group <- make.names(data$samples$group)
+}
+
+# Filter out any samples with zero counts
+if (any(data$samples$lib.size == 0)) {
+  sampleSel <- data$samples$lib.size != 0
+  filteredSamples <- paste(data$samples$ID[!sampleSel], collapse=", ")
+  data$counts <- data$counts[, sampleSel]
+  data$samples <- data$samples[sampleSel, ]
+}
+
+# Filter hairpins with low counts
+preFilterCount <- nrow(data)
+selRow <- rowSums(cpm(data$counts) > cpmReq) >= sampleReq
+selCol <- colSums(data$counts) > readReq
+data <- data[selRow, selCol]
+
+# Check if any data survived filtering
+if (length(data$counts) == 0) {
+  stop("no data remains after filtering, consider relaxing filters")
+}
+
+# Count number of filtered tags and samples
+postFilterCount <- nrow(data)
+filteredCount <- preFilterCount - postFilterCount
+sampleFilterCount <- sum(!selCol)
+
+if (secFactName == "none") {
+  # Estimate dispersions
+  data <- estimateDisp(data)
+  commonBCV <- round(sqrt(data$common.dispersion), 4)
+} else {
+  # Construct design
+  if (inputType == "counts") {
+
+    sampleNames <- colnames(counts)
+    matchedIndex <- match(sampleNames, samples$ID)
+    factors <- factor(make.names(samples$group[matchedIndex]))
+
+    secFactors <- factor(make.names(samples[[secFactName]][matchedIndex]))
+
+  } else if (inputType == "fastq" || inputType == "pairedFastq") {
+
+    factors <- factor(data$sample$group)
+    secFactors <- factor(data$sample[[secFactName]])
+
+  }
+
+  design <- model.matrix(~0 + factors + secFactors)
+
+  # Estimate dispersions
+  data <- estimateDisp(data, design=design)
+  commonBCV <- round(sqrt(data$common.dispersion), 4)
+}
+
+
+################################################################################
+### Output Processing
+################################################################################
+
+# Plot number of hairpins that could be matched per sample
+png(barIndexPng, width=600, height=600)
+barplot(height<-colSums(data$counts), las=2, main="Counts per index",
+        cex.names=1.0, cex.axis=0.8, ylim=c(0, max(height)*1.2))
+imageData[1, ] <- c("Counts per Index", "barIndex.png")
+invisible(dev.off())
+
+pdf(barIndexPdf)
+barplot(height<-colSums(data$counts), las=2, main="Counts per index",
+        cex.names=1.0, cex.axis=0.8, ylim=c(0, max(height)*1.2))
+linkData[1, ] <- c("Counts per Index Barplot (.pdf)", "barIndex.pdf")
+invisible(dev.off())
+
+# Plot per hairpin totals across all samples
+png(barHairpinPng, width=600, height=600)
+if (nrow(data$counts)<50) {
+  barplot(height<-rowSums(data$counts), las=2, main="Counts per hairpin",
+          cex.names=0.8, cex.axis=0.8, ylim=c(0, max(height)*1.2))
+} else {
+  barplot(height<-rowSums(data$counts), las=2, main="Counts per hairpin",
+          cex.names=0.8, cex.axis=0.8, ylim=c(0, max(height)*1.2),
+          names.arg=FALSE)
+}
+imageData <- rbind(imageData, c("Counts per Hairpin", "barHairpin.png"))
+invisible(dev.off())
+
+pdf(barHairpinPdf)
+if (nrow(data$counts)<50) {
+  barplot(height<-rowSums(data$counts), las=2, main="Counts per hairpin",
+          cex.names=0.8, cex.axis=0.8, ylim=c(0, max(height)*1.2))
+} else {
+  barplot(height<-rowSums(data$counts), las=2, main="Counts per hairpin",
+          cex.names=0.8, cex.axis=0.8, ylim=c(0, max(height)*1.2),
+          names.arg=FALSE)
+}
+newEntry <- c("Counts per Hairpin Barplot (.pdf)", "barHairpin.pdf")
+linkData <- rbind(linkData, newEntry)
+invisible(dev.off())
+
+# Make an MDS plot to visualise relationships between replicate samples
+png(mdsPng, width=600, height=600)
+plotMDS(data, labels=data$samples$group, col=as.numeric(data$samples$group), main="MDS Plot")
+imageData <- rbind(imageData, c("MDS Plot", "mds.png"))
+invisible(dev.off())
+
+pdf(mdsPdf)
+plotMDS(data, labels=data$samples$group, col=as.numeric(data$samples$group),main="MDS Plot")
+newEntry <- c("MDS Plot (.pdf)", "mds.pdf")
+linkData <- rbind(linkData, newEntry)
+invisible(dev.off())
+
+# BCV Plot
+png(bcvPng, width=600, height=600)
+plotBCV(data, main="BCV Plot")
+imageData <- rbind(imageData, c("BCV Plot", "bcv.png"))
+invisible(dev.off())
+
+pdf(bcvPdf)
+plotBCV(data, main="BCV Plot")
+newEntry <- c("BCV Plot (.pdf)", "bcv.pdf")
+linkData <- rbind(linkData, newEntry)
+invisible(dev.off())
+
+if (workMode == "classic") {
+  # Assess differential representation using classic exact testing methodology
+  # in edgeR
+  testData <- exactTest(data, pair=pairData)
+
+  top <- topTags(testData, n=Inf)
+
+  if (selectDirection == "all") {
+    topIDs <- top$table[(top$table$FDR < fdrThresh) &
+                      (abs(top$table$logFC) > lfcThresh), 1]
+  } else if (selectDirection == "up") {
+    topIDs <- top$table[(top$table$FDR < fdrThresh) &
+                      (top$table$logFC > lfcThresh), 1]
+  } else if (selectDirection == "down") {
+  topIDs <- top$table[(top$table$FDR < fdrThresh) &
+                      (top$table$logFC < -lfcThresh), 1]
+}
+
+  write.table(top, file=topOut, row.names=FALSE, sep="\t")
+
+  linkName <- paste0("Top Tags Table(", pairData[2], "-", pairData[1],
+                     ") (.tsv)")
+  linkAddr <- paste0("toptag(", pairData[2], "-", pairData[1], ").tsv")
+  linkData <- rbind(linkData, c(linkName, linkAddr))
+
+  upCount[1] <- sum(top$table$FDR < fdrThresh & top$table$logFC > lfcThresh)
+
+  downCount[1] <- sum(top$table$FDR < fdrThresh &
+                      top$table$logFC < -lfcThresh)
+
+  flatCount[1] <- sum(top$table$FDR > fdrThresh |
+                      abs(top$table$logFC) < lfcThresh)
+
+
+
+  # Select hairpins with FDR < 0.05 to highlight on plot
+  png(smearPng, width=600, height=600)
+  plotTitle <- gsub(".", " ",
+                    paste0("Smear Plot: ", pairData[2], "-", pairData[1]),
+                    fixed=TRUE)
+  plotSmear(testData, de.tags=topIDs,
+            pch=20, cex=1.0, main=plotTitle)
+  abline(h=c(-1, 0, 1), col=c("dodgerblue", "yellow", "dodgerblue"), lty=2)
+  imgName <- paste0("Smear Plot(", pairData[2], "-", pairData[1], ")")
+  imgAddr <- paste0("smear(", pairData[2], "-", pairData[1],").png")
+  imageData <- rbind(imageData, c(imgName, imgAddr))
+  invisible(dev.off())
+
+  pdf(smearPdf)
+  plotTitle <- gsub(".", " ",
+                    paste0("Smear Plot: ", pairData[2], "-", pairData[1]),
+                    fixed=TRUE)
+  plotSmear(testData, de.tags=topIDs,
+            pch=20, cex=1.0, main=plotTitle)
+  abline(h=c(-1, 0, 1), col=c("dodgerblue", "yellow", "dodgerblue"), lty=2)
+  imgName <- paste0("Smear Plot(", pairData[2], "-", pairData[1], ") (.pdf)")
+  imgAddr <- paste0("smear(", pairData[2], "-", pairData[1], ").pdf")
+  linkData <- rbind(linkData, c(imgName, imgAddr))
+  invisible(dev.off())
+
+} else if (workMode == "glm") {
+  # Generating design information
+  if (secFactName == "none") {
+
+    factors <- factor(data$sample$group)
+    design <- model.matrix(~0 + factors)
+
+    colnames(design) <- gsub("factors", "", colnames(design), fixed=TRUE)
+
+  } else {
+
+    factors <- factor(data$sample$group)
+
+    if (inputType == "counts") {
+
+      sampleNames <- colnames(counts)
+      matchedIndex <- match(sampleNames, samples$ID)
+      factors <- factor(samples$group[matchedIndex])
+
+      secFactors <- factor(samples[[secFactName]][matchedIndex])
+
+    } else if (inputType == "fastq" || inputType == "pairedFastq") {
+
+      secFactors <- factor(data$sample[[secFactName]])
+
+    }
+
+    design <- model.matrix(~0 + factors + secFactors)
+
+    colnames(design) <- gsub("factors", "", colnames(design), fixed=TRUE)
+    colnames(design) <- gsub("secFactors", secFactName, colnames(design),
+                              fixed=TRUE)
+  }
+
+
+  # Split up contrasts seperated by comma into a vector
+  contrastData <- unlist(strsplit(contrastData, split=","))
+
+  for (i in 1:length(contrastData)) {
+    # Generate contrasts information
+    contrasts <- makeContrasts(contrasts=contrastData[i], levels=design)
+
+    # Fit negative bionomial GLM
+    fit <- glmFit(data, design)
+    # Carry out Likelihood ratio test
+    testData <- glmLRT(fit, contrast=contrasts)
+
+    # Select hairpins with FDR < 0.05 to highlight on plot
+    top <- topTags(testData, n=Inf)
+
+    if (selectDirection == "all") {
+      topIDs <- top$table[(top$table$FDR < fdrThresh) &
+                        (abs(top$table$logFC) > lfcThresh), 1]
+    } else if (selectDirection == "up") {
+      topIDs <- top$table[(top$table$FDR < fdrThresh) &
+                        (top$table$logFC > lfcThresh), 1]
+    } else if (selectDirection == "down") {
+      topIDs <- top$table[(top$table$FDR < fdrThresh) &
+                        (top$table$logFC < -lfcThresh), 1]
+    }
+
+    write.table(top, file=topOut[i], row.names=FALSE, sep="\t")
+
+    linkName <- paste0("Top Tags Table(", contrastData[i], ") (.tsv)")
+    linkAddr <- paste0("toptag(", contrastData[i], ").tsv")
+    linkData <- rbind(linkData, c(linkName, linkAddr))
+
+    # Collect counts for differential representation
+    upCount[i] <- sum(top$table$FDR < fdrThresh & top$table$logFC > lfcThresh)
+    downCount[i] <- sum(top$table$FDR < fdrThresh &
+                        top$table$logFC < -lfcThresh)
+    flatCount[i] <- sum(top$table$FDR > fdrThresh |
+                        abs(top$table$logFC) < lfcThresh)
+
+    # Make a plot of logFC versus logCPM
+    png(smearPng[i], height=600, width=600)
+    plotTitle <- paste("Smear Plot:", gsub(".", " ", contrastData[i],
+                       fixed=TRUE))
+    plotSmear(testData, de.tags=topIDs, pch=20, cex=0.8, main=plotTitle)
+    abline(h=c(-1, 0, 1), col=c("dodgerblue", "yellow", "dodgerblue"), lty=2)
+
+    imgName <- paste0("Smear Plot(", contrastData[i], ")")
+    imgAddr <- paste0("smear(", contrastData[i], ").png")
+    imageData <- rbind(imageData, c(imgName, imgAddr))
+    invisible(dev.off())
+
+    pdf(smearPdf[i])
+    plotTitle <- paste("Smear Plot:", gsub(".", " ", contrastData[i],
+                       fixed=TRUE))
+    plotSmear(testData, de.tags=topIDs, pch=20, cex=0.8, main=plotTitle)
+    abline(h=c(-1, 0, 1), col=c("dodgerblue", "yellow", "dodgerblue"), lty=2)
+
+    linkName <- paste0("Smear Plot(", contrastData[i], ") (.pdf)")
+    linkAddr <- paste0("smear(", contrastData[i], ").pdf")
+    linkData <- rbind(linkData, c(linkName, linkAddr))
+    invisible(dev.off())
+
+    genes <- as.character(data$genes$Gene)
+    unq <- unique(genes)
+    unq <- unq[!is.na(unq)]
+    geneList <- list()
+    for (gene in unq) {
+      if (length(which(genes == gene)) >= hairpinReq) {
+        geneList[[gene]] <- which(genes == gene)
+      }
+    }
+
+    if (wantRoast) {
+      # Input preparaton for roast
+      nrot <- 9999
+      set.seed(602214129)
+      roastData <- mroast(data, index=geneList, design=design,
+                         contrast=contrasts, nrot=nrot)
+      roastData <- cbind(GeneID=rownames(roastData), roastData)
+      write.table(roastData, file=roastOut[i], row.names=FALSE, sep="\t")
+      linkName <- paste0("Gene Level Analysis Table(", contrastData[i],
+                         ") (.tsv)")
+      linkAddr <- paste0("gene_level(", contrastData[i], ").tsv")
+      linkData <- rbind(linkData, c(linkName, linkAddr))
+      if (selectOpt == "rank") {
+        selectedGenes <- rownames(roastData)[selectVals]
+      } else {
+        selectedGenes <- selectVals
+      }
+
+      if (packageVersion("limma")<"3.19.19") {
+        png(barcodePng[i], width=600, height=length(selectedGenes)*150)
+      } else {
+        png(barcodePng[i], width=600, height=length(selectedGenes)*300)
+      }
+      par(mfrow=c(length(selectedGenes), 1))
+      for (gene in selectedGenes) {
+        barcodeplot(testData$table$logFC, index=geneList[[gene]],
+                    main=paste("Barcode Plot for", gene, "(logFCs)",
+                               gsub(".", " ", contrastData[i])),
+                    labels=c("Positive logFC", "Negative logFC"))
+      }
+      imgName <- paste0("Barcode Plot(", contrastData[i], ")")
+      imgAddr <- paste0("barcode(", contrastData[i], ").png")
+      imageData <- rbind(imageData, c(imgName, imgAddr))
+      dev.off()
+      if (packageVersion("limma")<"3.19.19") {
+        pdf(barcodePdf[i], width=8, height=2)
+      } else {
+        pdf(barcodePdf[i], width=8, height=4)
+      }
+      for (gene in selectedGenes) {
+        barcodeplot(testData$table$logFC, index=geneList[[gene]],
+                    main=paste("Barcode Plot for", gene, "(logFCs)",
+                               gsub(".", " ", contrastData[i])),
+                    labels=c("Positive logFC", "Negative logFC"))
+      }
+      linkName <- paste0("Barcode Plot(", contrastData[i], ") (.pdf)")
+      linkAddr <- paste0("barcode(", contrastData[i], ").pdf")
+      linkData <- rbind(linkData, c(linkName, linkAddr))
+      dev.off()
+    }
+  }
+}
+
+# Generate data frame of the significant differences
+sigDiff <- data.frame(Up=upCount, Flat=flatCount, Down=downCount)
+if (workMode == "glm") {
+
+  row.names(sigDiff) <- contrastData
+
+} else if (workMode == "classic") {
+
+  row.names(sigDiff) <- paste0(pairData[2], "-", pairData[1])
+
+}
+
+# Output table of summarised counts
+ID <- rownames(data$counts)
+outputCounts <- cbind(ID, data$counts)
+write.table(outputCounts, file=countsOut, row.names=FALSE, sep="\t",
+            quote=FALSE)
+linkName <- "Counts table (.tsv)"
+linkAddr <- "counts.tsv"
+linkData <- rbind(linkData, c(linkName, linkAddr))
+
+# Record session info
+writeLines(capture.output(sessionInfo()), sessionOut)
+linkData <- rbind(linkData, c("Session Info", "session_info.txt"))
+
+# Record ending time and calculate total run time
+timeEnd <- as.character(Sys.time())
+timeTaken <- capture.output(round(difftime(timeEnd,timeStart), digits=3))
+timeTaken <- gsub("Time difference of ", "", timeTaken, fixed=TRUE)
+################################################################################
+### HTML Generation
+################################################################################
+# Clear file
+cat("", file=htmlPath)
+
+cata("<html>\n")
+HtmlHead("EdgeR Output")
+
+cata("<body>\n")
+cata("<h3>EdgeR Analysis Output:</h3>\n")
+cata("<h4>Input Summary:</h4>\n")
+if (inputType == "fastq" || inputType == "pairedFastq") {
+
+  cata("<ul>\n")
+  ListItem(hpReadout[1])
+  ListItem(hpReadout[2])
+  cata("</ul>\n")
+  cata(hpReadout[3], "<br />\n")
+  cata("<ul>\n")
+  ListItem(hpReadout[4])
+  ListItem(hpReadout[7])
+  cata("</ul>\n")
+  cata(hpReadout[8:11], sep="<br />\n")
+  cata("<br />\n")
+  cata("<b>Please check that read percentages are consistent with ")
+  cata("expectations.</b><br >\n")
+
+} else if (inputType == "counts") {
+
+  cata("<ul>\n")
+  ListItem("Number of Samples: ", ncol(data$counts))
+  ListItem("Number of Hairpins: ", countsRows)
+  ListItem("Number of annotations provided: ", annoRows)
+  ListItem("Number of annotations matched to hairpin: ", annoMatched)
+  cata("</ul>\n")
+
+}
+
+cata("The estimated common biological coefficient of variation (BCV) is: ",
+     commonBCV, "<br />\n")
+
+if (secFactName == "none") {
+
+  cata("No secondary factor specified.<br />\n")
+
+} else {
+
+  cata("Secondary factor specified as: ", secFactName, "<br />\n")
+
+}
+
+cata("<h4>Output:</h4>\n")
+cata("PDF copies of JPEGS available in 'Plots' section.<br />\n")
+for (i in 1:nrow(imageData)) {
+  if (grepl("barcode", imageData$Link[i])) {
+
+    if (packageVersion("limma")<"3.19.19") {
+
+      HtmlImage(imageData$Link[i], imageData$Label[i],
+                height=length(selectedGenes)*150)
+
+    } else {
+
+      HtmlImage(imageData$Link[i], imageData$Label[i],
+                height=length(selectedGenes)*300)
+
+    }
+  } else {
+
+    HtmlImage(imageData$Link[i], imageData$Label[i])
+
+  }
+}
+cata("<br />\n")
+
+cata("<h4>Differential Representation Counts:</h4>\n")
+
+cata("<table border=\"1\" cellpadding=\"4\">\n")
+cata("<tr>\n")
+TableItem()
+for (i in colnames(sigDiff)) {
+  TableHeadItem(i)
+}
+cata("</tr>\n")
+for (i in 1:nrow(sigDiff)) {
+  cata("<tr>\n")
+  TableHeadItem(unmake.names(row.names(sigDiff)[i]))
+  for (j in 1:ncol(sigDiff)) {
+    TableItem(as.character(sigDiff[i, j]))
+  }
+  cata("</tr>\n")
+}
+cata("</table>")
+
+cata("<h4>Plots:</h4>\n")
+for (i in 1:nrow(linkData)) {
+  if (grepl(".pdf", linkData$Link[i])) {
+    HtmlLink(linkData$Link[i], linkData$Label[i])
+  }
+}
+
+cata("<h4>Tables:</h4>\n")
+for (i in 1:nrow(linkData)) {
+  if (grepl(".tsv", linkData$Link[i])) {
+    HtmlLink(linkData$Link[i], linkData$Label[i])
+  }
+}
+
+cata("<p>Alt-click links to download file.</p>\n")
+cata("<p>Click floppy disc icon on associated history item to download ")
+cata("all files.</p>\n")
+cata("<p>.tsv files can be viewed in Excel or any spreadsheet program.</p>\n")
+
+cata("<h4>Additional Information:</h4>\n")
+
+if (inputType == "fastq") {
+
+  ListItem("Data was gathered from fastq raw read file(s).")
+
+} else if (inputType == "counts") {
+
+  ListItem("Data was gathered from a table of counts.")
+
+}
+
+if (cpmReq != 0 && sampleReq != 0) {
+  tempStr <- paste("Target sequences without more than", cpmReq,
+                   "CPM in at least", sampleReq, "samples are insignificant",
+                   "and filtered out.")
+  ListItem(tempStr)
+
+  filterProp <- round(filteredCount/preFilterCount*100, digits=2)
+  tempStr <- paste0(filteredCount, " of ", preFilterCount," (", filterProp,
+                   "%) target sequences were filtered out for low ",
+                   "count-per-million.")
+  ListItem(tempStr)
+}
+
+if (readReq != 0) {
+  tempStr <- paste("Samples that did not produce more than", readReq,
+                   "counts were filtered out.")
+  ListItem(tempStr)
+
+  tempStr <- paste0(sampleFilterCount, " samples were filtered out for low ",
+                    "counts.")
+  ListItem(tempStr)
+}
+
+if (exists("filteredSamples")) {
+  tempStr <- paste("The following samples were filtered out for having zero",
+                   "library size: ", filteredSamples)
+  ListItem(tempStr)
+}
+
+if (workMode == "classic") {
+  ListItem("An exact test was performed on each target sequence.")
+} else if (workMode == "glm") {
+  ListItem("A generalised linear model was fitted to each target sequence.")
+}
+
+cit <- character()
+link <-character()
+link[1] <- paste0("<a href=\"",
+                  "http://www.bioconductor.org/packages/release/bioc/",
+                  "vignettes/limma/inst/doc/usersguide.pdf",
+                  "\">", "limma User's Guide", "</a>.")
+link[2] <- paste0("<a href=\"",
+                  "http://www.bioconductor.org/packages/release/bioc/",
+                  "vignettes/edgeR/inst/doc/edgeRUsersGuide.pdf",
+                  "\">", "edgeR User's Guide", "</a>")
+
+cit[1] <- paste("Robinson MD, McCarthy DJ and Smyth GK (2010).",
+                "edgeR: a Bioconductor package for differential",
+                "expression analysis of digital gene expression",
+                "data. Bioinformatics 26, 139-140")
+cit[2] <- paste("Robinson MD and Smyth GK (2007). Moderated statistical tests",
+                "for assessing differences in tag abundance. Bioinformatics",
+                "23, 2881-2887")
+cit[3] <- paste("Robinson MD and Smyth GK (2008). Small-sample estimation of",
+                "negative binomial dispersion, with applications to SAGE data.",
+                "Biostatistics, 9, 321-332")
+
+cit[4] <- paste("McCarthy DJ, Chen Y and Smyth GK (2012). Differential",
+                "expression analysis of multifactor RNA-Seq experiments with",
+                "respect to biological variation. Nucleic Acids Research 40,",
+                "4288-4297")
+
+cata("<h4>Citations</h4>")
+cata("<ol>\n")
+ListItem(cit[1])
+ListItem(cit[2])
+ListItem(cit[3])
+ListItem(cit[4])
+cata("</ol>\n")
+
+cata("<p>Report problems to: su.s@wehi.edu.au</p>\n")
+
+for (i in 1:nrow(linkData)) {
+  if (grepl("session_info", linkData$Link[i])) {
+    HtmlLink(linkData$Link[i], linkData$Label[i])
+  }
+}
+
+cata("<table border=\"0\">\n")
+cata("<tr>\n")
+TableItem("Task started at:"); TableItem(timeStart)
+cata("</tr>\n")
+cata("<tr>\n")
+TableItem("Task ended at:"); TableItem(timeEnd)
+cata("</tr>\n")
+cata("<tr>\n")
+TableItem("Task run time:"); TableItem(timeTaken)
+cata("<tr>\n")
+cata("</table>\n")
+
+cata("</body>\n")
+cata("</html>")
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/hairpinTool.xml	Mon Jan 19 22:14:10 2015 -0500
@@ -0,0 +1,645 @@
+<?xml version="1.0"?>
+<tool id="shrnaseq" name="shRNAseq" version="1.2.1">
+  <description>
+    for differential representation for shRNAseq and sgRNA
+  </description>
+
+  <requirements>
+    <requirement type="package" version="3.1.2">R</requirement>
+    <requirement type="package" version="0.1">shrnaseq_r</requirement>
+    <requirement type="set_environment">HAIRPINTOOL_R_SOURCE</requirement>
+  </requirements>
+
+  <stdio>
+    <exit_code range="1:" level="fatal" description="Tool exception" />
+  </stdio>
+
+  <command>
+  Rscript \$HAIRPINTOOL_R_SOURCE "$inputOpt.inputType"
+                #if $inputOpt.inputType=="fastq":
+
+                  #for $i, $fas in enumerate($inputOpt.fastq):
+                    fastq::$fas.file
+                  #end for
+
+                  "$inputOpt.hairpin"
+                  "$inputOpt.samples"
+
+                  #if $inputOpt.positions.posOption=="yes":
+                    $inputOpt.positions.barstart
+                    $inputOpt.positions.barend
+                    0
+                    0
+                    $inputOpt.positions.hpstart
+                    $inputOpt.positions.hpend
+                  #else:
+                    1
+                    5
+                    0
+                    0
+                    37
+                    57
+                  #end if
+                #elif $inputOpt.inputType=="pairedFastq":
+
+                  #for $i, $fas in enumerate($inputOpt.fastq):
+                    fastq::$fas.file
+                  #end for
+
+                  #for $i, $fas in enumerate($inputOpt.fastq):
+                    fastqRev::$fas.fileRev
+                  #end for
+
+                  "$inputOpt.hairpin"
+                  "$inputOpt.samples"
+
+                  #if $inputOpt.positions.posOption=="yes":
+                    $inputOpt.positions.barstart
+                    $inputOpt.positions.barend
+                    $inputOpt.positions.barstartRev
+                    $inputOpt.positions.barendRev
+                    $inputOpt.positions.hpstart
+                    $inputOpt.positions.hpend
+                  #else:
+                    1
+                    5
+                    0
+                    0
+                    37
+                    57
+                  #end if
+
+                #elif $inputOpt.inputType=="counts":
+                  "$inputOpt.counts"
+                  "$inputOpt.hairpin"
+                  "$inputOpt.samples"
+                  0
+                  0
+                  0
+                  0
+                  0
+                #end if
+
+                #if $inputOpt.secondaryFactor.secFactorOpt=="yes":
+                  "$inputOpt.secondaryFactor.secFactName"
+                #else:
+                  "none"
+                #end if
+
+                #if $filterCPM.filtOption=="yes":
+                  $filterCPM.cpmReq
+                  $filterCPM.sampleReq
+                  $filterCPM.readReq
+                #else:
+                  -Inf
+                  -Inf
+                  -Inf
+                #end if
+
+                "$fdr"
+                "$lfc"
+                "$direction"
+                "$workMode.mode"
+                "$outFile"
+                "$outFile.files_path"
+
+                #if $workMode.mode=="classic":
+                  "$workMode.pair1"
+                  "$workMode.pair2"
+                #elif $workMode.mode=="glm":
+                  "$workMode.contrast"
+                  "$workMode.roast.roastOption"
+
+                  #if $workMode.roast.roastOption=="yes":
+                    "$workMode.roast.hairpinReq"
+                    "$workMode.roast.select.selOption"
+                    "$workMode.roast.select.selection"
+                  #else:
+                    0
+                    0
+                    0
+                  #end if
+
+                #end if
+  </command>
+
+  <inputs>
+    <conditional name="inputOpt">
+
+      <param name="inputType" type="select" label="Input File Type">
+        <option value="fastq">FastQ File</option>
+        <option value="pairedFastq">Paired FastQ File</option>
+        <option value="counts">Table of Counts</option>
+      </param>
+
+      <when value="fastq">
+        <param name="hairpin" type="data" format="tabular"
+               label="Target Annotation"/>
+
+        <param name="samples" type="data" format="tabular"
+               label="Sample Annotation"/>
+
+        <repeat name="fastq" title="FastQ Files">
+          <param name="file" type="data" format="fastq"/>
+        </repeat>
+
+        <conditional name="secondaryFactor">
+
+          <param name="secFactorOpt" type="select"
+                 label="Include Secondary Factor">
+
+            <option value="no" selected="True">No</option>
+
+            <option value="yes">Yes</option>
+
+          </param>
+
+          <when value="yes">
+
+            <param name="secFactName" type="text" label="Secondary Factor Name"
+                   size="80"/>
+
+          </when>
+
+          <when value="no">
+          </when>
+        </conditional>
+
+        <conditional name="positions">
+          <param name="posOption" type="select"
+                 label="Specify Sample Index and Target Sequence Locations?"
+                 help="Default Positions: Index: 1 to 5, Target: 37 to 57.">
+            <option value="no" selected="True">No</option>
+            <option value="yes">Yes</option>
+          </param>
+
+          <when value="yes">
+            <param name="barstart" type="integer" value="1"
+                   label="Index Starting Position"/>
+            <param name="barend" type="integer" value="5"
+                   label="Index Ending Position"/>
+
+            <param name="hpstart" type="integer" value="37"
+                   label="Target Starting Position"/>
+
+            <param name="hpend" type="integer" value="57"
+                   label="Target Ending Position"/>
+          </when>
+
+          <when value="no"/>
+        </conditional>
+      </when>
+
+      <when value="pairedFastq">
+        <param name="hairpin" type="data" format="tabular"
+               label="Target Sequence Annotation"/>
+
+        <param name="samples" type="data" format="tabular"
+               label="Sample Annotation"/>
+
+        <repeat name="fastq" title="FastQ Files">
+          <param name="file" type="data" format="fastq"/>
+          <param name="fileRev" type="data" format="fastq"/>
+        </repeat>
+
+        <conditional name="secondaryFactor">
+
+          <param name="secFactorOpt" type="select"
+                 label="Include Secondary Factor">
+
+            <option value="no" selected="True">No</option>
+
+            <option value="yes">Yes</option>
+
+          </param>
+
+          <when value="yes">
+
+            <param name="secFactName" type="text" label="Secondary Factor Name"
+                   size="80"/>
+
+          </when>
+
+          <when value="no">
+          </when>
+        </conditional>
+
+        <conditional name="positions">
+
+          <param name="posOption" type="select"
+                 label="Specify Sample Index and Target Sequence Locations?"
+                 help="Default Positions: Index: 1 to 5, Input required for
+                       reverse end, Target: 37 to 57.">
+
+            <option value="no" selected="True">No</option>
+
+            <option value="yes">Yes</option>
+
+          </param>
+
+          <when value="yes">
+            <param name="barstart" type="integer" value="1"
+                   label="Index Starting Position"/>
+
+            <param name="barend" type="integer" value="5"
+                   label="Index Ending Position"/>
+
+            <param name="barstartRev" type="integer" value="0"
+                   label="Reverse Index Starting Position"/>
+
+            <param name="barendRev" type="integer" value="0"
+                   label="Reverse Index Ending Position"/>
+
+            <param name="hpstart" type="integer" value="37"
+                   label="Target Starting Position"/>
+
+            <param name="hpend" type="integer" value="57"
+                   label="Target Ending Position"/>
+          </when>
+
+          <when value="no">
+          </when>
+
+        </conditional>
+
+      </when>
+
+      <when value="counts">
+
+        <param name="counts" type="data" format="tabular" label="Counts Table"/>
+
+        <param name="hairpin" type="data" format="tabular"
+               label="Target Sequence Annotation"/>
+
+        <param name="samples" type="data" format="tabular"
+               label="Sample Annotation"/>
+
+        <conditional name="secondaryFactor">
+
+          <param name="secFactorOpt" type="select"
+                 label="Include Secondary Factor">
+
+            <option value="no" selected="True">No</option>
+
+            <option value="yes">Yes</option>
+
+          </param>
+
+          <when value="yes">
+
+            <param name="secFactName" type="text" label="Secondary Factor Name"
+                   size="80"/>
+
+          </when>
+
+          <when value="no">
+          </when>
+
+        </conditional>
+
+      </when>
+
+    </conditional>
+
+    <conditional name="filterCPM">
+      <param name="filtOption" type="select" label="Filter Low CPM?"
+       help="Ignore target sequences with very low representation when
+             performing analysis.">
+        <option value="yes">Yes</option>
+        <option value="no">No</option>
+      </param>
+
+        <when value="yes">
+          <param name="cpmReq" type="float" value="0.5" min="0"
+                 label="Minimum CPM"/>
+
+          <param name="sampleReq" type="integer" value="1" min="0"
+                 label="Minimum Samples"
+                 help="Filter out all the genes that do not meet the minimum
+                       CPM in at least this many samples."/>
+
+          <param name="readReq" type="integer" value="1000" min="0"
+                 label="Minimum Reads"
+                 help="Filter out all samples that do not have the minimum
+                       number of reads."/>
+
+        </when>
+
+        <when value="no"/>
+
+    </conditional>
+
+    <conditional name="workMode">
+      <param name="mode" type="select" label="Analysis Type"
+       help="Classic Exact Tests are useful for simple comparisons across
+             two sampling groups. Generalised linear models allow for more
+             complex contrasts and gene level analysis to be made.">
+        <option value="classic">Classic Exact Test</option>
+        <option value="glm">Generalised Linear Model</option>
+      </param>
+
+      <when value="classic">
+        <param name="pair1" type="text" label="Compare" size="40"/>
+        <param name="pair2" type="text" label="To" size="40"
+               help="The analysis will subtract values of this group from those
+                     in the group above to establish the difference."/>
+      </when>
+
+      <when value="glm">
+        <param name="contrast" type="text" size="60"
+               label="Contrasts of interest"
+               help="Specify equations defining contrasts to be made. Eg.
+                     KD-Control will result in positive fold change if KD has
+                     greater expression and negative if Control has greater
+                     expression."/>
+
+        <conditional name="roast">
+          <param name="roastOption" type="select"
+                 label="Perform Gene Level Analysis?"
+                 help="Analyse LogFC tendencies for target sequences belonging
+                       to the same gene. NOTE: this is a slow procedure that
+                       scales badly with the number of genes analysed.">
+            <option value="no">No</option>
+            <option value="yes">Yes</option>
+          </param>
+
+          <when value="yes">
+            <param name="hairpinReq" type="integer" value="2" min="2"
+                   label="Minimum Targets Found"
+                   help="Only genes with at least this many target sequences
+                         found will be analysed."/>
+
+            <conditional name="select">
+              <param name="selOption" type="select"
+                     label="Gene Selection Method">
+                <option value="rank">By p-value Rank</option>
+                <option value="geneID">By Gene Identifier</option>
+              </param>
+              <when value="rank">
+                <param name="selection" type="text" size="40" value="1:5"
+                       label="Ranks of Top Genes to Plot"
+                       help="Genes are ranked in ascending p-value for
+                             differential representation, individual ranks can
+                             be entered seperated by comma or a range seperated
+                             by colon."/>
+              </when>
+              <when value="geneID">
+                <param name="selection" type="text" size="80" value=""
+                       label="Symbols of Genes to Plot"
+                       help="Select genes based on their identifier in the
+                             'Gene' column of the sample information file.
+                             Please ensure exact match with the values in input
+                             file and separate selections with commas."/>
+              </when>
+            </conditional>
+
+
+          </when>
+
+          <when value="no"/>
+        </conditional>
+      </when>
+    </conditional>
+
+    <param name="fdr" type="float" value="0.05" min="0" max="1"
+           label="FDR Threshold"
+           help="All observations below this threshold will be highlighted
+                 in the smear plot."/>
+
+    <param name="lfc" type="float" value="0" min="0"
+           label="Absolute LogFC Threshold"
+           help="In additional to meeting the FDR requirement, the absolute
+                 value of the log-fold-change of the observation must be above
+                 this threshold to be highlighted."/>
+
+    <param name="direction" type="select" label="Highlight Option"
+        help="Only hightlight positive or negative fold changes in smear plot?">
+        <option value="all">Default</option>
+        <option value="up">Positive Only</option>
+        <option value="down">Negative Only</option>
+    </param>
+  </inputs>
+
+  <outputs>
+    <data format="html" name="outFile" label="TagSeq Analysis"/>
+  </outputs>
+<tests>
+<test>
+    <param name='inputType' value="counts"/>
+    <param name='counts' value='zuber-count_matrix.txt' />
+    <param name='hairpin' value='zuber-target_anno.txt' />
+    <param name='samples' value='zuber-sample_anno.txt' />
+    <param name="secFactorOpt" value='no' />
+    <param name="filtOption" value='no' />
+    <param name="fdr" value='0.05' />
+    <param name="lfc" value="0" />
+    <param name="direction" value="all" />
+    <param name="mode" value="classic" />
+    <param name="pair1" value="Day 0" />
+    <param name="pair2" value="Day 14" />
+    <output name='outFile' file='shrnaseq_zuber_test.html' compare='diff' lines_diff = '10'/>
+</test>
+</tests>
+  <help>
+
+.. class:: infomark
+
+**What it does**
+
+Given tables containing information about the hairpins/sgRNA and their
+associated sample indices, information about the samples and fastq file
+containing the sequencing reads. This tool will generate plots and tables for
+the analysis of differential representation.
+
+.. class:: infomark
+
+A tutorial of how to use this tool is available at:
+http://bioinf.wehi.edu.au/shRNAseq/galaxy.html
+
+-----
+
+.. class:: infomark
+
+**INPUTS**
+
+**Input File Type:**
+
+This tool is able to either generate counts from a raw FastQ file given the
+information regarding the samples and hairpins/sgRNA. Alternatively if a table
+of counts has already been generated it can also be used.
+
+**Counts Table (Counts Input):**
+
+A tab delimited text table of information regarding the counts of
+hairpins/sgRNA. Should have a column 'ID' to denote the hairpins/sgRNA that
+counts correspond to. Each additional column should have titles corresponding to
+the label for the sample.
+
+Example::
+
+  ID  Sample1 Sample2 Sample3
+  Control1 49802 48014 40148
+  Control2 12441 16352 14232
+  Control3 9842  9148  9111
+  Hairpin1 3300  3418  2914
+  Hairpin2 91418 95812 93174
+  Hairpin3 32985 31975 35104
+  Hairpin4 12082 14081 14981
+  Hairpin5 2491  2769  2691
+  Hairpin6 1294  1486  1642
+  Hairpin7 49501 49076 47611
+  ...
+
+**Target Sequence Annotation:**
+
+A tab delimited text table of information regarding the targetted
+hairpins/sgRNA sequence. Should have columns 'ID', 'Sequences' and 'Gene' to
+uniquely identify the target, align it with the reads to produce counts and
+identify which gene the target acts on.
+
+NOTE: the column names are case sensitive and should be input exactly as they
+are shown here.
+
+Example::
+
+  ID  Sequences Gene
+  Control1  TCTCGCTTGGGCGAGAGTAAG 2
+  Control2  CCGCCTGAAGTCTCTGATTAA 2
+  Control3  AGGAATTATAATGCTTATCTA 2
+  Hairpin1  AAGGCAGAGACTGACCACCTA 4
+  Hairpin2  GAGCGACCTGGTGTTACTCTA 4
+  Hairpin3  ATGGTGTAAATAGAGCTGTTA 4
+  Hairpin4  CAGCTCATCTTCTGTGAAGAA 4
+  Hairpin5  CAGCTCTGTGGGTCAGAAGAA 4
+  Hairpin6  CCAGGCACAGATCTCAAGATA 4
+  Hairpin7  ATGACAAGAAAGACATCTCAA 7
+  ...
+
+**Sample Annotation (FastQ Input):**
+
+A tab delimited text table of information regarding the samples. Should have
+columns 'ID', 'Sequences' and 'group' to uniquely identify each sample, identify
+the sample in the reads by its sample index sequence and correctly group
+replicates for analysis. Additional columns may inserted for annotation purposes
+and will not interfere with analysis as long as the necessary columns are
+present.
+
+NOTE: With the exception of other_group, column names are case sensitive and
+should be input exactly as they are shown here. The other_group column can be
+named by the user and specified in the "Include Secondary Factor" option of the
+tool.
+
+Example::
+
+  ID  Sequences group other_group Replicate
+  3 GAAAG Day 2 male 1
+  6 GAACC Day 10  female  1
+  9 GAAGA Day 5 GFP neg male 1
+  16  GAATT Day 5 GFP pos male 1
+  18  GACAC Day 2 female 2
+  21  GACCA Day 10  male  2
+  28  GACGT Day 5 GFP neg male 2
+  31  GACTG Day 5 GFP pos female 2
+  33  GAGAA Day 2 male 3
+  40  GAGCT Day 10  female  3
+  ...
+
+**Include Secondary Factor**
+
+If there are two factors involved in the experiment (i.e. Age and Gender) then
+then secondary factor should be included to improve the statistical analysis.
+The secondary factor should be specified as a column in the sample annotation
+file and the corresponding column name should be input exactly as it is into
+the provided field in the tool.
+
+NOTE: Currently the secondary factor is used only to improve statistical
+analysis, comparisons can only be made in the primary factor specified as
+"group" in the sample annotation.
+
+**Specify Sample Index and Target Sequence Locations (FastQ Input):**
+
+It is assumed that in the sequencing reads that the first 5 bases are the
+sample index sequence and that bases 37-57 are the hairpins/sgRNA. If this is
+not the case then the values of the positions can be changed, however it still
+requires the sample indices and hairpins/sgRNA to be in a consistent location an
+in a continuous sequence.
+
+NOTE: position values start at 1 for the first base.
+
+**Filter Low CPM?:**
+
+Often in a large screen there may members with very low counts which are of no
+interest in the experiment, these may be filtered out to speed up computations.
+Filtering will be based on counts per million in a required number of samples.
+
+**Analysis Type:**
+
+ * **Classic Exact Test:** This allows two experimental groups to be compared
+   and p-values for differential representation derivec for each target
+   sequence. Simple and fast for straightforward comparisons. In this option you
+   will have the option of "*Compare* x *To* y" which implicitly subtracts the
+   data from y from that of x to produce the comparison.
+
+ * **Generalised Linear Model:** This allow for complex contrasts to be specified
+   and also gene level analysis to be performed. If this option is chosen then
+   contrasts must be explicitly stated in equations and multiple contrasts can
+   be made. In addition there will be the option to analyse hairpins/sgRNA on a
+   per-gene basis to see if hairpins/sgRNA belonging to a particular gene have
+   any overall tendencies for the direction of their log-fold-change.
+
+**FDR Threshold:**
+The smear plot in the output will have hairpins/sgRNA highlighted to signify
+significant differential representation. The significance is determined by
+contorlling the false discovery rate, only those with a FDR lower than the
+threshold will be highlighted in the plot.
+
+
+-----
+
+
+**Citations:**
+
+.. class:: infomark
+
+limma
+
+Please cite the paper below for the limma software itself.  Please also try
+to cite the appropriate methodology articles that describe the statistical
+methods implemented in limma, depending on which limma functions you are
+using.  The methodology articles are listed in Section 2.1 of the limma
+User's Guide.
+
+  * Smyth, GK (2005). Limma: linear models for microarray data. In:
+    'Bioinformatics and Computational Biology Solutions using R and
+    Bioconductor'. R. Gentleman, V. Carey, S. Dudoit, R. Irizarry,
+    W. Huber (eds), Springer, New York, pages 397-420.
+
+.. class:: infomark
+
+edgeR
+
+Please cite the first paper for the software itself and the other papers for
+the various original statistical methods implemented in edgeR.  See
+Section 1.2 in the User's Guide for more detail.
+
+  * Robinson MD, McCarthy DJ and Smyth GK (2010). edgeR: a Bioconductor
+    package for differential expression analysis of digital gene expression
+    data. Bioinformatics 26, 139-140
+
+  * Robinson MD and Smyth GK (2007). Moderated statistical tests for assessing
+    differences in tag abundance. Bioinformatics 23, 2881-2887
+
+  * Robinson MD and Smyth GK (2008). Small-sample estimation of negative
+    binomial dispersion, with applications to SAGE data.
+    Biostatistics, 9, 321-332
+
+  * McCarthy DJ, Chen Y and Smyth GK (2012). Differential expression analysis
+    of multifactor RNA-Seq experiments with respect to biological variation.
+    Nucleic Acids Research 40, 4288-4297
+
+Report problems to: su.s@wehi.edu.au
+
+.. _edgeR: http://www.bioconductor.org/packages/release/bioc/html/edgeR.html
+.. _limma: http://www.bioconductor.org/packages/release/bioc/html/limma.html
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/readme.rst	Mon Jan 19 22:14:10 2015 -0500
@@ -0,0 +1,15 @@
+shrnaseq wrapper
+================
+
+This is a self installing Galaxy tool exposing the shrnaseq_ R package which has excellent documentation at
+shrnaseq_ Minimal details are provided in this wrapper - please RTM to get the best out of it.
+
+
+.. _shrnaseq: http://bioinf.wehi.edu.au/shRNAseq/
+
+Underlying R code written by Matt Ritchie.
+Galaxy wrapper by Shian Su
+Autoinstallation and fixin' : Ross Lazarus
+
+This version first passed tests on 18 Jan 2015
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/shrnaseq_zuber_test.html	Mon Jan 19 22:14:10 2015 -0500
@@ -0,0 +1,80 @@
+<html>
+<head>
+<title>EdgeR Output</title>
+</head>
+<body>
+<h3>EdgeR Analysis Output:</h3>
+<h4>Input Summary:</h4>
+<ul>
+<li>Number of Samples: 4</li>
+<li>Number of Hairpins: 1105</li>
+<li>Number of annotations provided: 1105</li>
+<li>Number of annotations matched to hairpin: 1105</li>
+</ul>
+The estimated common biological coefficient of variation (BCV) is: 0.9323<br />
+No secondary factor specified.<br />
+<h4>Output:</h4>
+PDF copies of JPEGS available in 'Plots' section.<br />
+<img src="barIndex.png" alt="Counts per Index" height="600" width="600"/>
+<img src="barHairpin.png" alt="Counts per Hairpin" height="600" width="600"/>
+<img src="mds.png" alt="MDS Plot" height="600" width="600"/>
+<img src="bcv.png" alt="BCV Plot" height="600" width="600"/>
+<img src="smear(Day.0-Day.14).png" alt="Smear Plot(Day.0-Day.14)" height="600" width="600"/>
+<br />
+<h4>Differential Representation Counts:</h4>
+<table border="1" cellpadding="4">
+<tr>
+<td></td>
+<th>Up</th>
+<th>Flat</th>
+<th>Down</th>
+</tr>
+<tr>
+<th>Day 0-Day 14</th>
+<td>376</td>
+<td>682</td>
+<td>35</td>
+</tr>
+</table><h4>Plots:</h4>
+<a href="barIndex.pdf" target="_blank">Counts per Index Barplot (.pdf)</a><br />
+<a href="barHairpin.pdf" target="_blank">Counts per Hairpin Barplot (.pdf)</a><br />
+<a href="mds.pdf" target="_blank">MDS Plot (.pdf)</a><br />
+<a href="bcv.pdf" target="_blank">BCV Plot (.pdf)</a><br />
+<a href="smear(Day.0-Day.14).pdf" target="_blank">Smear Plot(Day.0-Day.14) (.pdf)</a><br />
+<h4>Tables:</h4>
+<a href="toptag(Day.0-Day.14).tsv" target="_blank">Top Tags Table(Day.0-Day.14) (.tsv)</a><br />
+<a href="counts.tsv" target="_blank">Counts table (.tsv)</a><br />
+<p>Alt-click links to download file.</p>
+<p>Click floppy disc icon on associated history item to download all files.</p>
+<p>.tsv files can be viewed in Excel or any spreadsheet program.</p>
+<h4>Additional Information:</h4>
+<li>Data was gathered from a table of counts.</li>
+<li>Target sequences without more than 0.5 CPM in at least 1 samples are insignificant and filtered out.</li>
+<li>1 of 1094 (0.09%) target sequences were filtered out for low count-per-million.</li>
+<li>Samples that did not produce more than 1000 counts were filtered out.</li>
+<li>0 samples were filtered out for low counts.</li>
+<li>An exact test was performed on each target sequence.</li>
+<h4>Citations</h4><ol>
+<li>Robinson MD, McCarthy DJ and Smyth GK (2010). edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26, 139-140</li>
+<li>Robinson MD and Smyth GK (2007). Moderated statistical tests for assessing differences in tag abundance. Bioinformatics 23, 2881-2887</li>
+<li>Robinson MD and Smyth GK (2008). Small-sample estimation of negative binomial dispersion, with applications to SAGE data. Biostatistics, 9, 321-332</li>
+<li>McCarthy DJ, Chen Y and Smyth GK (2012). Differential expression analysis of multifactor RNA-Seq experiments with respect to biological variation. Nucleic Acids Research 40, 4288-4297</li>
+</ol>
+<p>Report problems to: su.s@wehi.edu.au</p>
+<a href="session_info.txt" target="_blank">Session Info</a><br />
+<table border="0">
+<tr>
+<td>Task started at:</td>
+<td>2015-01-20 12:16:59</td>
+</tr>
+<tr>
+<td>Task ended at:</td>
+<td>2015-01-20 12:17:05</td>
+</tr>
+<tr>
+<td>Task run time:</td>
+<td>6 secs</td>
+<tr>
+</table>
+</body>
+</html>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/zuber-count_matrix.txt	Mon Jan 19 22:14:10 2015 -0500
@@ -0,0 +1,1106 @@
+ID	Reads_A_T0	Reads_A_T14	Reads_B_T0	Reads_B_T14
+100043305.2	34133	9171	31158	4111
+100043305.4	5589	1	4311	5737
+100043305.5	38651	7722	24711	15331
+2900092E17Rik.377	11759	24	9328	21
+2900092E17Rik.546	3581	30	3211	3
+2900092E17Rik.1051	11498	1907	10809	4116
+2900092E17Rik.1361	5590	1128	5753	1704
+Actl6b.379	8147	3520	8262	3861
+Actl6b.819	7152	5311	7080	2636
+Actl6b.917	3549	3	3326	9
+Actl6b.989	9928	3200	12207	1787
+Actl6b.1221	2449	173	4553	190
+Alkbh2.462	8219	0	8307	3674
+Alkbh2.557	17312	11788	16162	7253
+Alkbh2.590	908	0	3	0
+Alkbh2.640	29881	9982	32507	6981
+Alkbh2.641	30677	31067	21977	5244
+Alkbh3.552	7748	95	10813	628
+Alkbh3.843	7288	47	6161	1141
+Alkbh3.901	11464	10632	13945	986
+Alkbh3.1184	235478	121880	223886	199915
+Aof2.1869	4835	1	6635	18
+Aof2.1956	9168	74	11901	2001
+Aof2.2435	22561	5296	27662	4349
+Aof2.2857	12275	0	13761	0
+Ash1l.1031	40881	12818	35694	11615
+Ash1l.1280	15907	3501	24446	2818
+Ash1l.3810	0	0	570	0
+Ash1l.8132	16135	3240	13553	8157
+Ash1l.9540	19334	4915	19956	482
+Ash2l.586	17315	3908	16296	11351
+Ash2l.805	15308	11745	19785	7504
+Ash2l.948	17154	7175	22222	1182
+Ash2l.1135	10872	23	9514	649
+Ash2l.2130	48820	71306	54356	55586
+Asxl1.2020	8883	85	7366	810
+Asxl1.3548	1499	177	4290	434
+Asxl1.3785	13925	9770	13967	1888
+Asxl1.4792	14695	2973	17368	6663
+Asxl1.5221	207	21	1015	413
+Asxl1.6315	5323	2931	4104	1254
+Asxl2.11	12636	1202	19230	836
+Asxl2.4563	6740	9470	6275	14168
+Asxl2.6593	7040	7865	7327	463
+Asxl2.7130	1005	688	1998	98
+Asxl2.7253	2848	0	4313	1015
+Asxl3.6101	27880	9120	23317	9903
+Asxl3.6824	0	0	0	0
+Asxl3.8947	10505	1283	17111	8040
+Asxl3.10021	11150	77	9094	418
+Asxl3.11070	6878	434	13876	499
+Asxl3.11073	19570	60	23697	1250
+Atm.137	7726	1	7961	0
+Atm.4098	17664	79096	14372	19643
+Atm.4998	5448	0	8348	0
+Atm.5616	26499	17417	25957	5963
+Atm.7782	121694	37584	112860	23911
+Atm.9396	23098	8301	16153	13589
+Atr.1239	7318	0	7499	76
+Atr.3160	4630	0	2454	0
+Atr.4762	7087	502	6196	1408
+Atr.6186	14186	1517	14242	2136
+Atr.7888	2705	715	1274	40
+Atrx.2490	21802	13082	20344	3929
+Atrx.5490	9146	4876	8110	1459
+Atrx.6144	22072	50037	17635	135473
+Atrx.7173	20760	2010	32941	360
+Atrx.7377	4661	7127	5894	858
+Aurkb.520	10448	158	8464	14
+Aurkb.631	12294	13088	16774	9788
+Aurkb.917	9721	85	7381	297
+Aurkb.928	3823	0	3360	70
+Aurkb.1620	2783	0	1689	0
+Aurkb.1803	5485	964	6727	502
+Baz1a.2095	17890	6381	16476	10861
+Baz1a.2451	8018	26337	7113	7350
+Baz1a.4993	4040	2049	5627	4388
+Baz1a.5946	8518	471	7167	756
+Baz1b.801	3377	3	2560	1
+Baz1b.3683	19598	1361	14007	9115
+Baz1b.5646	7619	140	6540	93
+Baz1b.6371	20503	0	14675	4199
+Bmi1.698	13315	927	12090	1400
+Bmi1.895	22321	1589	22783	0
+Bmi1.1440	148	0	1337	0
+Bmi1.1746	57319	7041	58914	6748
+Bmi1.2404	2012	0	5750	0
+Bmi1.2561	7381	4663	6301	1752
+Bop1.778	22193	9880	25011	22498
+Bop1.2228	9126	1164	11243	1759
+Bop1.2403	1267	0	2340	0
+Bptf.1622	19917	1645	16672	1194
+Bptf.3234	29927	1975	29930	1459
+Bptf.7211	9162	196	8435	235
+Bptf.8224	22786	4089	25881	16627
+Braf.3750	251680	111577	252403	96275
+Braf.3826	36692	6171	38833	3552
+Braf.5053	21572	58690	24272	47962
+Brd1.286	2667	1	3889	732
+Brd1.287	47567	32364	42739	11998
+Brd1.2096	15510	483	12893	662
+Brd1.4229	1776	47	2985	0
+Brd2.813	8544	364547	19761	57153
+Brd2.1714	7605	1900	7256	279
+Brd2.3011	1335	40	1645	44
+Brd2.3396	447	431	1478	90
+Brd3.187	20291	0	16080	1
+Brd3.298	45100	2627	41908	2295
+Brd3.411	3322	4993	9122	88
+Brd3.4162	4380	3233	4235	2236
+Brd4.523	59871	250	62100	1030
+Brd4.552	4366	0	4085	0
+Brd4.632	6519	0	8625	0
+Brd4.1448	18590	2201	13467	2049
+Brd4.2097	15250	0	12300	0
+Carm1.892	7893	3	7502	1189
+Carm1.1222	6127	0	5712	860
+Carm1.1454	6356	0	4529	0
+Carm1.1614	2578	0	2116	1032
+Carm1.1717	10432	26	5147	5
+Cbx1.1004	2119	176	2118	68
+Cbx1.1053	55760	32885	49270	78522
+Cbx1.1099	6839	6288	10338	2367
+Cbx1.1103	16450	2350	10274	7958
+Cbx1.1210	4161	1553	6473	768
+Cbx2.2033	3805	6	3394	910
+Cbx2.3537	1236	0	1822	0
+Cbx2.3545	1510	1926	1608	235
+Cbx2.3620	4720	41	4982	1298
+Cbx2.3706	15664	23374	12341	9903
+Cbx3.882	3121	0	3119	0
+Cbx3.1206	13461	1774	17078	1812
+Cbx3.1339	19195	1352	22424	4795
+Cbx3.1719	4977	0	5860	0
+Cbx3.1735	20825	237	16087	3528
+Cbx4.1794	9233	3426	6939	16366
+Cbx4.1844	2832	3464	4193	744
+Cbx4.2573	69888	62259	67617	50333
+Cbx4.4403	3806	0	4281	1847
+Cbx4.5120	11707	4670	9880	5888
+Cbx5.1309	20635	20130	21845	21774
+Cbx5.4366	907	0	563	0
+Cbx5.4409	9565	1475	14591	3062
+Cbx5.4508	26823	20517	26002	16192
+Cbx5.5707	3839	488	2459	831
+Cbx5.8586	2634	924	4578	8
+Cbx6.1535	1684	44	2014	5254
+Cbx6.3332	32724	36460	41754	5931
+Cbx6.3473	1027	199	1093	2766
+Cbx6.3969	25243	20256	20037	7607
+Cbx7.745	41390	8417	44824	10473
+Cbx7.1633	9110	0	7318	594
+Cbx7.1634	8492	1	7765	1175
+Cbx7.1639	3050	380	4027	305
+Cbx7.2006	12881	0	11203	1803
+Cbx7.2504	15650	74	14065	1023
+Cbx8.136	14429	562	10096	1833
+Cbx8.1120	23518	5129	18818	4414
+Cbx8.1342	91120	117507	88227	77242
+Chaf1a.166	7650	0	8656	0
+Chaf1a.1039	1166	0	1879	0
+Chaf1a.2122	36245	25317	42693	4155
+Chaf1b.367	1271	0	3122	0
+Chaf1b.566	5644	2726	6501	805
+Chaf1b.692	8344	4791	14305	0
+Chaf1b.901	11840	1680	10452	2885
+Chaf1b.1223	3527	0	4039	327
+Chd1.746	42149	4740	47141	5029
+Chd1.1103	9539	301	10681	317
+Chd1.2443	9033	998	8891	1151
+Chd1.2959	17519	3663	17844	3550
+Chd1.4558	16095	18060	18409	694
+Chd1l.2305	13833	2232	9271	1687
+Chd1l.2598	2003	4	3653	467
+Chd1l.2804	8186	1848	9889	4110
+Chd2.926	12754	2298	14491	1390
+Chd2.3700	18791	8160	17139	6180
+Chd2.3984	39660	3183	28160	5299
+Chd2.8087	21625	5699	19522	2258
+Chd2.8913	44266	4697	48691	2032
+Chd3.482	5654	84	2967	437
+Chd3.3249	18194	209	16629	2181
+Chd3.4011	12016	5122	15608	2384
+Chd3.6496	8188	250	11414	658
+Chd3.7148	6057	11694	5216	14343
+Chd3.7149	18779	2183	20787	4073
+Chd4.2060	3613	0	9449	3
+Chd4.3326	0	0	0	0
+Chd4.3423	18147	329	24617	1474
+Chd4.3772	18305	1967	17413	13691
+Chd5.2301	20061	34429	23079	1480
+Chd5.2900	8518	12121	8113	23821
+Chd5.5471	16812	135	14891	832
+Chd5.6392	27664	42408	24064	32029
+Chd6.311	5183	30	4482	283
+Chd6.4698	11850	691	9494	952
+Chd6.4988	9782	9443	8227	3677
+Chd6.9610	4646	4252	7143	2341
+Chd7.1269	5308	36016	5596	15544
+Chd7.1502	17568	19902	24339	10329
+Chd7.5857	24131	42321	23035	13811
+Chd7.6498	2585	2388	3680	681
+Chd7.7229	4726	3715	3325	5096
+Chd8.434	10501	5059	13580	0
+Chd8.3265	14017	45094	15274	35713
+Chd8.4169	46755	130786	47380	90425
+Chd8.5352	15081	0	10249	963
+Chd8.6946	24933	3532	29506	678
+Chd9.1402	8846	10701	5390	15209
+Chd9.3919	30650	5485	31316	8951
+Chd9.9352	4541	7	4353	547
+Chd9.10928	11786	846	6533	3211
+Clock.693	30386	192421	30632	61226
+Clock.1387	3512	16	6185	1879
+Clock.4461	8821	15720	13658	32530
+Clock.4611	7531	1868	7634	960
+Clock.5863	8924	0	6154	0
+Crebbp.704	6954	132149	5748	28129
+Crebbp.2064	15054	21613	9232	8683
+Crebbp.2118	16858	416	14067	1155
+Crebbp.3582	10871	49874	11472	31243
+Crebbp.4463	10735	244297	8756	87465
+Ctsl.940	64046	40415	67042	33661
+Ctsl.1445	4304	11403	6955	921
+Ctsl.1941	14957	114	9881	1230
+Ctsl.1942	3801	651	5404	119
+Ctsl.1947	83104	55376	79952	45160
+Cxxc1.68	22254	7624	21861	13433
+Cxxc1.359	16364	0	14694	712
+Cxxc1.1889	13048	105	15103	1803
+Cxxc1.2034	10733	2431	11257	5220
+Cxxc1.2133	24632	4890	18850	3756
+Dmap1.439	22069	17051	18179	11546
+Dmap1.518	270	6	835	0
+Dmap1.1354	27540	2702	27126	5348
+Dmap1.1355	38236	3410	25053	19190
+Dmap1.1487	16458	35264	12204	7974
+Dnmt1.437	2774	1	4466	1933
+Dnmt1.828	37302	0	37771	2350
+Dnmt1.1137	1982	0	900	0
+Dnmt1.4462	19205	1622	19314	2525
+Dnmt1.4848	11770	53612	13284	12279
+Dnmt3a.16	28736	52935	39231	63096
+Dnmt3a.1669	7497	2055	9359	279
+Dnmt3a.2338	26093	14264	21886	8356
+Dnmt3a.4173	90754	147980	91811	371738
+Dnmt3b.275	2759	0	4350	967
+Dnmt3b.579	23800	2457	15840	4413
+Dnmt3b.958	18118	1831	14535	41
+Dnmt3b.2218	4817	0	5321	0
+Dnmt3l.306	1360	0	7206	133
+Dnmt3l.760	107789	89964	109791	48867
+Dnmt3l.1049	12911	3759	16355	4238
+Dnmt3l.1333	10696	5884	9512	8646
+Dnmt3l.1350	11998	13780	13122	7740
+Dot1l.602	15468	1611	18782	28
+Dot1l.941	308	0	1	0
+Dot1l.3626	1819	0	2461	0
+Dub2a.769	20173	45614	27227	22193
+Dub2a.1334	3322	913	3054	1061
+Dub2a.1391	7400	0	6144	0
+Dub2a.1397	1989	1475	2177	2420
+Dub2a.1444	6000	772	9736	1277
+Dub2a.1445	17909	5522	13925	4446
+Edf1.486	21827	12951	27904	16057
+Edf1.628	14218	14904	9199	1968
+Edf1.631	17016	5000	14264	1849
+Edf1.652	14581	2743	14121	1112
+Eed.710	5375	0	4431	0
+Eed.949	19036	15171	17602	11188
+Eed.1083	40824	1687	39480	698
+Eed.1397	27933	4138	25394	8774
+Eed.1820	36795	99609	29844	5995
+EG330129.869	2661	61	1902	619
+EG330129.2118	14758	1039	18080	5314
+EG330129.2262	15426	19116	20410	28859
+EG330129.2329	19693	6224	15507	1799
+EG546387.1344	61423	132971	65502	105110
+EG546387.2159	18532	5441	17522	6441
+EG546387.2272	5181	2230	3858	1293
+Ehmt1.66	23038	3862	34576	8831
+Ehmt1.386	78913	8990	88361	18872
+Ehmt1.859	3728	0	2265	0
+Ehmt1.920	12674	47588	15786	8109
+Ehmt1.3003	17009	4	13764	0
+Ehmt2.724	28567	15002	19363	7218
+Ehmt2.1880	16161	724	10956	2142
+Ehmt2.2014	9586	2303	10876	5893
+Ehmt2.3146	20606	4947	20381	4673
+Ehmt2.3202	12157	924	12076	0
+Elp3.117	13584	1649	11794	7368
+Elp3.215	14727	1372	14790	23
+Elp3.219	17103	125	19102	1933
+Elp3.592	7651	1	13554	437
+Ep300.754	49982	34746	48931	26824
+Ep300.3850	4229	0	4817	0
+Ep300.5490	19810	2485	18297	1698
+Ep300.7826	25198	3046	25177	307
+Ep300.8647	34570	13119	36600	5763
+Evi1.649	23821	1022	23583	938
+Evi1.652	4938	1433	6371	7108
+Evi1.1371	6351	4198	5211	3390
+Evi1.1978	0	0	0	0
+Evi1.2720	8079	4150	7301	4240
+Ezh1.68	23617	6527	29619	30045
+Ezh1.73	2152	1	2857	3113
+Ezh1.4104	5575	74	3572	1105
+Ezh1.4105	10809	0	9427	3236
+Ezh2.556	5195	3183	2808	898
+Ezh2.1370	13095	1	16542	4081
+Ezh2.1678	39634	33392	36467	37036
+Ezh2.2124	24614	13542	24923	1861
+Ezh2.2253	23466	844	25517	49
+Fbxl10.356	9135	6792	12154	10033
+Fbxl10.443	1186	0	1217	0
+Fbxl10.3131	12157	3918	15296	5301
+Fbxl10.3145	28882	145367	25071	266575
+Fbxl11.663	4479	254	4500	248
+Fbxl11.1840	2254	1230	892	701
+Fbxl11.7144	14494	9088	14709	3408
+Fbxl11.7145	10143	70	8133	314
+Fbxl19.1945	4994	4	6347	0
+Fbxl19.2841	4416	0	3763	0
+Fbxl19.3203	17900	0	21153	395
+Fkbp1a.646	7663	6	6272	169
+Fkbp1a.827	3731	66420	5825	4725
+Fkbp1a.851	2142	4	1255	0
+Fkbp1a.854	17779	5211	17456	2979
+Fkbp2.195	12182	84	7562	997
+Fkbp2.213	1713	0	1042	0
+Fkbp2.532	190	0	104	0
+Fkbp2.581	29896	2210	38434	3532
+Fkbp5.595	6187	1738	9425	3732
+Fkbp5.628	2539	448	2028	4
+Fkbp5.1219	2462	0	1697	3
+Fkbp5.2613	0	0	0	0
+Fkbp5.2813	27937	0	19923	52176
+Fkbp5.3272	7148	720	11556	616
+Gtf3c4.2358	14364	7409	14531	1446
+Gtf3c4.2444	5365	106	8597	3468
+Gtf3c4.2605	13187	44260	17871	32768
+Gtf3c4.3160	12285	1919	9387	2634
+Gtf3c4.3163	23210	21932	22233	10393
+H2afz.508	7648	1460	7024	236
+H2afz.692	13424	1472	13562	1762
+H2afz.823	8678	0	5225	0
+H2afz.909	27579	108855	26279	31357
+H2afz.937	6529	1591	6908	1939
+Hat1.290	40899	11691	48020	9574
+Hat1.638	278838	398517	279877	354180
+Hat1.866	13651	10058	10447	5453
+Hat1.1528	5921	3024	8953	2868
+Hcfc1.812	28786	4502	27161	4598
+Hcfc1.4648	8357	0	9882	1262
+Hcfc1.7430	4307	160	3200	35
+Hcfc1.7506	43003	8634	44678	2972
+Hcfc1.8014	8845	33	9753	0
+Hdac1.245	4808	1777	5428	576
+Hdac1.1053	15708	11064	13398	2392
+Hdac1.1065	6119	41	4640	0
+Hdac1.1830	10309	3420	7166	15784
+Hdac10.1645	0	0	0	0
+Hdac10.2041	9421	30	13575	906
+Hdac10.2307	11332	4605	15942	1310
+Hdac11.2025	5748	390	4388	1
+Hdac11.2058	21979	11670	33308	23388
+Hdac11.2182	2741	0	1897	0
+Hdac11.2460	3150	226	3435	986
+Hdac11.2461	5426	792	5499	365
+Hdac2.439	29909	2942	35230	5020
+Hdac2.440	1162	0	1339	0
+Hdac2.1184	19432	33612	18548	32335
+Hdac2.1611	39116	35275	44610	9355
+Hdac2.1919	58543	16034	62733	11276
+Hdac3.161	5438	284	5431	16
+Hdac3.854	11512	3613	11530	925
+Hdac3.987	15606	236696	17908	57900
+Hdac3.1037	4439	1723	4619	0
+Hdac3.1491	7985	0	6286	986
+Hdac4.331	16436	6934	19062	1466
+Hdac4.431	6765	158440	9201	22187
+Hdac4.1903	1357	657	1195	991
+Hdac4.3273	14916	944	19717	2146
+Hdac5.1115	2098	613	2229	0
+Hdac5.1936	18798	7849	29847	6138
+Hdac5.2060	2568	3	1204	121
+Hdac5.2412	13712	1	11404	3505
+Hdac5.2886	8136	196	8759	209
+Hdac6.530	0	0	0	0
+Hdac6.2249	1808	1429	2043	0
+Hdac6.3838	6542	2441	9262	5129
+Hdac6.4026	21285	12348	26787	20564
+Hdac7.560	6870	687	6840	0
+Hdac7.836	8926	5421	7502	10495
+Hdac7.1293	34937	9117	34192	6997
+Hdac7.2255	20876	6721	30076	1172
+Hdac7.3429	5979	454	5696	805
+Hdac8.296	1838	0	3737	0
+Hdac8.397	13492	5078	9430	2980
+Hdac8.900	25917	1733	29902	2130
+Hdac8.1692	22304	21086	26207	12759
+Hdac9.1236	8992	519	14512	952
+Hdac9.1449	12626	676	13666	458
+Hdac9.2031	17918	4808	17044	2570
+Hdac9.2070	59653	6259	56073	20783
+Hdac9.4083	45586	22853	43689	11794
+Hells.977	1299	1	2614	2157
+Hells.1094	0	0	0	0
+Hells.1145	31010	2668	28532	1538
+Hells.1703	9030	9859	5844	8448
+Hells.2323	35114	5146	32398	1612
+Hira.223	8759	417	7043	211
+Hira.2318	7426	0	9835	0
+Hira.2835	4556	12145	5932	4706
+Hira.4298	8683	101	5451	536
+Hltf.252	20489	11041	22885	6226
+Hltf.455	76855	45338	80380	23580
+Hltf.497	25307	38142	24907	146870
+Hltf.1198	3863	153	3035	1096
+Ing2.649	4504	6	4733	244
+Ing2.1400	38848	18868	29144	11601
+Ing2.1788	6201	57	10102	11
+Ing2.1824	10033	3283	10696	1439
+Ing2.2176	29600	1073	32782	6050
+Ino80.458	10511	6016	22774	33294
+Ino80.1194	11000	6405	9044	10376
+Ino80.2062	52365	148689	44701	184145
+Ino80.4069	6702	28691	4415	24593
+Jarid1a.2826	18278	6403	18014	2648
+Jarid1a.6729	10355	5540	10379	22760
+Jarid1a.10299	26860	6487	19211	5470
+Jarid1a.10802	3533	0	4344	926
+Jarid1a.11640	35567	17366	33011	4446
+Jarid1b.382	9868	2723	5159	527
+Jarid1b.1671	0	0	6	0
+Jarid1b.2176	0	0	0	0
+Jarid1b.4339	5073	345	5343	1689
+Jarid1b.4527	9425	50	10059	1381
+Jarid1c.1882	2549	17	3478	953
+Jarid1c.1886	14749	7706	12323	10740
+Jarid1c.2010	2273	2461	527	398
+Jarid1c.5632	27259	49235	24893	11026
+Jarid1d.2138	9206	228	12341	0
+Jarid1d.2800	10754	10630	12462	2316
+Jarid1d.3002	2007	136	2996	282
+Jarid1d.4830	34435	12167	32548	13433
+Jarid2.1699	2892	775	5944	278
+Jarid2.2191	83425	340442	85527	65202
+Jarid2.3219	2395	0	769	0
+Jhdm1d.2087	29857	12371	32979	3416
+Jhdm1d.2209	25750	14116	21403	14704
+Jhdm1d.3273	119204	22930	121764	31402
+Jhdm1d.6787	5686	477	5135	953
+Jhdm1d.8524	30018	8410	33250	9317
+Jmjd1a.371	15143	0	9975	0
+Jmjd1a.753	10118	74	13083	677
+Jmjd1a.1070	5348	0	5622	948
+Jmjd1a.3518	4726	1	5434	5389
+Jmjd1b.1014	22703	16785	20694	20823
+Jmjd1b.3708	4995	0	7649	4
+Jmjd1b.5309	9434	3183	7204	5711
+Jmjd1b.6406	42972	40465	40110	68843
+Jmjd1b.6504	10265	1777	9964	9327
+Jmjd1c.649	9093	1476	8029	3525
+Jmjd1c.3196	6525	11	11473	0
+Jmjd1c.4221	26638	2833	27602	2788
+Jmjd1c.6050	16745	9264	17779	16014
+Jmjd1c.6346	19323	3230	17970	5289
+Jmjd2a.424	4205	508	3711	1090
+Jmjd2a.663	14302	1084	16049	2421
+Jmjd2a.1474	9697	27	8804	1545
+Jmjd2a.1498	66057	4568	55742	948
+Jmjd2a.3033	10638	11	7955	5
+Jmjd2b.1151	13663	16056	13831	9568
+Jmjd2b.2905	112806	268376	97185	116026
+Jmjd2b.4018	5645	5932	6977	11481
+Jmjd2b.4170	28332	10072	26581	38183
+Jmjd2c.738	14473	1738	13755	3513
+Jmjd2c.1217	9829	9470	11148	18647
+Jmjd2c.3112	18781	8790	19860	7108
+Jmjd2c.3541	40250	22412	40729	16482
+Jmjd2d.301	3043	1	3782	975
+Jmjd2d.450	1036	1	3009	8145
+Jmjd2d.1143	7706	7367	7416	180
+Jmjd2d.2310	102210	26240	106864	7826
+Jmjd2d.2358	12130	911	13293	582
+Jmjd4.1722	8159	6247	16741	12010
+Jmjd4.1796	9253	1514	7118	1684
+Jmjd4.2677	31423	25789	37642	20063
+Jmjd4.2749	5793	223	8612	2395
+Jmjd4.3327	23522	4354	26494	24409
+Jmjd5.18	14793	55385	14988	21455
+Jmjd5.1123	5430	203	5612	1456
+Jmjd5.1291	5179	2109	3752	1488
+Jmjd5.1564	10552	237	12059	4238
+Jmjd5.2041	10418	167	7459	9
+Jmjd6.254	13534	2503	11700	729
+Jmjd6.530	3656	97	3885	1044
+Jmjd6.956	11018	2874	16364	76
+Jmjd6.1633	37602	9544	39980	9096
+Kat2a.542	3504	3297	5800	1718
+Kat2a.1771	1161	0	2203	533
+Kat2a.2053	12866	1384	10067	9758
+Kat2a.2201	6827	1761	8972	241
+Kat2b.1306	37105	2671	31383	275
+Kat2b.2624	16637	1228	15500	1335
+Kat2b.3228	6549	413	12258	933
+Kat2b.3494	138189	63210	110981	31184
+Kat2b.3766	16379	2391	10353	790
+Kat5.679	2739	630	2249	10
+Kat5.1193	1796	4824	2367	4568
+Kat5.1242	54	7231	887	4382
+Kat5.1387	15408	52911	10253	43152
+L3mbtl.263	5757	4	5207	2071
+L3mbtl.373	7879	3266	8067	1344
+L3mbtl.725	125876	41968	136893	60944
+L3mbtl.1906	7657	184	3595	0
+L3mbtl.2689	8264	1127	4854	0
+LOC100040412.49	44628	9676	40349	10227
+LOC100040412.495	518	0	264	0
+LOC100040412.655	36670	7127	34829	20101
+LOC100040412.1128	20338	7124	19461	5684
+LOC100044324.736	53916	28423	51151	28391
+LOC100044324.927	3794	1326	5898	0
+LOC100044324.1075	4055	23211	2907	8855
+LOC100044324.1240	3549	0	2335	1159
+LOC100044324.1314	33932	4960	43503	12431
+LOC100048887.186	11625	42693	11686	68360
+LOC100048887.194	1209	0	631	0
+LOC100048887.732	19420	2151	23621	922
+LOC100048887.787	5608	0	5382	0
+LOC100048887.803	15555	1240	14130	2172
+LOC664892.1494	15416	9985	16994	8314
+LOC664892.1500	39567	45154	32681	16788
+LOC664892.1697	21861	3459	23168	13194
+LOC664892.1892	7530	197	9165	1433
+LOC664892.2169	2728	61	694	1
+Mbd1.746	18613	7	15420	5997
+Mbd1.1387	16462	697	11111	3994
+Mbd1.1856	16551	180	18694	2741
+Mbd1.2237	4287	58	3734	1034
+Mbd2.938	18282	0	20638	1385
+Mbd2.1117	57023	25500	68767	7293
+Mbd2.1545	5545	1123	2169	11
+Mbd2.1763	14932	21	8532	469
+Mbd2.1823	168962	47694	166843	91277
+Mbd3.579	2471	28	4469	298
+Mbd3.1147	7558	998	6411	846
+Mbd3.1354	9463	348	9133	333
+Mbd3.1452	12302	19001	10776	2107
+Mbd3.1551	14684	4138	13756	10
+Mbd4.434	7882	186	5141	7256
+Mbd4.1027	26878	5949	31423	2532
+Mbd4.3297	63441	53173	49261	23120
+Mbd4.3541	13769	9186	15004	2583
+Mds1.87	13597	54	10811	997
+Mds1.651	24891	3300	20814	10559
+Mds1.764	6774	13	12423	800
+Mds1.874	55777	60096	65359	33264
+Mecp2.1627	2211	613	2915	114
+Mecp2.2287	30878	16895	24540	25052
+Mecp2.5438	17574	6850	16734	5558
+Mecp2.7745	6981	74	8337	543
+Men1.219	36152	6676	36421	2180
+Men1.228	2413	0	1031	0
+Men1.1457	24003	1418	19287	0
+Men1.2310	1903	0	1963	0
+Men1.2707	3891	0	3747	611
+Mettl8.846	15269	32248	20256	25007
+Mettl8.1184	31695	23070	27103	9050
+Mettl8.1353	13590	3829	7213	1318
+Mettl8.1914	4626	23	2666	1515
+Mettl8.1990	17582	111	13919	1630
+Mgmt.384	8858	14	13506	2427
+Mgmt.412	47142	206140	56921	427295
+Mgmt.433	7563	4297	6613	3666
+Mgmt.672	1225	43	2941	9
+Mgmt.730	22753	5741	18956	3166
+Mll1.4195	19468	5469	15618	2029
+Mll1.11050	22877	942	24834	3541
+Mll1.13303	305	0	759	0
+Mll1.16168	27703	4104	31277	1745
+Mll2.4285	5216	13928	5210	10868
+Mll2.5430	13067	5975	9114	3637
+Mll2.6153	2237	9263	2642	15030
+Mll2.11374	33723	759803	28105	234314
+Mll2.12943	46826	232154	42025	455810
+Mll3.1099	1138	4199	1813	883
+Mll3.2993	19133	11678	12182	9160
+Mll3.5304	3633	0	5156	0
+Mll3.6232	5828	17022	8940	6153
+Mll3.15396	40315	309338	50764	123575
+Morf4l1.281	17414	4324	22313	707
+Morf4l1.603	25422	1074	19962	410
+Morf4l1.639	20761	2921	15916	1451
+Morf4l1.1034	25865	152	27963	287
+Morf4l1.1245	18488	9450	19247	3840
+Mta1.213	1640	0	2028	0
+Mta1.1003	8419	1279	7201	4263
+Mta1.1053	12543	1219	13119	1381
+Mta1.1147	23472	14298	19777	22940
+Mta1.1363	94	0	210	0
+Mta2.511	10088	35	14741	766
+Mta2.924	9090	194	12773	126
+Mta2.1284	16460	7126	14805	1384
+Mta2.2013	126	0	1746	0
+Mta3.222	2387	0	3939	0
+Mta3.553	11839	40	9230	1181
+Mta3.1523	22093	18940	27171	9881
+Mta3.1663	12142	1439	13022	226
+Myst1.643	5812	0	6117	0
+Myst1.724	11510	1026	23724	15872
+Myst1.1250	5525	0	3597	0
+Myst1.1302	4909	220	4468	925
+Myst2.176	84001	121101	82269	41547
+Myst2.507	41910	84241	52804	161235
+Myst2.1183	7207	9429	5826	3312
+Myst2.3099	21920	6172	21876	2265
+Myst3.2590	690	0	1102	0
+Myst3.3127	3786	0	2861	0
+Myst3.3485	1716	21	1398	0
+Myst3.4554	15670	12777	11421	13526
+Myst3.6844	27947	10469	26576	30244
+Myst4.3568	12141	2967	3110	302
+Myst4.5452	16472	24567	19154	12044
+Myst4.6527	15970	3067	14141	2193
+Myst4.6644	21694	44024	22142	61368
+Nap1l1.2360	20442	8951	22291	4467
+Nap1l1.2470	15228	13610	16118	71731
+Nap1l1.3414	33493	21016	37336	5837
+Nap1l1.3554	19656	2232	17595	1953
+Nap1l2.819	18185	14552	18837	65021
+Nap1l2.1093	12286	230	9099	1446
+Nap1l2.1180	7721	1	10120	0
+Nap1l2.1695	13192	395	15216	2247
+Nap1l2.1750	11527	1977	12730	355
+Nap1l3.743	11414	34902	10526	15256
+Nap1l3.779	10585	453392	13704	246034
+Nap1l3.1969	48200	1958	40917	2939
+Nap1l3.2063	5157	569	6952	6
+Nap1l3.2498	4447	43	2318	8
+Ncoa3.1032	13841	5149	15348	10926
+Ncoa3.3669	17643	5797	12819	13390
+Ncoa3.3815	6003	0	4303	512
+Ncoa3.3885	8252	1	7232	527
+Ncoa3.7494	3221	14	3092	724
+Nr0b2.381	11504	6	9099	734
+Nr0b2.534	10457	1255	8156	3874
+Nr0b2.558	19364	2303	17410	2131
+Nr0b2.1023	42733	48641	39109	13800
+Nr0b2.1068	58582	99191	69312	43078
+Nsd1.2795	0	0	415	238
+Nsd1.5598	21387	11162	17611	11484
+Nsd1.5640	22756	21	29222	334
+Nsd1.11634	6488	299	4923	3308
+Padi4.295	15624	4046	18150	408
+Padi4.1042	11140	5914	7592	9678
+Padi4.1058	7187	2580	9327	5213
+Padi4.1914	6051	2929	7850	1
+Padi4.2336	5954	352	8032	523
+Parp1.1124	10502	3860	10456	567
+Parp1.1623	4986	938	4516	94
+Parp1.2887	4108	1300	4481	6581
+Parp1.3789	15343	453	14110	13
+Parp1.3790	22972	7864	22581	8646
+Parp2.574	20473	250	12332	0
+Parp2.905	3913	1940	6975	0
+Parp2.946	8940	952	6587	0
+Parp2.1006	12735	20094	9708	16966
+Parp2.1429	3923	1209	1909	54
+Parp2.1677	21429	365	15745	701
+Pax5.154	7895	1858	7788	681
+Pax5.328	7916	3945	8084	2341
+Pax5.601	16755	412	16181	1171
+Pax5.852	5606	43539	6945	80501
+Pax5.914	7880	237	9620	2649
+Paxip1.3203	41990	12756	45697	3247
+Paxip1.3451	21718	77708	22111	91808
+Paxip1.3562	16353	10026	16730	13912
+Paxip1.3670	36342	334247	43757	46048
+Pcgf2.507	23232	7601	27671	10380
+Pcgf2.690	8265	1327	6110	49
+Pcgf2.801	18514	1270	22113	2903
+Pcgf2.982	33166	12751	28473	14390
+Pcgf2.1013	17638	1	20019	3606
+Pcmt1.619	18240	43248	19763	17914
+Pcmt1.620	3869	1	8380	1106
+Pcmt1.840	23942	591737	28292	852487
+Pcmt1.946	7092	2887	7370	7007
+Pcmt1.1259	36457	29451	34007	14026
+Pcna.566	57814	1239	48176	293
+Pcna.1186	22524	0	21335	0
+Phf1.561	29733	32867	26321	1012
+Phf1.637	24740	11373	12636	2567
+Phf1.1098	6665	1228	6817	360
+Phf1.2400	13673	2799	11408	1727
+Phf2.1851	16125	7502	17489	1720
+Phf2.3668	3941	7	3400	2394
+Phf2.5132	46204	31225	41687	56982
+Phf2.5166	49720	28142	45140	127055
+Phf8.1420	44092	22623	45369	25710
+Phf8.1984	25612	1565	21593	2593
+Phf8.2131	11570	480	6245	3
+Polr2b.489	4441	0	3338	0
+Polr2b.2176	14171	1	16062	0
+Ppargc1a.669	8229	7478	10179	1715
+Ppargc1a.831	221	0	257	0
+Ppargc1a.1269	34453	15023	26676	10184
+Ppargc1a.1500	20357	4144	22189	5681
+Prdm1.711	7594	136	12326	1021
+Prdm1.862	13674	1272	17495	2820
+Prdm1.919	7981	211	6452	659
+Prdm1.2964	9702	1649	6519	74
+Prdm1.3709	6880	2963	4367	6545
+Prdm10.318	38326	1624	35774	3435
+Prdm10.1130	22199	3710	18678	2910
+Prdm10.1348	14385	2569	11194	719
+Prdm10.2613	9338	5136	8248	0
+Prdm11.1844	7683	26	9378	903
+Prdm11.2306	2693	505	1394	36
+Prdm11.3215	34411	12308	45331	6294
+Prdm11.3216	9073	928	6858	1530
+Prdm12.481	11080	1	8398	2032
+Prdm12.603	18533	2716	14848	1285
+Prdm12.1421	11165	13	7190	522
+Prdm12.2351	35983	35549	39030	28743
+Prdm13.554	6553	145	6306	626
+Prdm13.2613	24026	74465	26691	198619
+Prdm13.2702	1483	0	964	1006
+Prdm13.2828	21409	2400	19712	753
+Prdm13.2936	20674	4192	24072	8085
+Prdm14.530	6054	2386	6453	2689
+Prdm14.1756	2872	0	3280	39
+Prdm14.1934	1736	915	2137	128
+Prdm14.2271	23286	2272	18192	2265
+Prdm14.2348	4410	186	4574	4312
+Prdm15.958	948	1832	1351	44
+Prdm15.1034	7500	28	7058	31
+Prdm15.1690	11098	4766	8877	5507
+Prdm15.1796	18603	3415	17010	2809
+Prdm15.2734	6593	26	11491	850
+Prdm16.680	27382	18093	23775	9678
+Prdm16.5683	9804	1774	12654	158
+Prdm16.8212	510	0	75	0
+Prdm16.8363	32959	8200	37005	22671
+Prdm16.8571	41183	105040	34452	72617
+Prdm2.1020	5835	1513	6535	313
+Prdm2.4191	17204	8644	12039	7427
+Prdm2.4655	0	0	0	0
+Prdm2.4956	30817	4934	19758	407
+Prdm2.5781	7580	2678	7412	1599
+Prdm4.1943	32986	1564	27413	5021
+Prdm4.2535	5176	1	4929	841
+Prdm4.3139	3980	0	1329	3
+Prdm4.3391	12217	729	13747	1087
+Prdm4.3667	189	0	71	0
+Prdm5.908	17017	2184	16584	2824
+Prdm5.984	9047	5630	6870	1405
+Prdm5.1353	5507	11532	2450	2925
+Prdm5.2148	29180	20887	26070	15137
+Prdm6.1018	8513	95	9250	75
+Prdm6.1790	27811	2748	38933	5747
+Prdm6.1823	10397	3921	13953	3896
+Prdm6.1839	8440	2848	8331	542
+Prdm8.2290	2074	1	1661	1
+Prdm8.3042	18563	110944	22244	10919
+Prdm8.3048	9249	10791	8032	922
+Prdm8.3062	34157	8769	24864	11608
+Prdm9.77	8384	2377	9245	4796
+Prdm9.496	2638	207	1667	611
+Prdm9.1838	28476	11399	32679	6714
+Prkaa1.145	15289	2584	16946	1937
+Prkaa1.1981	7523	146	8342	164
+Prkaa1.3080	1662	0	458	0
+Prkaa1.3635	51745	221378	47732	100294
+Prkaa1.3954	3718	0	3379	89
+Prkaa1.4596	14178	836	18454	170
+Prkaa2.2299	2066	1	4279	35
+Prkaa2.2748	1877	680	1923	614
+Prkaa2.4825	0	0	21	0
+Prkaa2.6172	2701	0	2936	119
+Prkaa2.6849	21406	1548	23709	4690
+Prkcd.161	5086	508	6961	1803
+Prkcd.441	685	1	1449	947
+Prkcd.707	9014	9663	10168	2609
+Prkcd.1389	1525	978	1423	2661
+Prmt1.243	15068	1812	18422	1862
+Prmt1.264	46040	17605	55341	9030
+Prmt1.630	20371	35935	26429	23619
+Prmt1.1014	26740	17066	25371	8374
+Prmt2.151	7523	284	7173	183
+Prmt2.154	8667	10496	12546	9225
+Prmt2.1066	5444	1	4843	0
+Prmt2.1067	11455	7496	10344	10105
+Prmt3.502	2673	842	4409	0
+Prmt3.814	7852	0	10218	1
+Prmt3.838	26818	112940	29743	86471
+Prmt3.985	43276	18317	37898	4768
+Prmt3.1839	2270	338	6325	498
+Prmt5.56	1674	759	613	677
+Prmt5.266	40637	7070	40157	9218
+Prmt5.2152	5093	390	7676	1360
+Prmt5.2293	8377	3933	8176	31947
+Prmt6.247	16408	14	12340	822
+Prmt6.1493	4884	1134	4611	168
+Prmt6.1983	10376	1738	7729	1099
+Prmt6.2355	7539	4086	9278	4263
+Prmt7.23	1245	6	1139	16
+Prmt7.45	41811	21691	44665	25418
+Prmt7.88	21561	1050	22146	2492
+Prmt7.1284	11267	1422	12595	48
+Prmt7.2135	13417	5187	13065	1089
+Prmt8.302	32365	6417	32121	9345
+Prmt8.455	29562	23733	30364	11859
+Prmt8.667	9965	870	10199	41
+Prmt8.1854	35676	2488	32704	4795
+Psip1.763	4282	0	4395	73
+Psip1.1311	2929	0	7223	0
+Psip1.1596	24286	2117	24019	775
+Psip1.2474	10661	133	13615	0
+Psip1.2652	54657	5848	56080	947
+Rbbp4.2088	14907	1879	17367	4542
+Rbbp4.2174	2162	0	1290	15
+Rbbp4.2511	23749	23858	32454	27646
+Rbbp4.3753	8597	1167	6013	66
+Rbbp5.1634	33001	38166	28644	25077
+Rbbp5.2248	29504	43	32701	4
+Rbbp5.2655	6168	1052	11246	825
+Rbbp5.2974	7237	10464	10292	13922
+Renilla.713	367178	563164	344553	620131
+Ring1.260	1691	45	1582	863
+Ring1.669	11819	2018	8157	1301
+Ring1.1034	4600	75	7179	2477
+Rnf2.1856	7494	6249	13866	7112
+Rnf2.2203	30535	25972	25569	27068
+Rnf2.2538	46115	24976	46018	52199
+Rnf2.2809	9879	810	8811	2579
+Rnf2.2875	37646	26066	40057	16086
+Rnf20.420	36503	1984	34359	2525
+Rnf20.948	33597	14226	54979	7373
+Rnf20.1295	4427	0	4587	1
+Rnf20.3244	0	0	0	0
+Rnf20.3277	41281	33163	38179	4449
+Rnf20.3718	12555	17757	8721	7494
+Rpa1.1620	45458	16	57357	807
+Rpa3.276	35854	4	28720	1
+Rpa3.455	66725	1381	54371	851
+Rpa3.561	208162	536	199970	1389
+Satb1.710	5263	1702	7524	4
+Satb1.1401	36326	12944	26886	11529
+Satb1.1478	4562	2161	5968	38
+Satb1.1709	14269	1071	12405	3873
+Satb1.2566	3710	131	1155	407
+Setd1a.119	4384	748	4155	184
+Setd1a.388	33695	22014	30190	17010
+Setd1a.643	38998	65977	44426	60023
+Setd1a.5859	12239	11023	14509	10084
+Setd1b.3553	11381	0	18226	3
+Setd1b.3557	10915	1966	9020	1635
+Setd1b.4520	20976	1076	17850	6222
+Setd1b.4522	5428	0	10172	68
+Setd1b.4699	29600	2899	29677	5249
+Setd2.182	50766	2411	51817	1703
+Setd2.1467	7627	0	8664	3
+Setd2.1785	19426	534	23462	1152
+Setd2.3632	15881	7077	15278	4722
+Setd2.4051	8105	0	9809	0
+Setd3.795	3477	95	4288	970
+Setd3.1496	424	0	150	0
+Setd3.2395	5170	0	7159	175
+Setd4.506	8915	16	7889	13
+Setd4.1308	19600	1	30802	0
+Setd4.1517	2249	0	1736	0
+Setd7.4328	27912	38276	31452	6959
+Setd7.5317	23119	13552	19804	5863
+Setd7.5342	29195	1276	25869	6316
+Setd7.5940	0	0	0	0
+Setd7.7009	40400	1995	34707	2878
+Setd8.2578	4113	4	3366	1274
+Setd8.2622	42611	26560	45421	9076
+Setd8.2632	86958	216794	99707	79091
+Setdb1.1145	22800	10730	18391	10380
+Setdb1.1925	19087	0	12578	2178
+Setdb1.2174	9258	1	6981	2039
+Setdb1.3684	11551	1	13226	274
+Setdb2.809	10440	29022	8305	21
+Setdb2.810	37568	36190	41634	58990
+Setdb2.990	28467	613	24673	3385
+Setdb2.1417	9056	3565	14238	4287
+Setmar.1193	18271	6544	15427	3510
+Setmar.1195	9944	1350	9967	1878
+Setmar.1589	23950	1248927	26938	2049408
+Sfmbt1.868	7566	9131	8793	7208
+Sfmbt1.1345	9354	98	8211	55
+Sfmbt1.1802	3435	2478	2641	3402
+Sfmbt1.2018	2922	1389	1521	90
+Sfmbt1.2421	14771	24	12907	1929
+Sfmbt2.602	14404	7493	12974	547
+Sfmbt2.3592	7795	44	3204	513
+Sfmbt2.5673	10825	213	8582	2138
+Sin3a.531	634	0	1702	0
+Sin3a.3537	22343	0	23130	1126
+Sin3a.3559	3950	11186	4588	2872
+Sin3a.4729	2903	0	3390	0
+Sin3b.188	6644	562	7276	0
+Sin3b.326	40114	91267	52170	31420
+Sin3b.338	6940	0	4025	850
+Sin3b.381	3401	844	1798	39
+Sin3b.475	4577	5120	5887	945
+Sirt1.688	19362	38333	23363	21555
+Sirt1.1708	197153	144560	193622	102444
+Sirt1.1779	17885	6024	15615	8384
+Sirt1.2191	7851	19851	6431	5987
+Sirt2.735	10121	31	8695	2542
+Sirt2.1418	51603	4818	41566	7049
+Sirt2.1460	9317	2705	4885	1287
+Sirt2.1600	28368	738	27560	591
+Sirt3.462	12608	8937	23079	3496
+Sirt3.869	7400	241	6738	958
+Sirt3.993	8931	9252	7877	9460
+Sirt3.1002	2040	426	2568	1087
+Sirt3.1236	15566	3873	20108	4350
+Sirt4.105	28968	24512	24897	18143
+Sirt4.633	14159	257	11725	9490
+Sirt4.1490	7280	3400	12576	961
+Sirt4.1806	21710	7905	25165	1464
+Sirt5.586	41392	2529	43804	1104
+Sirt5.1032	981	0	444	671
+Sirt5.1219	43332	63257	35460	30451
+Sirt5.1290	14394	2383	24051	3183
+Sirt6.83	24755	1313	21310	405
+Sirt6.421	14293	0	12196	3
+Sirt6.937	17858	2868	28828	8748
+Sirt6.1609	18792	1621	18577	11944
+Sirt7.841	2362	0	2342	0
+Sirt7.844	30249	3373	28104	9318
+Sirt7.1238	14603	3027	8531	1909
+Sirt7.1604	3339	13	3293	767
+Sirt7.1677	8411	4502	6020	2215
+Smarca1.1401	33840	57146	25759	15929
+Smarca1.1430	29317	23044	26964	3632
+Smarca1.1613	26153	1619	25359	4043
+Smarca1.1893	15155	3318	11343	2367
+Smarca1.3418	18683	20393	21196	2633
+Smarca2.263	28313	5055	19538	3254
+Smarca2.274	799	0	685	0
+Smarca2.712	3352	13	4803	323
+Smarca2.1061	18983	2278	7875	323
+Smarca4.3232	1287	0	1543	0
+Smarca4.3364	12192	0	9172	3410
+Smarca4.3633	12283	2082	7827	268
+Smarca4.4935	20721	13230	19425	5625
+Smarca4.5466	2050	0	1324	0
+Smarca5.1139	38415	1132532	46081	2237665
+Smarca5.1264	11896	1222	13262	0
+Smarca5.3886	10888	46556	5016	7539
+Smarca5.4421	1718	81	4763	33
+Smarca5.4522	10483	13647	10095	20371
+Smarcc2.1398	29247	234724	29717	98347
+Smarcc2.1941	4410	553	7885	9608
+Smarcc2.2235	15214	6310	16647	2339
+Smarcc2.2541	15431	6136	13795	4700
+Smarcd1.690	13166	129	15195	758
+Smarcd1.986	14993	3694	16328	724
+Smarcd1.1738	8832	11477	8520	1934
+Smarcd1.1858	10888	3275	9600	888
+Smarcd3.518	12413	2339	11321	342
+Smarcd3.847	26274	4645	19349	7316
+Smarcd3.1323	28661	13110	28557	6669
+Smarcd3.1591	4047	935	3632	15
+Smarcd3.1708	2642	0	8094	0
+Smarce1.2096	9533	1983	6689	1627
+Smarce1.2121	36774	145025	36347	291079
+Smarce1.2154	29474	1127	40937	12039
+Smarce1.2337	28357	12960	30056	20823
+Smarce1.2593	11618	786	9889	1345
+Smyd1.1302	18136	2610	24378	2014
+Smyd1.1635	22181	16847	24576	23009
+Smyd1.1658	1744	139	1322	1184
+Smyd2.334	6201	2644	8081	1941
+Smyd2.640	4778	0	8728	0
+Smyd2.1421	5873	43	8087	485
+Smyd2.1476	29280	4886	27735	2780
+Smyd3.306	36640	64693	27190	5504
+Smyd3.438	7299	2499	7015	1359
+Smyd3.980	7252	51716	12288	65481
+Smyd3.1506	11477	0	9246	0
+Smyd3.2607	20309	10800	20516	5798
+Smyd4.693	7240	0	6185	429
+Smyd4.2959	10105	1792	11907	850
+Smyd4.3333	23476	3958	24531	9662
+Smyd4.3414	9832	633	10665	83
+Smyd4.3439	24075	2841	30616	2676
+Smyd5.1548	3233	3575	2919	14
+Smyd5.1643	22979	5462	25329	4173
+Smyd5.2044	4110	0	5406	1087
+Smyd5.2048	32582	187333	27131	88007
+Srcap.2697	2734	0	4412	3083
+Srcap.3130	26303	6435	28044	5059
+Srcap.5342	25111	1863	34202	1023
+Srcap.7360	2702	1	2989	0
+Srcap.11381	33874	12408	23101	5718
+Ssrp1.306	9024	0	5331	1396
+Ssrp1.577	11830	0	10214	0
+Ssrp1.897	1979	0	1920	0
+Ssrp1.975	9139	0	5141	1787
+Ssrp1.2237	18404	9074	12412	6693
+Supt16h.1672	19141	0	16741	0
+Supt16h.2037	3987	0	5301	0
+Supt16h.2827	2799	0	3742	1904
+Supt16h.2999	7017	13525	9120	10585
+Suv39h1.496	9760	51	9748	99
+Suv39h1.1016	11061	2285	8960	1041
+Suv39h1.1202	9865	18	9681	8563
+Suv39h1.1471	37679	28758	31264	26986
+Suv39h1.1827	8924	0	8966	26
+Suv39h2.1395	11929	19031	17833	17100
+Suv39h2.1871	14656	12220	13167	18556
+Suv39h2.2981	45343	27039	52720	14100
+Suv39h2.4184	35743	5240	31412	6431
+Suv420h1.1112	38281	18821	28569	15950
+Suv420h1.1327	3903	0	5390	1259
+Suv420h1.3263	15175	7482	15676	3830
+Suv420h1.3357	6838	14010	10166	6097
+Suv420h2.287	4714	35	1766	68
+Suv420h2.686	12691	1372	12522	1533
+Suv420h2.825	3954	0	4272	15
+Suz12.909	19186	788	22747	876
+Suz12.1676	48602	41328	42913	5210
+Suz12.1842	20807	0	26947	0
+Suz12.3979	34551	25839	37312	26473
+Suz12.4300	95918	361295	105525	82284
+Taf1.928	29566	17762	30431	7446
+Taf1.3994	3805	11349	4811	10913
+Taf1.5030	16687	97640	11553	1419722
+Taf1.7786	26447	3893	17078	15382
+Taf3.1009	47005	40334	56864	22863
+Taf3.1315	9721	1	11094	5798
+Taf3.1769	7972	348	4563	2535
+Taf3.2951	2050	0	3001	0
+Taf3.3182	2441	4367	7877	4886
+Ube2a.142	6844	0	10490	0
+Ube2a.786	26843	3732	31512	3188
+Ube2a.1206	16679	1913	13264	2325
+Ube2a.1411	12770	1093	15872	551
+Ube2b.776	11624	596	15283	991
+Ube2b.1626	5770	228	4749	460
+Ube2b.1661	11131	10339	15579	1101
+Ube2b.2075	36359	11211	35981	12669
+Ube2b.2079	27519	36285	22274	73852
+Ube2e1.228	9870	580	7343	0
+Ube2e1.858	44362	142918	47668	36510
+Ube2e1.1041	27358	51197	25570	21613
+Ube2e1.1126	7564	45	9319	711
+Ube2e1.1207	17571	12619	15690	7099
+Ube2e1.1357	64966	13745	77653	28390
+Ube2i.40	2401	1010	2600	1494
+Ube2i.2212	62796	63531	58362	90071
+Ube2i.2447	6276	607	7252	0
+Ube2i.2498	51201	35736	51072	80735
+Usp22.1429	13262	5695	17290	9139
+Usp22.2382	31385	3450	32459	3697
+Usp22.2760	8601	267	5822	541
+Usp22.3603	1065	1	273	0
+Usp27x.1408	3564	45	4275	997
+Usp27x.2829	25035	4402	24751	8224
+Usp27x.2922	2730	1290	3453	578
+Usp27x.3592	6464	341	5536	2973
+Usp27x.3593	14001	3741	11248	384504
+Usp51.737	1039	406	562	802
+Usp51.1997	53674	23257	51654	9694
+Usp51.2109	7975	1484	8900	1269
+Usp51.2114	12165	116	13434	917
+Usp51.2194	3678	724	1318	2196
+Utx.652	13068	56560	19451	96391
+Utx.888	18640	32639	23825	9547
+Utx.1445	17137	32295	23244	29207
+Utx.4317	33766	102551	27815	12107
+Utx.4510	12851	40012	12155	17742
+Wbp7.2972	24413	60018	36070	20515
+Wbp7.3029	8164	0	11414	806
+Wbp7.5587	1840	0	2933	0
+Wbp7.6965	2142	0	1208	0
+Wdr5.501	9132	40067	12091	5193
+Wdr5.502	7780	475	6238	144
+Wdr5.1321	33084	8610	29142	6825
+Wdr5.1765	15206	0	11812	0
+Wdr5.2837	10752	1577	8922	76
+Wdr82.1889	9318	158922	6926	133595
+Wdr82.3590	102793	67621	100194	42465
+Wdr82.3705	25607	2390	22211	5706
+Wdr82.4023	47467	54245	35961	10951
+Whsc1.812	5301	8373	8384	1919
+Whsc1.818	21079	7170	18333	11013
+Whsc1.3055	20202	3	16818	4080
+Whsc1.3056	14848	3566	17067	3063
+Whsc1l1.276	8983	16	15356	86
+Whsc1l1.373	24335	1	18394	19
+Whsc1l1.524	25667	33492	20530	18722
+Whsc1l1.1307	36165	3810	43502	5067
+Whsc1l1.1653	1740	0	2619	0
+Wnt5a.2013	14662	2054	14921	8784
+Wnt5a.2659	31981	25084	30296	21463
+Wnt5a.2764	3508	402	4188	0
+Wnt5a.4154	24598	41766	25258	11415
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/zuber-sample_anno.txt	Mon Jan 19 22:14:10 2015 -0500
@@ -0,0 +1,5 @@
+"ID"	"group"
+"Reads_A_T0"	"Day 0"
+"Reads_A_T14"	"Day 14"
+"Reads_B_T0"	"Day 0"
+"Reads_B_T14"	"Day 14"
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/zuber-target_anno.txt	Mon Jan 19 22:14:10 2015 -0500
@@ -0,0 +1,1106 @@
+ID	Gene	GeneID	Pool	shRNA_start	Mean_T14.T0	T14.T0_A	T14.T0_B
+100043305.2	100043305	100043305	LIB	158	0.200312349	0.268684264	0.131940433
+100043305.4	100043305	100043305	LIB	369	0.665480322	0.000178923	1.330781721
+100043305.5	100043305	100043305	LIB	458	0.410099904	0.199787845	0.620411962
+2900092E17Rik.377	2900092E17Rik	67278	LIB	377	0.002146138	0.00204099	0.002251286
+2900092E17Rik.546	2900092E17Rik	67278	LIB	546	0.004655918	0.008377548	0.000934288
+2900092E17Rik.1051	2900092E17Rik	67278	LIB	1051	0.273324357	0.165854931	0.380793783
+2900092E17Rik.1361	2900092E17Rik	67278	LIB	1361	0.2489911	0.201788909	0.29619329
+Actl6b.379	Actl6b	83766	LIB	379	0.449690571	0.432060881	0.467320261
+Actl6b.819	Actl6b	83766	LIB	819	0.557452935	0.742589485	0.372316384
+Actl6b.917	Actl6b	83766	LIB	917	0.001775631	0.000845309	0.002705953
+Actl6b.989	Actl6b	83766	LIB	989	0.234356062	0.322320709	0.146391415
+Actl6b.1221	Actl6b	83766	LIB	1221	0.056185902	0.070641078	0.041730727
+Alkbh2.462	Alkbh2	231642	LIB	462	0.221138799	0	0.442277597
+Alkbh2.557	Alkbh2	231642	LIB	557	0.564841845	0.680914972	0.448768717
+Alkbh2.590	Alkbh2	231642	LIB	590	NA	NA	NA
+Alkbh2.640	Alkbh2	231642	LIB	640	0.274406089	0.334058432	0.214753745
+Alkbh2.641	Alkbh2	231642	LIB	641	0.625663102	1.012713108	0.238613096
+Alkbh3.552	Alkbh3	69113	LIB	552	0.035169734	0.012261229	0.058078239
+Alkbh3.843	Alkbh3	69113	LIB	843	0.095823083	0.006448957	0.185197208
+Alkbh3.901	Alkbh3	69113	LIB	901	0.499065664	0.927424983	0.070706346
+Alkbh3.1184	Alkbh3	69113	LIB	1184	0.705258812	0.517585507	0.892932117
+Aof2.1869	Aof2	99982	LIB	1869	0.001459856	0.000206825	0.002712886
+Aof2.1956	Aof2	99982	LIB	1956	0.088104342	0.008071553	0.168137131
+Aof2.2435	Aof2	99982	LIB	2435	0.195980329	0.234741368	0.15721929
+Aof2.2857	Aof2	99982	LIB	2857	0	0	0
+Ash1l.1031	Ash1l	192195	LIB	1031	0.31947451	0.313544189	0.32540483
+Ash1l.1280	Ash1l	192195	LIB	1280	0.167683133	0.220091783	0.115274483
+Ash1l.3810	Ash1l	192195	LIB	3810	NA	NA	NA
+Ash1l.8132	Ash1l	192195	LIB	8132	0.401332534	0.200805702	0.601859367
+Ash1l.9540	Ash1l	192195	LIB	9540	0.139184254	0.254215372	0.024153137
+Ash2l.586	Ash2l	23808	LIB	586	0.46112578	0.22570026	0.696551301
+Ash2l.805	Ash2l	23808	LIB	805	0.573261557	0.767245885	0.37927723
+Ash2l.948	Ash2l	23808	LIB	948	0.235730162	0.418269791	0.053190532
+Ash2l.1135	Ash2l	23808	LIB	1135	0.035165394	0.002115526	0.068215262
+Ash2l.2130	Ash2l	23808	LIB	2130	1.241609259	1.460589922	1.022628597
+Asxl1.2020	Asxl1	228790	LIB	2020	0.059766771	0.009568839	0.109964703
+Asxl1.3548	Asxl1	228790	LIB	3548	0.10962211	0.118078719	0.101165501
+Asxl1.3785	Asxl1	228790	LIB	3785	0.418395785	0.701615799	0.135175771
+Asxl1.4792	Asxl1	228790	LIB	4792	0.292975143	0.202313712	0.383636573
+Asxl1.5221	Asxl1	228790	LIB	5221	NA	NA	NA
+Asxl1.6315	Asxl1	228790	LIB	6315	0.42809245	0.550629344	0.305555556
+Asxl2.11	Asxl2	75302	LIB	11	0.069299389	0.09512504	0.043473739
+Asxl2.4563	Asxl2	75302	LIB	4563	1.831446558	1.40504451	2.257848606
+Asxl2.6593	Asxl2	75302	LIB	6593	0.590189219	1.1171875	0.063190938
+Asxl2.7130	Asxl2	75302	LIB	7130	0.366813082	0.684577114	0.049049049
+Asxl2.7253	Asxl2	75302	LIB	7253	0.117667517	0	0.235335034
+Asxl3.6101	Asxl3	211961	LIB	6101	0.375913898	0.327116212	0.424711584
+Asxl3.6824	Asxl3	211961	LIB	6824	NA	NA	NA
+Asxl3.8947	Asxl3	211961	LIB	8947	0.296002749	0.122132318	0.469873181
+Asxl3.10021	Asxl3	211961	LIB	10021	0.026435101	0.00690583	0.045964372
+Asxl3.11070	Asxl3	211961	LIB	11070	0.049530555	0.063099738	0.035961372
+Asxl3.11073	Asxl3	211961	LIB	11073	0.027907605	0.003065917	0.052749293
+Atm.137	Atm	11920	LIB	137	6.47E-05	0.000129433	0
+Atm.4098	Atm	11920	LIB	4098	2.922281386	4.477807971	1.366754801
+Atm.4998	Atm	11920	LIB	4998	0	0	0
+Atm.5616	Atm	11920	LIB	5616	0.443498086	0.657270086	0.229726085
+Atm.7782	Atm	11920	LIB	7782	0.260352231	0.308840206	0.211864257
+Atm.9396	Atm	11920	LIB	9396	0.60032482	0.359381765	0.841267876
+Atr.1239	Atr	245000	LIB	1239	0.005067342	0	0.010134685
+Atr.3160	Atr	245000	LIB	3160	0	0	0
+Atr.4762	Atr	245000	LIB	4762	0.149038652	0.070833921	0.227243383
+Atr.6186	Atr	245000	LIB	6186	0.128457676	0.106936416	0.149978936
+Atr.7888	Atr	245000	LIB	7888	0.147861249	0.264325323	0.031397174
+Atrx.2490	Atrx	22589	LIB	2490	0.396582444	0.600036694	0.193128195
+Atrx.5490	Atrx	22589	LIB	5490	0.356515297	0.533129237	0.179901356
+Atrx.6144	Atrx	22589	LIB	6144	4.974521294	2.266989851	7.682052736
+Atrx.7173	Atrx	22589	LIB	7173	0.05387472	0.096820809	0.01092863
+Atrx.7377	Atrx	22589	LIB	7377	0.837321391	1.529071015	0.145571768
+Aurkb.520	Aurkb	20877	LIB	520	0.008388288	0.015122511	0.001654064
+Aurkb.631	Aurkb	20877	LIB	631	0.824053234	1.06458435	0.583522118
+Aurkb.917	Aurkb	20877	LIB	917	0.024491203	0.008743956	0.04023845
+Aurkb.928	Aurkb	20877	LIB	928	0.010416667	0	0.020833333
+Aurkb.1620	Aurkb	20877	LIB	1620	0	0	0
+Aurkb.1803	Aurkb	20877	LIB	1803	0.125188349	0.175752051	0.074624647
+Baz1a.2095	Baz1a	217578	LIB	2095	0.507940486	0.356679709	0.659201262
+Baz1a.2451	Baz1a	217578	LIB	2451	2.159026811	3.284734348	1.033319275
+Baz1a.4993	Baz1a	217578	LIB	4993	0.64349492	0.507178218	0.779811623
+Baz1a.5946	Baz1a	217578	LIB	5946	0.080389068	0.05529467	0.105483466
+Baz1b.801	Baz1b	22385	LIB	801	0.000639494	0.000888362	0.000390625
+Baz1b.3683	Baz1b	22385	LIB	3683	0.360095959	0.069445862	0.650746056
+Baz1b.5646	Baz1b	22385	LIB	5646	0.016297649	0.018375115	0.014220183
+Baz1b.6371	Baz1b	22385	LIB	6371	0.14306644	0	0.286132879
+Bmi1.698	Bmi1	12151	LIB	698	0.092709454	0.069620729	0.11579818
+Bmi1.895	Bmi1	12151	LIB	895	0.035594283	0.071188567	0
+Bmi1.1440	Bmi1	12151	LIB	1440	NA	NA	NA
+Bmi1.1746	Bmi1	12151	LIB	1746	0.118689343	0.122838849	0.114539838
+Bmi1.2404	Bmi1	12151	LIB	2404	0	0	0
+Bmi1.2561	Bmi1	12151	LIB	2561	0.454904159	0.631757214	0.278051103
+Bop1.778	Bop1	12181	LIB	778	0.672354814	0.445185419	0.899524209
+Bop1.2228	Bop1	12181	LIB	2228	0.142000285	0.127547666	0.156452904
+Bop1.2403	Bop1	12181	LIB	2403	0	0	0
+Bptf.1622	Bptf	207165	LIB	1622	0.077104921	0.08259276	0.071617083
+Bptf.3234	Bptf	207165	LIB	3234	0.057370498	0.065993919	0.048747077
+Bptf.7211	Bptf	207165	LIB	7211	0.024626408	0.021392709	0.027860107
+Bptf.8224	Bptf	207165	LIB	8224	0.410946348	0.179452295	0.6424404
+Braf.3750	Braf	109880	NC	3750	0.412381245	0.44332883	0.38143366
+Braf.3826	Braf	109880	NC	3826	0.129826198	0.1681838	0.091468596
+Braf.5053	Braf	109880	NC	5053	2.34833908	2.720656406	1.976021753
+Brd1.286	Brd1	223770	LIB	286	0.094299073	0.000374953	0.188223194
+Brd1.287	Brd1	223770	LIB	287	0.480557434	0.680387664	0.280727205
+Brd1.2096	Brd1	223770	LIB	2096	0.041243445	0.031141199	0.051345691
+Brd1.4229	Brd1	223770	LIB	4229	0.013231982	0.026463964	0
+Brd2.813	Brd2	14312	LIB	813	22.77961486	42.66701779	2.892211933
+Brd2.1714	Brd2	14312	LIB	1714	0.144143286	0.249835634	0.038450937
+Brd2.3011	Brd2	14312	LIB	3011	0.028355134	0.029962547	0.02674772
+Brd2.3396	Brd2	14312	LIB	3396	NA	NA	NA
+Brd3.187	Brd3	67382	LIB	187	3.11E-05	0	6.22E-05
+Brd3.298	Brd3	67382	LIB	298	0.056505575	0.058248337	0.054762814
+Brd3.411	Brd3	67382	LIB	411	0.756328621	1.503010235	0.009647007
+Brd3.4162	Brd3	67382	LIB	4162	0.633054482	0.738127854	0.52798111
+Brd4.523	Brd4	57261	LIB	523	0.010380898	0.004175644	0.016586151
+Brd4.552	Brd4	57261	LIB	552	0	0	0
+Brd4.632	Brd4	57261	LIB	632	0	0	0
+Brd4.1448	Brd4	57261	LIB	1448	0.135273343	0.118396988	0.152149699
+Brd4.2097	Brd4	57261	LIB	2097	0	0	0
+Carm1.892	Carm1	59035	LIB	892	0.079435576	0.000380084	0.158491069
+Carm1.1222	Carm1	59035	LIB	1222	0.075280112	0	0.150560224
+Carm1.1454	Carm1	59035	LIB	1454	0	0	0
+Carm1.1614	Carm1	59035	LIB	1614	0.243856333	0	0.487712665
+Carm1.1717	Carm1	59035	LIB	1717	0.001731885	0.002492331	0.00097144
+Cbx1.1004	Cbx1	12412	LIB	1004	0.057581903	0.083058046	0.03210576
+Cbx1.1053	Cbx1	12412	LIB	1053	1.091733912	0.589759684	1.593708139
+Cbx1.1099	Cbx1	12412	LIB	1099	0.57419689	0.919432666	0.228961114
+Cbx1.1103	Cbx1	12412	LIB	1103	0.458716872	0.142857143	0.774576601
+Cbx1.1210	Cbx1	12412	LIB	1210	0.245937138	0.37322759	0.118646686
+Cbx2.2033	Cbx2	12416	LIB	2033	0.134848542	0.001576873	0.268120212
+Cbx2.3537	Cbx2	12416	LIB	3537	0	0	0
+Cbx2.3545	Cbx2	12416	LIB	3545	0.710820484	1.275496689	0.146144279
+Cbx2.3620	Cbx2	12416	LIB	3620	0.134612189	0.008686441	0.260537937
+Cbx2.3706	Cbx2	12416	LIB	3706	1.147329284	1.49221144	0.802447127
+Cbx3.882	Cbx3	12417	LIB	882	0	0	0
+Cbx3.1206	Cbx3	12417	LIB	1206	0.118944773	0.131788129	0.106101417
+Cbx3.1339	Cbx3	12417	LIB	1339	0.142134201	0.070435009	0.213833393
+Cbx3.1719	Cbx3	12417	LIB	1719	0	0	0
+Cbx3.1735	Cbx3	12417	LIB	1735	0.115344034	0.011380552	0.219307515
+Cbx4.1794	Cbx4	12418	LIB	1794	1.364806716	0.371060327	2.358553106
+Cbx4.1844	Cbx4	12418	LIB	1844	0.700301215	1.223163842	0.177438588
+Cbx4.2573	Cbx4	12418	LIB	2573	0.817611719	0.890839629	0.744383809
+Cbx4.4403	Cbx4	12418	LIB	4403	0.215720626	0	0.431441252
+Cbx4.5120	Cbx4	12418	LIB	5120	0.497429027	0.398906637	0.595951417
+Cbx5.1309	Cbx5	12419	LIB	1309	0.986138423	0.975527017	0.996749828
+Cbx5.4366	Cbx5	12419	LIB	4366	0	0	0
+Cbx5.4409	Cbx5	12419	LIB	4409	0.18203172	0.15420805	0.20985539
+Cbx5.4508	Cbx5	12419	LIB	4508	0.693812292	0.764903255	0.622721329
+Cbx5.5707	Cbx5	12419	LIB	5707	0.232529345	0.127116437	0.337942253
+Cbx5.8586	Cbx5	12419	LIB	8586	0.176272377	0.350797267	0.001747488
+Cbx6.1535	Cbx6	494448	LIB	1535	1.317433547	0.026128266	2.608738828
+Cbx6.3332	Cbx6	494448	LIB	3332	0.628106622	1.114166972	0.142046271
+Cbx6.3473	Cbx6	494448	LIB	3473	1.362208923	0.193768257	2.530649588
+Cbx6.3969	Cbx6	494448	LIB	3969	0.591043966	0.80244028	0.379647652
+Cbx7.745	Cbx7	52609	LIB	745	0.218502726	0.203358299	0.233647153
+Cbx7.1633	Cbx7	52609	LIB	1633	0.040584859	0	0.081169719
+Cbx7.1634	Cbx7	52609	LIB	1634	0.075718892	0.000117758	0.151320026
+Cbx7.1639	Cbx7	52609	LIB	1639	0.100164464	0.124590164	0.075738763
+Cbx7.2006	Cbx7	52609	LIB	2006	0.080469517	0	0.160939034
+Cbx7.2504	Cbx7	52609	LIB	2504	0.038731085	0.004728435	0.072733736
+Cbx8.136	Cbx8	30951	LIB	136	0.110253195	0.038949338	0.181557052
+Cbx8.1120	Cbx8	30951	LIB	1120	0.226325463	0.218088273	0.234562653
+Cbx8.1342	Cbx8	30951	LIB	1342	1.082538396	1.289585162	0.87549163
+Chaf1a.166	Chaf1a	27221	LIB	166	0	0	0
+Chaf1a.1039	Chaf1a	27221	LIB	1039	0	0	0
+Chaf1a.2122	Chaf1a	27221	LIB	2122	0.397909545	0.698496344	0.097322746
+Chaf1b.367	Chaf1b	110749	LIB	367	0	0	0
+Chaf1b.566	Chaf1b	110749	LIB	566	0.303408945	0.482990787	0.123827104
+Chaf1b.692	Chaf1b	110749	LIB	692	0.287092522	0.574185043	0
+Chaf1b.901	Chaf1b	110749	LIB	901	0.20895781	0.141891892	0.276023728
+Chaf1b.1223	Chaf1b	110749	LIB	1223	0.040480317	0	0.080960634
+Chd1.746	Chd1	12648	LIB	746	0.109569072	0.112458184	0.10667996
+Chd1.1103	Chd1	12648	LIB	1103	0.03061677	0.03155467	0.029678869
+Chd1.2443	Chd1	12648	LIB	2443	0.119970268	0.110483782	0.129456754
+Chd1.2959	Chd1	12648	LIB	2959	0.204016851	0.209087277	0.198946425
+Chd1.4558	Chd1	12648	LIB	4558	0.579893278	1.122087605	0.037698952
+Chd1l.2305	Chd1l	68058	LIB	2305	0.171659277	0.161353286	0.181965268
+Chd1l.2598	Chd1l	68058	LIB	2598	0.064918568	0.001997004	0.127840131
+Chd1l.2804	Chd1l	68058	LIB	2804	0.320682295	0.225751283	0.415613308
+Chd2.926	Chd2	244059	LIB	926	0.138050187	0.180178767	0.095921607
+Chd2.3700	Chd2	244059	LIB	3700	0.397415785	0.434250439	0.360581131
+Chd2.3984	Chd2	244059	LIB	3984	0.134215951	0.080257186	0.188174716
+Chd2.8087	Chd2	244059	LIB	8087	0.189600975	0.263537572	0.115664379
+Chd2.8913	Chd2	244059	LIB	8913	0.073920542	0.106108526	0.041732558
+Chd3.482	Chd3	216848	LIB	482	0.08107178	0.014856739	0.147286822
+Chd3.3249	Chd3	216848	LIB	3249	0.071321859	0.011487304	0.131156413
+Chd3.4011	Chd3	216848	LIB	4011	0.289503582	0.42626498	0.152742183
+Chd3.6496	Chd3	216848	LIB	6496	0.044090494	0.030532487	0.057648502
+Chd3.7148	Chd3	216848	LIB	7148	2.340233512	1.930658742	2.749808282
+Chd3.7149	Chd3	216848	LIB	7149	0.156093321	0.116246872	0.19593977
+Chd4.2060	Chd4	107932	LIB	2060	0.000158747	0	0.000317494
+Chd4.3326	Chd4	107932	LIB	3326	NA	NA	NA
+Chd4.3423	Chd4	107932	LIB	3423	0.039003519	0.018129718	0.059877321
+Chd4.3772	Chd4	107932	LIB	3772	0.446854315	0.107456979	0.786251651
+Chd5.2301	Chd5	269610	LIB	2301	0.890171552	1.716215543	0.064127562
+Chd5.2900	Chd5	269610	LIB	2900	2.179569236	1.422986617	2.936151855
+Chd5.5471	Chd5	269610	LIB	5471	0.031951327	0.008029979	0.055872675
+Chd5.6392	Chd5	269610	LIB	6392	1.431979693	1.532967033	1.330992354
+Chd6.311	Chd6	71389	LIB	311	0.034464804	0.005788154	0.063141455
+Chd6.4698	Chd6	71389	LIB	4698	0.079293047	0.058312236	0.100273857
+Chd6.4988	Chd6	71389	LIB	4988	0.706143751	0.96534451	0.446942993
+Chd6.9610	Chd6	71389	LIB	9610	0.621464656	0.915195867	0.327733445
+Chd7.1269	Chd7	320790	LIB	1269	4.781464099	6.785229842	2.777698356
+Chd7.1502	Chd7	320790	LIB	1502	0.778617907	1.132855191	0.424380624
+Chd7.5857	Chd7	320790	LIB	5857	1.176684021	1.753802163	0.599565878
+Chd7.6498	Chd7	320790	LIB	6498	0.554422725	0.923791103	0.185054348
+Chd7.7229	Chd7	320790	LIB	7229	1.1593543	0.786077021	1.532631579
+Chd8.434	Chd8	67772	LIB	434	0.240881821	0.481763642	0
+Chd8.3265	Chd8	67772	LIB	3265	2.777624937	3.217093529	2.338156344
+Chd8.4169	Chd8	67772	LIB	4169	2.352884012	2.797262325	1.908505699
+Chd8.5352	Chd8	67772	LIB	5352	0.046980193	0	0.093960386
+Chd8.6946	Chd8	67772	LIB	6946	0.082319013	0.141659648	0.022978377
+Chd9.1402	Chd9	109151	LIB	1402	2.015703082	1.209699299	2.821706865
+Chd9.3919	Chd9	109151	LIB	3919	0.232392142	0.178955954	0.285828331
+Chd9.9352	Chd9	109151	LIB	9352	0.063600987	0.001541511	0.125660464
+Chd9.10928	Chd9	109151	LIB	10928	0.281642373	0.071780078	0.491504669
+Clock.693	Clock	12753	LIB	693	4.165656967	6.332554466	1.998759467
+Clock.1387	Clock	12753	LIB	1387	0.154177662	0.004555809	0.303799515
+Clock.4461	Clock	12753	LIB	4461	2.081932577	1.782110872	2.381754283
+Clock.4611	Clock	12753	LIB	4611	0.186897319	0.248041429	0.125753209
+Clock.5863	Clock	12753	LIB	5863	0	0	0
+Crebbp.704	Crebbp	12914	LIB	704	11.9485048	19.00330745	4.893702157
+Crebbp.2064	Crebbp	12914	LIB	2064	1.188115541	1.435698153	0.940532929
+Crebbp.2118	Crebbp	12914	LIB	2118	0.053391885	0.024676711	0.082107059
+Crebbp.3582	Crebbp	12914	LIB	3582	3.655607969	4.58780241	2.723413529
+Crebbp.4463	Crebbp	12914	LIB	4463	16.37310333	22.75705636	9.989150297
+Ctsl.940	Ctsl	13039	LIB	940	0.566559532	0.631030822	0.502088243
+Ctsl.1445	Ctsl	13039	LIB	1445	1.390909314	2.649395911	0.132422717
+Ctsl.1941	Ctsl	13039	LIB	1941	0.066051589	0.007621849	0.124481328
+Ctsl.1942	Ctsl	13039	LIB	1942	0.096645722	0.171270718	0.022020725
+Ctsl.1947	Ctsl	13039	LIB	1947	0.615592343	0.666345784	0.564838903
+Cxxc1.68	Cxxc1	74322	LIB	68	0.47853168	0.342590096	0.614473263
+Cxxc1.359	Cxxc1	74322	LIB	359	0.024227576	0	0.048455152
+Cxxc1.1889	Cxxc1	74322	LIB	1889	0.063713733	0.00804721	0.119380256
+Cxxc1.2034	Cxxc1	74322	LIB	2034	0.345104593	0.226497717	0.463711468
+Cxxc1.2133	Cxxc1	74322	LIB	2133	0.198889771	0.198522247	0.199257294
+Dmap1.439	Dmap1	66233	LIB	439	0.703875338	0.77262223	0.635128445
+Dmap1.518	Dmap1	66233	LIB	518	NA	NA	NA
+Dmap1.1354	Dmap1	66233	LIB	1354	0.14763293	0.098111837	0.197154022
+Dmap1.1355	Dmap1	66233	LIB	1355	0.42757955	0.089182969	0.765976131
+Dmap1.1487	Dmap1	66233	LIB	1487	1.398029255	2.142666181	0.65339233
+Dnmt1.437	Dnmt1	13433	LIB	437	0.216593143	0.00036049	0.432825795
+Dnmt1.828	Dnmt1	13433	LIB	828	0.031108522	0	0.062217045
+Dnmt1.1137	Dnmt1	13433	LIB	1137	0	0	0
+Dnmt1.4462	Dnmt1	13433	LIB	4462	0.107595678	0.084457173	0.130734182
+Dnmt1.4848	Dnmt1	13433	LIB	4848	2.73965767	4.554970263	0.924345077
+Dnmt3a.16	Dnmt3a	13435	LIB	16	1.725217186	1.842114421	1.608319951
+Dnmt3a.1669	Dnmt3a	13435	LIB	1669	0.151960261	0.274109644	0.029810877
+Dnmt3a.2338	Dnmt3a	13435	LIB	2338	0.464228303	0.546660024	0.381796582
+Dnmt3a.4173	Dnmt3a	13435	LIB	4173	2.839755061	1.630561738	4.048948383
+Dnmt3b.275	Dnmt3b	13436	LIB	275	0.111149425	0	0.222298851
+Dnmt3b.579	Dnmt3b	13436	LIB	579	0.190916889	0.103235294	0.278598485
+Dnmt3b.958	Dnmt3b	13436	LIB	958	0.051940249	0.10105972	0.002820777
+Dnmt3b.2218	Dnmt3b	13436	LIB	2218	0	0	0
+Dnmt3l.306	Dnmt3l	54427	LIB	306	0.009228421	0	0.018456842
+Dnmt3l.760	Dnmt3l	54427	LIB	760	0.639860874	0.834630621	0.445091128
+Dnmt3l.1049	Dnmt3l	54427	LIB	1049	0.275136367	0.291147084	0.25912565
+Dnmt3l.1333	Dnmt3l	54427	LIB	1333	0.729534649	0.550112191	0.908957107
+Dnmt3l.1350	Dnmt3l	54427	LIB	1350	0.869186931	1.148524754	0.589849108
+Dot1l.602	Dot1l	208266	LIB	602	0.052820647	0.104150504	0.001490789
+Dot1l.941	Dot1l	208266	LIB	941	NA	NA	NA
+Dot1l.3626	Dot1l	208266	LIB	3626	0	0	0
+Dub2a.769	Dub2a	384701	LIB	769	1.538125565	2.261141129	0.815110001
+Dub2a.1334	Dub2a	384701	LIB	1334	0.311123833	0.274834437	0.347413229
+Dub2a.1391	Dub2a	384701	LIB	1391	0	0	0
+Dub2a.1397	Dub2a	384701	LIB	1397	0.92660009	0.741578683	1.111621497
+Dub2a.1444	Dub2a	384701	LIB	1444	0.129914681	0.128666667	0.131162695
+Dub2a.1445	Dub2a	384701	LIB	1445	0.313809229	0.308336591	0.319281867
+Edf1.486	Edf1	59022	LIB	486	0.584392451	0.593347689	0.575437213
+Edf1.628	Edf1	59022	LIB	628	0.631092498	1.048248699	0.213936297
+Edf1.631	Edf1	59022	LIB	631	0.211734062	0.293841091	0.129627033
+Edf1.652	Edf1	59022	LIB	652	0.133434746	0.188121528	0.078747964
+Eed.710	Eed	13626	LIB	710	0	0	0
+Eed.949	Eed	13626	LIB	949	0.716286619	0.796963648	0.63560959
+Eed.1083	Eed	13626	LIB	1083	0.029501785	0.041323731	0.017679838
+Eed.1397	Eed	13626	LIB	1397	0.246827441	0.148140193	0.345514689
+Eed.1820	Eed	13626	LIB	1820	1.45400601	2.707134121	0.200877898
+EG330129.869	EG330129	330129	LIB	869	0.174185305	0.022923713	0.325446898
+EG330129.2118	EG330129	330129	LIB	2118	0.182159211	0.070402494	0.293915929
+EG330129.2262	EG330129	330129	LIB	2262	1.326585139	1.239206534	1.413963743
+EG330129.2329	EG330129	330129	LIB	2329	0.216031756	0.316051389	0.116012124
+EG546387.1344	EG546387	546387	LIB	1344	1.884762179	2.164840532	1.604683826
+EG546387.2159	EG546387	546387	LIB	2159	0.330597641	0.293600259	0.367595023
+EG546387.2272	EG546387	546387	LIB	2272	0.382783292	0.430418838	0.335147745
+Ehmt1.66	Ehmt1	77683	LIB	66	0.211522228	0.16763608	0.255408376
+Ehmt1.386	Ehmt1	77683	LIB	386	0.163750658	0.113922928	0.213578389
+Ehmt1.859	Ehmt1	77683	LIB	859	0	0	0
+Ehmt1.920	Ehmt1	77683	LIB	920	2.134228281	3.754773552	0.51368301
+Ehmt1.3003	Ehmt1	77683	LIB	3003	0.000117585	0.00023517	0
+Ehmt2.724	Ehmt2	110147	LIB	724	0.448962106	0.525151398	0.372772814
+Ehmt2.1880	Ehmt2	110147	LIB	1880	0.120154259	0.044799208	0.19550931
+Ehmt2.2014	Ehmt2	110147	LIB	2014	0.391040713	0.240246192	0.541835234
+Ehmt2.3146	Ehmt2	110147	LIB	3146	0.23467894	0.240075706	0.229282175
+Ehmt2.3202	Ehmt2	110147	LIB	3202	0.038002797	0.076005593	0
+Elp3.117	Elp3	74195	LIB	117	0.373058626	0.121392815	0.624724436
+Elp3.215	Elp3	74195	LIB	215	0.047358662	0.093162219	0.001555105
+Elp3.219	Elp3	74195	LIB	219	0.054251126	0.007308659	0.101193592
+Elp3.592	Elp3	74195	LIB	592	0.016186053	0.000130702	0.032241405
+Ep300.754	Ep300	328572	LIB	754	0.621685394	0.695170261	0.548200527
+Ep300.3850	Ep300	328572	LIB	3850	0	0	0
+Ep300.5490	Ep300	328572	LIB	5490	0.109121897	0.125441696	0.092802099
+Ep300.7826	Ep300	328572	LIB	7826	0.066538139	0.12088261	0.012193669
+Ep300.8647	Ep300	328572	LIB	8647	0.268474952	0.379490888	0.157459016
+Evi1.649	Evi1	14013	LIB	649	0.041338867	0.042903321	0.039774414
+Evi1.652	Evi1	14013	LIB	652	0.702939444	0.290198461	1.115680427
+Evi1.1371	Evi1	14013	LIB	1371	0.655772594	0.660998268	0.65054692
+Evi1.1978	Evi1	14013	LIB	1978	NA	NA	NA
+Evi1.2720	Evi1	14013	LIB	2720	0.5472099	0.513677435	0.580742364
+Ezh1.68	Ezh1	14055	LIB	68	0.645375689	0.276368717	1.01438266
+Ezh1.73	Ezh1	14055	LIB	73	0.545034582	0.000464684	1.08960448
+Ezh1.4104	Ezh1	14055	LIB	4104	0.161312023	0.013273543	0.309350504
+Ezh1.4105	Ezh1	14055	LIB	4105	0.171634666	0	0.343269333
+Ezh2.556	Ezh2	14056	LIB	556	0.466252547	0.612704524	0.31980057
+Ezh2.1370	Ezh2	14056	LIB	1370	0.123390861	7.64E-05	0.246705356
+Ezh2.1678	Ezh2	14056	LIB	1678	0.929056053	0.842508957	1.015603148
+Ezh2.2124	Ezh2	14056	LIB	2124	0.31242234	0.550174697	0.074669984
+Ezh2.2253	Ezh2	14056	LIB	2253	0.01894361	0.035966931	0.001920288
+Fbxl10.356	Fbxl10	30841	LIB	356	0.784501754	0.743513957	0.825489551
+Fbxl10.443	Fbxl10	30841	LIB	443	0	0	0
+Fbxl10.3131	Fbxl10	30841	LIB	3131	0.334422325	0.322283458	0.346561192
+Fbxl10.3145	Fbxl10	30841	LIB	3145	7.832968832	5.033134824	10.63280284
+Fbxl11.663	Fbxl11	225876	LIB	663	0.055910099	0.056709087	0.055111111
+Fbxl11.1840	Fbxl11	225876	LIB	1840	0.665785489	0.545696539	0.785874439
+Fbxl11.7144	Fbxl11	225876	LIB	7144	0.429356479	0.627018076	0.231694881
+Fbxl11.7145	Fbxl11	225876	LIB	7145	0.022754725	0.006901311	0.03860814
+Fbxl19.1945	Fbxl19	233902	LIB	1945	0.000400481	0.000800961	0
+Fbxl19.2841	Fbxl19	233902	LIB	2841	0	0	0
+Fbxl19.3203	Fbxl19	233902	LIB	3203	0.009336737	0	0.018673474
+Fkbp1a.646	Fkbp1a	14225	LIB	646	0.013864068	0.000782983	0.026945153
+Fkbp1a.827	Fkbp1a	14225	LIB	827	9.3066783	17.8021978	0.811158798
+Fkbp1a.851	Fkbp1a	14225	LIB	851	0.000933707	0.001867414	0
+Fkbp1a.854	Fkbp1a	14225	LIB	854	0.231878127	0.293098599	0.170657654
+Fkbp2.195	Fkbp2	14227	LIB	195	0.069369424	0.006895419	0.131843428
+Fkbp2.213	Fkbp2	14227	LIB	213	0	0	0
+Fkbp2.532	Fkbp2	14227	LIB	532	NA	NA	NA
+Fkbp2.581	Fkbp2	14227	LIB	581	0.082910366	0.073922933	0.091897799
+Fkbp5.595	Fkbp5	14229	LIB	595	0.338439879	0.280911589	0.39596817
+Fkbp5.628	Fkbp5	14229	LIB	628	0.089209903	0.17644742	0.001972387
+Fkbp5.1219	Fkbp5	14229	LIB	1219	0.000883913	0	0.001767826
+Fkbp5.2613	Fkbp5	14229	LIB	2613	NA	NA	NA
+Fkbp5.2813	Fkbp5	14229	LIB	2813	1.309441349	0	2.618882698
+Fkbp5.3272	Fkbp5	14229	LIB	3272	0.077016559	0.100727476	0.053305642
+Gtf3c4.2358	Gtf3c4	269252	LIB	2358	0.307657393	0.515803397	0.099511389
+Gtf3c4.2444	Gtf3c4	269252	LIB	2444	0.211577111	0.019757689	0.403396534
+Gtf3c4.2605	Gtf3c4	269252	LIB	2605	2.594960462	3.356335785	1.833585138
+Gtf3c4.3160	Gtf3c4	269252	LIB	3160	0.218403794	0.156206756	0.280600831
+Gtf3c4.3163	Gtf3c4	269252	LIB	3163	0.706197905	0.944937527	0.467458283
+H2afz.508	H2afz	51788	LIB	508	0.112249335	0.190899582	0.033599089
+H2afz.692	H2afz	51788	LIB	692	0.119788095	0.10965435	0.12992184
+H2afz.823	H2afz	51788	LIB	823	0	0	0
+H2afz.909	H2afz	51788	LIB	909	2.570129526	3.94702491	1.193234141
+H2afz.937	H2afz	51788	LIB	937	0.262185545	0.243682034	0.280689056
+Hat1.290	Hat1	107435	LIB	290	0.242612885	0.28585051	0.19937526
+Hat1.638	Hat1	107435	LIB	638	1.347345343	1.429206206	1.265484481
+Hat1.866	Hat1	107435	LIB	866	0.629381934	0.736795839	0.521968029
+Hat1.1528	Hat1	107435	LIB	1528	0.415532045	0.51072454	0.320339551
+Hcfc1.812	Hcfc1	15161	LIB	812	0.162841158	0.15639547	0.169286845
+Hcfc1.4648	Hcfc1	15161	LIB	4648	0.063853471	0	0.127706942
+Hcfc1.7430	Hcfc1	15161	LIB	7430	0.024043164	0.037148827	0.0109375
+Hcfc1.7506	Hcfc1	15161	LIB	7506	0.133648563	0.20077669	0.066520435
+Hcfc1.8014	Hcfc1	15161	LIB	8014	0.001865461	0.003730921	0
+Hdac1.245	Hdac1	433759	LIB	245	0.23785439	0.369592346	0.106116433
+Hdac1.1053	Hdac1	433759	LIB	1053	0.441444289	0.704354469	0.17853411
+Hdac1.1065	Hdac1	433759	LIB	1065	0.003350221	0.006700441	0
+Hdac1.1830	Hdac1	433759	LIB	1830	1.267186229	0.331748957	2.2026235
+Hdac10.1645	Hdac10	170787	LIB	1645	NA	NA	NA
+Hdac10.2041	Hdac10	170787	LIB	2041	0.034962353	0.003184375	0.066740331
+Hdac10.2307	Hdac10	170787	LIB	2307	0.244272107	0.406371338	0.082172877
+Hdac11.2025	Hdac11	232232	LIB	2025	0.034038791	0.067849687	0.000227894
+Hdac11.2058	Hdac11	232232	LIB	2058	0.616567512	0.530961372	0.702173652
+Hdac11.2182	Hdac11	232232	LIB	2182	0	0	0
+Hdac11.2460	Hdac11	232232	LIB	2460	0.179395578	0.071746032	0.287045124
+Hdac11.2461	Hdac11	232232	LIB	2461	0.106169791	0.145963878	0.066375705
+Hdac2.439	Hdac2	15182	LIB	439	0.120428617	0.098365041	0.142492194
+Hdac2.440	Hdac2	15182	LIB	440	0	0	0
+Hdac2.1184	Hdac2	15182	LIB	1184	1.736519405	1.729724166	1.743314643
+Hdac2.1611	Hdac2	15182	LIB	1611	0.555755616	0.901804888	0.209706344
+Hdac2.1919	Hdac2	15182	LIB	1919	0.22681503	0.273884154	0.179745907
+Hdac3.161	Hdac3	15183	LIB	161	0.027585567	0.052225083	0.00294605
+Hdac3.854	Hdac3	15183	LIB	854	0.19703596	0.313846421	0.080225499
+Hdac3.987	Hdac3	15183	LIB	987	9.200089463	15.16698706	3.23319187
+Hdac3.1037	Hdac3	15183	LIB	1037	0.194075242	0.388150484	0
+Hdac3.1491	Hdac3	15183	LIB	1491	0.078428253	0	0.156856507
+Hdac4.331	Hdac4	208727	LIB	331	0.249392869	0.421878803	0.076906935
+Hdac4.431	Hdac4	208727	LIB	431	12.91595763	23.42054693	2.41136833
+Hdac4.1903	Hdac4	208727	LIB	1903	0.656722465	0.484156227	0.829288703
+Hdac4.3273	Hdac4	208727	LIB	3273	0.086063916	0.063287745	0.108840087
+Hdac5.1115	Hdac5	15184	LIB	1115	0.146091516	0.292183031	0
+Hdac5.1936	Hdac5	15184	LIB	1936	0.311596614	0.41754442	0.205648809
+Hdac5.2060	Hdac5	15184	LIB	2060	0.050833282	0.001168224	0.100498339
+Hdac5.2412	Hdac5	15184	LIB	2412	0.153710614	7.29E-05	0.307348299
+Hdac5.2886	Hdac5	15184	LIB	2886	0.023975817	0.024090462	0.023861171
+Hdac6.530	Hdac6	15185	LIB	530	NA	NA	NA
+Hdac6.2249	Hdac6	15185	LIB	2249	0.395188053	0.790376106	0
+Hdac6.3838	Hdac6	15185	LIB	3838	0.463447784	0.373127484	0.553768085
+Hdac6.4026	Hdac6	15185	LIB	4026	0.673906334	0.58012685	0.767685818
+Hdac7.560	Hdac7	56233	LIB	560	0.05	0.1	0
+Hdac7.836	Hdac7	56233	LIB	836	1.003143594	0.60732691	1.398960277
+Hdac7.1293	Hdac7	56233	LIB	1293	0.232796973	0.260955434	0.204638512
+Hdac7.2255	Hdac7	56233	LIB	2255	0.180458299	0.321948649	0.038967948
+Hdac7.3429	Hdac7	56233	LIB	3429	0.108629839	0.07593243	0.141327247
+Hdac8.296	Hdac8	70315	LIB	296	0	0	0
+Hdac8.397	Hdac8	70315	LIB	397	0.346191954	0.376371183	0.316012725
+Hdac8.900	Hdac8	70315	LIB	900	0.06905	0.066867307	0.071232693
+Hdac8.1692	Hdac8	70315	LIB	1692	0.716122809	0.945390961	0.486854657
+Hdac9.1236	Hdac9	79221	LIB	1236	0.061659427	0.057717972	0.065600882
+Hdac9.1449	Hdac9	79221	LIB	1449	0.043527072	0.053540314	0.03351383
+Hdac9.2031	Hdac9	79221	LIB	2031	0.20955986	0.268333519	0.1507862
+Hdac9.2070	Hdac9	79221	LIB	2070	0.237782658	0.104923474	0.370641842
+Hdac9.4083	Hdac9	79221	LIB	4083	0.385634864	0.501316194	0.269953535
+Hells.977	Hells	15201	LIB	977	0.412970986	0.000769823	0.82517215
+Hells.1094	Hells	15201	LIB	1094	NA	NA	NA
+Hells.1145	Hells	15201	LIB	1145	0.069970575	0.086036762	0.053904388
+Hells.1703	Hells	15201	LIB	1703	1.268695155	1.091805094	1.445585216
+Hells.2323	Hells	15201	LIB	2323	0.098153695	0.146551233	0.049756158
+Hira.223	Hira	15260	LIB	223	0.038783499	0.047608174	0.029958824
+Hira.2318	Hira	15260	LIB	2318	0	0	0
+Hira.2835	Hira	15260	LIB	2835	1.729519941	2.66571554	0.793324343
+Hira.4298	Hira	15260	LIB	4298	0.054981253	0.011631924	0.098330582
+Hltf.252	Hltf	20585	LIB	252	0.405465225	0.538874518	0.272055932
+Hltf.455	Hltf	20585	LIB	455	0.441636316	0.589916076	0.293356556
+Hltf.497	Hltf	20585	LIB	497	3.701953893	1.507171929	5.896735857
+Hltf.1198	Hltf	20585	LIB	1198	0.200363394	0.039606523	0.361120264
+Ing2.649	Ing2	69260	LIB	649	0.026442538	0.001332149	0.051552926
+Ing2.1400	Ing2	69260	LIB	1400	0.441872864	0.485687809	0.398057919
+Ing2.1788	Ing2	69260	LIB	1788	0.00514048	0.009192066	0.001088893
+Ing2.1824	Ing2	69260	LIB	1824	0.230878224	0.327220173	0.134536275
+Ing2.2176	Ing2	69260	LIB	2176	0.110401249	0.03625	0.184552498
+Ino80.458	Ino80	68142	LIB	458	1.017141522	0.572352773	1.461930271
+Ino80.1194	Ino80	68142	LIB	1194	0.864776346	0.582272727	1.147279965
+Ino80.2062	Ino80	68142	LIB	2062	3.479477858	2.83947293	4.119482786
+Ino80.4069	Ino80	68142	LIB	4069	4.925644667	4.280960907	5.570328426
+Jarid1a.2826	Jarid1a	214899	LIB	2826	0.248654315	0.35031185	0.14699678
+Jarid1a.6729	Jarid1a	214899	LIB	6729	1.363948366	0.535007243	2.192889488
+Jarid1a.10299	Jarid1a	214899	LIB	10299	0.263122123	0.241511541	0.284732705
+Jarid1a.10802	Jarid1a	214899	LIB	10802	0.106583794	0	0.213167587
+Jarid1a.11640	Jarid1a	214899	LIB	11640	0.311471985	0.488261591	0.134682379
+Jarid1b.382	Jarid1b	75605	LIB	382	0.18904701	0.27594244	0.10215158
+Jarid1b.1671	Jarid1b	75605	LIB	1671	NA	NA	NA
+Jarid1b.2176	Jarid1b	75605	LIB	2176	NA	NA	NA
+Jarid1b.4339	Jarid1b	75605	LIB	4339	0.192060819	0.068007096	0.316114542
+Jarid1b.4527	Jarid1b	75605	LIB	4527	0.071297514	0.00530504	0.137289989
+Jarid1c.1882	Jarid1c	20591	LIB	1882	0.140338666	0.006669282	0.274008051
+Jarid1c.1886	Jarid1c	20591	LIB	1886	0.69700856	0.5224761	0.871541021
+Jarid1c.2010	Jarid1c	20591	LIB	2010	0.918964146	1.082710075	0.755218216
+Jarid1c.5632	Jarid1c	20591	LIB	5632	1.124564108	1.80619245	0.442935765
+Jarid1d.2138	Jarid1d	20592	LIB	2138	0.012383228	0.024766457	0
+Jarid1d.2800	Jarid1d	20592	LIB	2800	0.587157188	0.988469407	0.185844969
+Jarid1d.3002	Jarid1d	20592	LIB	3002	0.080944165	0.06776283	0.094125501
+Jarid1d.4830	Jarid1d	20592	LIB	4830	0.383022948	0.353332365	0.412713531
+Jarid2.1699	Jarid2	16468	LIB	1699	0.157375244	0.267980636	0.046769852
+Jarid2.2191	Jarid2	16468	LIB	2191	2.421585425	4.080815103	0.762355747
+Jarid2.3219	Jarid2	16468	LIB	3219	0	0	0
+Jhdm1d.2087	Jhdm1d	338523	LIB	2087	0.258961381	0.414341695	0.103581067
+Jhdm1d.2209	Jhdm1d	338523	LIB	2209	0.617600335	0.548194175	0.687006494
+Jhdm1d.3273	Jhdm1d	338523	LIB	3273	0.225125817	0.192359317	0.257892316
+Jhdm1d.6787	Jhdm1d	338523	LIB	6787	0.134739676	0.083890257	0.185589094
+Jhdm1d.8524	Jhdm1d	338523	LIB	8524	0.28018788	0.280165234	0.280210526
+Jmjd1a.371	Jmjd1a	104263	LIB	371	0	0	0
+Jmjd1a.753	Jmjd1a	104263	LIB	753	0.02953012	0.007313698	0.051746541
+Jmjd1a.1070	Jmjd1a	104263	LIB	1070	0.084311633	0	0.168623266
+Jmjd1a.3518	Jmjd1a	104263	LIB	3518	0.495965201	0.000211595	0.991718808
+Jmjd1b.1014	Jmjd1b	277250	LIB	1014	0.872781647	0.739329604	1.006233691
+Jmjd1b.3708	Jmjd1b	277250	LIB	3708	0.000261472	0	0.000522944
+Jmjd1b.5309	Jmjd1b	277250	LIB	5309	0.565075338	0.33739665	0.792754026
+Jmjd1b.6406	Jmjd1b	277250	LIB	6406	1.329007355	0.941659685	1.716355024
+Jmjd1b.6504	Jmjd1b	277250	LIB	6504	0.554591185	0.173112518	0.936069851
+Jmjd1c.649	Jmjd1c	108829	LIB	649	0.300678085	0.162322666	0.439033504
+Jmjd1c.3196	Jmjd1c	108829	LIB	3196	0.000842912	0.001685824	0
+Jmjd1c.4221	Jmjd1c	108829	LIB	4221	0.103679501	0.106351828	0.101007173
+Jmjd1c.6050	Jmjd1c	108829	LIB	6050	0.726982674	0.553239773	0.900725575
+Jmjd1c.6346	Jmjd1c	108829	LIB	6346	0.230741091	0.167158309	0.294323873
+Jmjd2a.424	Jmjd2a	230674	LIB	424	0.207264965	0.120808561	0.293721369
+Jmjd2a.663	Jmjd2a	230674	LIB	663	0.113322058	0.075793595	0.15085052
+Jmjd2a.1474	Jmjd2a	230674	LIB	1474	0.08913639	0.002784366	0.175488414
+Jmjd2a.1498	Jmjd2a	230674	LIB	1498	0.043079662	0.069152399	0.017006925
+Jmjd2a.3033	Jmjd2a	230674	LIB	3033	0.000831282	0.001034029	0.000628536
+Jmjd2b.1151	Jmjd2b	193796	LIB	1151	0.933461944	1.175144551	0.691779336
+Jmjd2b.2905	Jmjd2b	193796	LIB	2905	1.786480339	2.379093311	1.193867366
+Jmjd2b.4018	Jmjd2b	193796	LIB	4018	1.348195558	1.050841453	1.645549663
+Jmjd2b.4170	Jmjd2b	193796	LIB	4170	0.895988133	0.355499082	1.436477183
+Jmjd2c.738	Jmjd2c	76804	LIB	738	0.187741857	0.120085677	0.255398037
+Jmjd2c.1217	Jmjd2c	76804	LIB	1217	1.318076072	0.96347543	1.672676713
+Jmjd2c.3112	Jmjd2c	76804	LIB	3112	0.412965767	0.468026197	0.357905337
+Jmjd2c.3541	Jmjd2c	76804	LIB	3541	0.480747339	0.556819876	0.404674802
+Jmjd2d.301	Jmjd2d	244694	LIB	301	0.129064364	0.000328623	0.257800106
+Jmjd2d.450	Jmjd2d	244694	LIB	450	1.353922306	0.000965251	2.706879362
+Jmjd2d.1143	Jmjd2d	244694	LIB	1143	0.490140075	0.956008305	0.024271845
+Jmjd2d.2310	Jmjd2d	244694	LIB	2310	0.164979808	0.256726348	0.073233268
+Jmjd2d.2358	Jmjd2d	244694	LIB	2358	0.059442746	0.07510305	0.043782442
+Jmjd4.1722	Jmjd4	194952	LIB	1722	0.741528975	0.765657556	0.717400394
+Jmjd4.1796	Jmjd4	194952	LIB	1796	0.200102959	0.163622609	0.23658331
+Jmjd4.2677	Jmjd4	194952	LIB	2677	0.676849819	0.820704579	0.532995059
+Jmjd4.2749	Jmjd4	194952	LIB	2749	0.15829753	0.038494735	0.278100325
+Jmjd4.3327	Jmjd4	194952	LIB	3327	0.553203122	0.185103308	0.921302937
+Jmjd5.18	Jmjd5	77035	LIB	18	2.587739528	3.744000541	1.431478516
+Jmjd5.1123	Jmjd5	77035	LIB	1123	0.148414474	0.037384899	0.259444048
+Jmjd5.1291	Jmjd5	77035	LIB	1291	0.401904979	0.407221471	0.396588486
+Jmjd5.1564	Jmjd5	77035	LIB	1564	0.186949478	0.022460197	0.351438759
+Jmjd5.2041	Jmjd5	77035	LIB	2041	0.008618272	0.016029948	0.001206596
+Jmjd6.254	Jmjd6	107817	LIB	254	0.12362466	0.184941628	0.062307692
+Jmjd6.530	Jmjd6	107817	LIB	530	0.147628799	0.026531729	0.268725869
+Jmjd6.956	Jmjd6	107817	LIB	956	0.132745115	0.260845889	0.004644341
+Jmjd6.1633	Jmjd6	107817	LIB	1633	0.240665022	0.253816286	0.227513757
+Kat2a.542	Kat2a	14534	LIB	542	0.618565777	0.940924658	0.296206897
+Kat2a.1771	Kat2a	14534	LIB	1771	0.120971403	0	0.241942805
+Kat2a.2053	Kat2a	14534	LIB	2053	0.538437996	0.10757034	0.969305652
+Kat2a.2201	Kat2a	14534	LIB	2201	0.142403868	0.257946389	0.026861346
+Kat2b.1306	Kat2b	18519	LIB	1306	0.040373807	0.071984908	0.008762706
+Kat2b.2624	Kat2b	18519	LIB	2624	0.079970208	0.073811384	0.086129032
+Kat2b.3228	Kat2b	18519	LIB	3228	0.069588311	0.063063063	0.076113558
+Kat2b.3494	Kat2b	18519	LIB	3494	0.369201025	0.457417016	0.280985033
+Kat2b.3766	Kat2b	18519	LIB	3766	0.111142996	0.145979608	0.076306385
+Kat5.679	Kat5	81601	LIB	679	0.117228687	0.230010953	0.004446421
+Kat5.1193	Kat5	81601	LIB	1193	2.307918926	2.68596882	1.929869033
+Kat5.1242	Kat5	81601	LIB	1242	NA	NA	NA
+Kat5.1387	Kat5	81601	LIB	1387	3.821357363	3.433995327	4.208719399
+L3mbtl.263	L3mbtl	241764	LIB	263	0.199214313	0.000694806	0.39773382
+L3mbtl.373	L3mbtl	241764	LIB	373	0.290562147	0.414519609	0.166604686
+L3mbtl.725	L3mbtl	241764	LIB	725	0.389300951	0.33340748	0.445194422
+L3mbtl.1906	L3mbtl	241764	LIB	1906	0.01201515	0.024030299	0
+L3mbtl.2689	L3mbtl	241764	LIB	2689	0.068187318	0.136374637	0
+LOC100040412.49	LOC100040412	100040412	LIB	49	0.235139043	0.216814556	0.253463531
+LOC100040412.495	LOC100040412	100040412	LIB	495	NA	NA	NA
+LOC100040412.655	LOC100040412	100040412	LIB	655	0.385744528	0.194355059	0.577133998
+LOC100040412.1128	LOC100040412	100040412	LIB	1128	0.321175793	0.350280264	0.292071322
+LOC100044324.736	LOC100044324	100044324	LIB	736	0.541107405	0.527171897	0.555042912
+LOC100044324.927	LOC100044324	100044324	LIB	927	0.174749605	0.349499209	0
+LOC100044324.1075	LOC100044324	100044324	LIB	1075	4.38507001	5.72404439	3.046095631
+LOC100044324.1240	LOC100044324	100044324	LIB	1240	0.248179872	0	0.496359743
+LOC100044324.1314	LOC100044324	100044324	LIB	1314	0.215962555	0.146174702	0.285750408
+LOC100048887.186	LOC100048887	100048887	LIB	186	4.761125427	3.672516129	5.849734725
+LOC100048887.194	LOC100048887	100048887	LIB	194	0	0	0
+LOC100048887.732	LOC100048887	100048887	LIB	732	0.074897582	0.110762101	0.039033064
+LOC100048887.787	LOC100048887	100048887	LIB	787	0	0	0
+LOC100048887.803	LOC100048887	100048887	LIB	803	0.116716316	0.079717133	0.153715499
+LOC664892.1494	LOC664892	664892	LIB	1494	0.568467589	0.647703684	0.489231493
+LOC664892.1500	LOC664892	664892	LIB	1500	0.82744825	1.141203528	0.513692971
+LOC664892.1697	LOC664892	664892	LIB	1697	0.363859691	0.15822698	0.569492403
+LOC664892.1892	LOC664892	664892	LIB	1892	0.09125886	0.026162019	0.156355701
+LOC664892.2169	LOC664892	664892	LIB	2169	0.011900813	0.022360704	0.001440922
+Mbd1.746	Mbd1	17190	LIB	746	0.194643294	0.000376081	0.388910506
+Mbd1.1387	Mbd1	17190	LIB	1387	0.200901765	0.042339934	0.359463595
+Mbd1.1856	Mbd1	17190	LIB	1856	0.078750031	0.010875476	0.146624585
+Mbd1.2237	Mbd1	17190	LIB	2237	0.145222056	0.013529275	0.276914837
+Mbd2.938	Mbd2	17191	LIB	938	0.033554608	0	0.067109216
+Mbd2.1117	Mbd2	17191	LIB	1117	0.276620876	0.447187977	0.106053776
+Mbd2.1545	Mbd2	17191	LIB	1545	0.103798129	0.202524797	0.005071462
+Mbd2.1763	Mbd2	17191	LIB	1763	0.028187951	0.001406376	0.054969526
+Mbd2.1823	Mbd2	17191	LIB	1823	0.414679837	0.282276488	0.547083186
+Mbd3.579	Mbd3	17192	LIB	579	0.039006515	0.011331445	0.066681584
+Mbd3.1147	Mbd3	17192	LIB	1147	0.132003104	0.132045515	0.131960693
+Mbd3.1354	Mbd3	17192	LIB	1354	0.036617996	0.036774807	0.036461185
+Mbd3.1452	Mbd3	17192	LIB	1452	0.87003635	1.544545602	0.195527097
+Mbd3.1551	Mbd3	17192	LIB	1551	0.141265139	0.281803323	0.000726956
+Mbd4.434	Mbd4	17193	LIB	434	0.717498316	0.023598072	1.411398561
+Mbd4.1027	Mbd4	17193	LIB	1027	0.150955677	0.221333433	0.080577921
+Mbd4.3297	Mbd4	17193	LIB	3297	0.653742815	0.838148831	0.469336798
+Mbd4.3541	Mbd4	17193	LIB	3541	0.419652469	0.667150846	0.172154092
+Mds1.87	Mds1	17251	LIB	87	0.048096175	0.003971464	0.092220886
+Mds1.651	Mds1	17251	LIB	651	0.319940409	0.13257804	0.507302777
+Mds1.764	Mds1	17251	LIB	764	0.033157893	0.001919102	0.064396684
+Mds1.874	Mds1	17251	LIB	874	0.793188133	1.077433351	0.508942915
+Mecp2.1627	Mecp2	17257	LIB	1627	0.158179087	0.277250113	0.039108062
+Mecp2.2287	Mecp2	17257	LIB	2287	0.784008604	0.547153313	1.020863896
+Mecp2.5438	Mecp2	17257	LIB	5438	0.36095926	0.389780357	0.332138162
+Mecp2.7745	Mecp2	17257	LIB	7745	0.037865771	0.010600201	0.065131342
+Men1.219	Men1	17283	LIB	219	0.122260163	0.184664749	0.059855578
+Men1.228	Men1	17283	LIB	228	0	0	0
+Men1.1457	Men1	17283	LIB	1457	0.029537974	0.059075949	0
+Men1.2310	Men1	17283	LIB	2310	0	0	0
+Men1.2707	Men1	17283	LIB	2707	0.081531892	0	0.163063784
+Mettl8.846	Mettl8	228019	LIB	846	1.673269703	2.111991617	1.234547788
+Mettl8.1184	Mettl8	228019	LIB	1184	0.530893217	0.727875059	0.333911375
+Mettl8.1353	Mettl8	228019	LIB	1353	0.232238461	0.281751288	0.182725634
+Mettl8.1914	Mettl8	228019	LIB	1914	0.286619482	0.004971898	0.568267067
+Mettl8.1990	Mettl8	228019	LIB	1990	0.061709694	0.006313275	0.117106114
+Mgmt.384	Mgmt	17314	LIB	384	0.090639202	0.001580492	0.179697912
+Mgmt.412	Mgmt	17314	LIB	412	5.939776926	4.372746171	7.506807681
+Mgmt.433	Mgmt	17314	LIB	433	0.561261701	0.568160783	0.554362619
+Mgmt.672	Mgmt	17314	LIB	672	0.019081112	0.035102041	0.003060184
+Mgmt.730	Mgmt	17314	LIB	730	0.209668367	0.252318376	0.167018358
+Mll1.4195	Mll1	214162	LIB	4195	0.205418371	0.28092254	0.129914202
+Mll1.11050	Mll1	214162	LIB	11050	0.091881752	0.041176728	0.142586776
+Mll1.13303	Mll1	214162	LIB	13303	NA	NA	NA
+Mll1.16168	Mll1	214162	LIB	16168	0.101967298	0.1481428	0.055791796
+Mll2.4285	Mll2	381022	LIB	4285	2.378116941	2.670245399	2.085988484
+Mll2.5430	Mll2	381022	LIB	5430	0.42815757	0.457258743	0.399056397
+Mll2.6153	Mll2	381022	LIB	6153	4.914842828	4.14081359	5.688872067
+Mll2.11374	Mll2	381022	LIB	11374	15.43389955	22.53070605	8.337093044
+Mll2.12943	Mll2	381022	LIB	12943	7.90198211	4.957801222	10.846163
+Mll3.1099	Mll3	231051	LIB	1099	2.088422368	3.689806678	0.487038058
+Mll3.2993	Mll3	231051	LIB	2993	0.681144071	0.610359065	0.751929076
+Mll3.5304	Mll3	231051	LIB	5304	0	0	0
+Mll3.6232	Mll3	231051	LIB	6232	1.804491278	2.920727522	0.688255034
+Mll3.15396	Mll3	231051	LIB	15396	5.053664383	7.673024929	2.434303837
+Morf4l1.281	Morf4l1	21761	LIB	281	0.139995763	0.248305961	0.031685564
+Morf4l1.603	Morf4l1	21761	LIB	603	0.031392948	0.042246873	0.020539024
+Morf4l1.639	Morf4l1	21761	LIB	639	0.11593131	0.140696498	0.091166122
+Morf4l1.1034	Morf4l1	21761	LIB	1034	0.008070115	0.005876667	0.010263563
+Morf4l1.1245	Morf4l1	21761	LIB	1245	0.355326987	0.511142363	0.199511612
+Mta1.213	Mta1	116870	LIB	213	0	0	0
+Mta1.1003	Mta1	116870	LIB	1003	0.371959696	0.15191828	0.592001111
+Mta1.1053	Mta1	116870	LIB	1053	0.101226426	0.097185681	0.10526717
+Mta1.1147	Mta1	116870	LIB	1147	0.884542293	0.609151329	1.159933256
+Mta1.1363	Mta1	116870	LIB	1363	NA	NA	NA
+Mta2.511	Mta2	23942	LIB	511	0.027716689	0.003469469	0.05196391
+Mta2.924	Mta2	23942	LIB	924	0.015603346	0.021342134	0.009864558
+Mta2.1284	Mta2	23942	LIB	1284	0.263205121	0.432928311	0.093481932
+Mta2.2013	Mta2	23942	LIB	2013	NA	NA	NA
+Mta3.222	Mta3	116871	LIB	222	0	0	0
+Mta3.553	Mta3	116871	LIB	553	0.065665497	0.003378664	0.127952329
+Mta3.1523	Mta3	116871	LIB	1523	0.610472449	0.857285113	0.363659784
+Mta3.1663	Mta3	116871	LIB	1663	0.067934747	0.118514248	0.017355245
+Myst1.643	Myst1	67773	LIB	643	0	0	0
+Myst1.724	Myst1	67773	LIB	724	0.379083512	0.089139878	0.669027146
+Myst1.1250	Myst1	67773	LIB	1250	0	0	0
+Myst1.1302	Myst1	67773	LIB	1302	0.125921699	0.044815645	0.207027753
+Myst2.176	Myst2	217127	LIB	176	0.973337724	1.441661409	0.505014039
+Myst2.507	Myst2	217127	LIB	507	2.531753597	2.010045335	3.053461859
+Myst2.1183	Myst2	217127	LIB	1183	0.93839873	1.308311364	0.568486097
+Myst2.3099	Myst2	217127	LIB	3099	0.192553734	0.281569343	0.103538124
+Myst3.2590	Myst3	244349	LIB	2590	0	0	0
+Myst3.3127	Myst3	244349	LIB	3127	0	0	0
+Myst3.3485	Myst3	244349	LIB	3485	0.006118881	0.012237762	0
+Myst3.4554	Myst3	244349	LIB	4554	0.999844656	0.815379706	1.184309605
+Myst3.6844	Myst3	244349	LIB	6844	0.756310595	0.374601925	1.138019266
+Myst4.3568	Myst4	54169	LIB	3568	0.170742331	0.244378552	0.097106109
+Myst4.5452	Myst4	54169	LIB	5452	1.060119091	1.491440019	0.628798162
+Myst4.6527	Myst4	54169	LIB	6527	0.17356428	0.192047589	0.15508097
+Myst4.6644	Myst4	54169	LIB	6644	2.400441106	2.029316862	2.771565351
+Nap1l1.2360	Nap1l1	53605	LIB	2360	0.319133892	0.437873007	0.200394778
+Nap1l1.2470	Nap1l1	53605	LIB	2470	2.672057204	0.893748358	4.45036605
+Nap1l1.3414	Nap1l1	53605	LIB	3414	0.391905722	0.627474398	0.156337047
+Nap1l1.3554	Nap1l1	53605	LIB	3554	0.112275278	0.113553114	0.110997442
+Nap1l2.819	Nap1l2	17954	LIB	819	2.125995207	0.800219962	3.451770452
+Nap1l2.1093	Nap1l2	17954	LIB	1093	0.088819529	0.018720495	0.158918562
+Nap1l2.1180	Nap1l2	17954	LIB	1180	6.48E-05	0.000129517	0
+Nap1l2.1695	Nap1l2	17954	LIB	1695	0.088807945	0.029942389	0.147673502
+Nap1l2.1750	Nap1l2	17954	LIB	1750	0.099698624	0.171510367	0.027886881
+Nap1l3.743	Nap1l3	54561	LIB	743	2.253593603	3.057823725	1.449363481
+Nap1l3.779	Nap1l3	54561	LIB	779	30.3934439	42.83344355	17.95344425
+Nap1l3.1969	Nap1l3	54561	LIB	1969	0.056225371	0.040622407	0.071828335
+Nap1l3.2063	Nap1l3	54561	LIB	2063	0.055599264	0.110335466	0.000863061
+Nap1l3.2498	Nap1l3	54561	LIB	2498	0.006560346	0.00966944	0.003451251
+Ncoa3.1032	Ncoa3	17979	LIB	1032	0.541947489	0.372010693	0.711884285
+Ncoa3.3669	Ncoa3	17979	LIB	3669	0.686557747	0.328572238	1.044543256
+Ncoa3.3815	Ncoa3	17979	LIB	3815	0.059493377	0	0.118986753
+Ncoa3.3885	Ncoa3	17979	LIB	3885	0.036495879	0.000121183	0.072870575
+Ncoa3.7494	Ncoa3	17979	LIB	7494	0.119249564	0.004346476	0.234152652
+Nr0b2.381	Nr0b2	23957	LIB	381	0.040594882	0.000521558	0.080668205
+Nr0b2.534	Nr0b2	23957	LIB	534	0.29750152	0.120015301	0.474987739
+Nr0b2.558	Nr0b2	23957	LIB	558	0.120666479	0.118932039	0.122400919
+Nr0b2.1023	Nr0b2	23957	LIB	1023	0.745556882	1.138253809	0.352859956
+Nr0b2.1068	Nr0b2	23957	LIB	1068	1.157353909	1.693199276	0.621508541
+Nsd1.2795	Nsd1	18193	LIB	2795	NA	NA	NA
+Nsd1.5598	Nsd1	18193	LIB	5598	0.586999136	0.521905831	0.652092442
+Nsd1.5640	Nsd1	18193	LIB	5640	0.006176289	0.000922834	0.011429745
+Nsd1.11634	Nsd1	18193	LIB	11634	0.35901654	0.04608508	0.671947999
+Padi4.295	Padi4	18602	LIB	295	0.140719956	0.258960573	0.022479339
+Padi4.1042	Padi4	18602	LIB	1042	0.902821311	0.530879713	1.274762908
+Padi4.1058	Padi4	18602	LIB	1058	0.458948236	0.358981494	0.558914978
+Padi4.1914	Padi4	18602	LIB	1914	0.242089806	0.484052223	0.000127389
+Padi4.2336	Padi4	18602	LIB	2336	0.062117231	0.059119919	0.065114542
+Parp1.1124	Parp1	11545	LIB	1124	0.210888138	0.367549038	0.054227238
+Parp1.1623	Parp1	11545	LIB	1623	0.104470818	0.188126755	0.02081488
+Parp1.2887	Parp1	11545	LIB	2887	0.892550544	0.316455696	1.468645392
+Parp1.3789	Parp1	11545	LIB	3789	0.015223099	0.029524865	0.000921332
+Parp1.3790	Parp1	11545	LIB	3790	0.362609031	0.342329793	0.382888269
+Parp2.574	Parp2	11546	LIB	574	0.006105603	0.012211205	0
+Parp2.905	Parp2	11546	LIB	905	0.247891643	0.495783286	0
+Parp2.946	Parp2	11546	LIB	946	0.053243848	0.106487696	0
+Parp2.1006	Parp2	11546	LIB	1006	1.662743561	1.577856302	1.74763082
+Parp2.1429	Parp2	11546	LIB	1429	0.168234787	0.308182513	0.028287061
+Parp2.1677	Parp2	11546	LIB	1677	0.030777532	0.017032993	0.04452207
+Pax5.154	Pax5	18507	LIB	154	0.16139052	0.235338822	0.087442219
+Pax5.328	Pax5	18507	LIB	328	0.39397106	0.498357756	0.289584364
+Pax5.601	Pax5	18507	LIB	601	0.048479251	0.024589675	0.072368828
+Pax5.852	Pax5	18507	LIB	852	9.678858441	7.766500178	11.5912167
+Pax5.914	Pax5	18507	LIB	914	0.152719984	0.030076142	0.275363825
+Paxip1.3203	Paxip1	55982	LIB	3203	0.187420804	0.303786616	0.071054993
+Paxip1.3451	Paxip1	55982	LIB	3451	3.865093664	3.578045861	4.152141468
+Paxip1.3562	Paxip1	55982	LIB	3562	0.722329293	0.613098514	0.831560072
+Paxip1.3670	Paxip1	55982	LIB	3670	5.124811105	9.197264873	1.052357337
+Pcgf2.507	Pcgf2	22658	LIB	507	0.35115	0.32717803	0.375121969
+Pcgf2.690	Pcgf2	22658	LIB	690	0.084288102	0.160556564	0.00801964
+Pcgf2.801	Pcgf2	22658	LIB	801	0.09993849	0.068596738	0.131280242
+Pcgf2.982	Pcgf2	22658	LIB	982	0.444925531	0.384459989	0.505391072
+Pcgf2.1013	Pcgf2	22658	LIB	1013	0.090092787	5.67E-05	0.180128878
+Pcmt1.619	Pcmt1	18537	LIB	619	1.638746981	2.371052632	0.90644133
+Pcmt1.620	Pcmt1	18537	LIB	620	0.066119686	0.000258465	0.131980907
+Pcmt1.840	Pcmt1	18537	LIB	840	27.42358533	24.71543731	30.13173335
+Pcmt1.946	Pcmt1	18537	LIB	946	0.678912333	0.407078398	0.950746269
+Pcmt1.1259	Pcmt1	18537	LIB	1259	0.610136449	0.807828401	0.412444497
+Pcna.566	Pcna	18538	PC	566	0.013756331	0.021430795	0.006081866
+Pcna.1186	Pcna	18538	PC	1186	0	0	0
+Phf1.561	Phf1	21652	LIB	561	0.571926578	1.105404769	0.038448387
+Phf1.637	Phf1	21652	LIB	637	0.33142531	0.459700889	0.203149731
+Phf1.1098	Phf1	21652	LIB	1098	0.118527608	0.184246062	0.052809154
+Phf1.2400	Phf1	21652	LIB	2400	0.178047503	0.204710012	0.151384993
+Phf2.1851	Phf2	18676	LIB	1851	0.281793921	0.46524031	0.098347533
+Phf2.3668	Phf2	18676	LIB	3668	0.352946923	0.001776199	0.704117647
+Phf2.5132	Phf2	18676	LIB	5132	1.021354121	0.675807289	1.366900952
+Phf2.5166	Phf2	18676	LIB	5166	1.690348646	0.566009654	2.814687638
+Phf8.1420	Phf8	320595	LIB	1420	0.539886389	0.513086274	0.566686504
+Phf8.1984	Phf8	320595	LIB	1984	0.090594691	0.06110417	0.120085213
+Phf8.2131	Phf8	320595	LIB	2131	0.020983494	0.041486603	0.000480384
+Polr2b.489	Polr2b	231329	PC	489	0	0	0
+Polr2b.2176	Polr2b	231329	PC	2176	3.53E-05	7.06E-05	0
+Ppargc1a.669	Ppargc1a	19017	LIB	669	0.538610763	0.908737392	0.168484134
+Ppargc1a.831	Ppargc1a	19017	LIB	831	NA	NA	NA
+Ppargc1a.1269	Ppargc1a	19017	LIB	1269	0.408904844	0.436043305	0.381766382
+Ppargc1a.1500	Ppargc1a	19017	LIB	1500	0.229797051	0.203566341	0.256027762
+Prdm1.711	Prdm1	12142	LIB	711	0.050370956	0.017908875	0.082833036
+Prdm1.862	Prdm1	12142	LIB	862	0.127106083	0.093023256	0.161188911
+Prdm1.919	Prdm1	12142	LIB	919	0.064288331	0.02643779	0.102138872
+Prdm1.2964	Prdm1	12142	LIB	2964	0.090658195	0.169964956	0.011351434
+Prdm1.3709	Prdm1	12142	LIB	3709	0.964704579	0.430668605	1.498740554
+Prdm10.318	Prdm10	382066	LIB	318	0.06919639	0.042373324	0.096019455
+Prdm10.1130	Prdm10	382066	LIB	1130	0.161461455	0.167124645	0.155798265
+Prdm10.1348	Prdm10	382066	LIB	1348	0.121409823	0.178588808	0.064230838
+Prdm10.2613	Prdm10	382066	LIB	2613	0.275005354	0.550010709	0
+Prdm11.1844	Prdm11	100042784	LIB	1844	0.049836641	0.003384095	0.096289187
+Prdm11.2306	Prdm11	100042784	LIB	2306	0.106674086	0.187523208	0.025824964
+Prdm11.3215	Prdm11	100042784	LIB	3215	0.248260853	0.357676324	0.138845382
+Prdm11.3216	Prdm11	100042784	LIB	3216	0.162689304	0.102281495	0.223097113
+Prdm12.481	Prdm12	381359	LIB	481	0.121026312	9.03E-05	0.241962372
+Prdm12.603	Prdm12	381359	LIB	603	0.11654652	0.146549398	0.086543642
+Prdm12.1421	Prdm12	381359	LIB	1421	0.036882594	0.001164353	0.072600834
+Prdm12.2351	Prdm12	381359	LIB	2351	0.862186131	0.987938749	0.736433513
+Prdm13.554	Prdm13	230025	LIB	554	0.060698903	0.02212727	0.099270536
+Prdm13.2613	Prdm13	230025	LIB	2613	5.270386453	3.099350703	7.441422202
+Prdm13.2702	Prdm13	230025	LIB	2702	0.521784232	0	1.043568465
+Prdm13.2828	Prdm13	230025	LIB	2828	0.075151234	0.112102387	0.038200081
+Prdm13.2936	Prdm13	230025	LIB	2936	0.269317079	0.20276676	0.335867398
+Prdm14.530	Prdm14	383491	LIB	530	0.405412499	0.39411959	0.416705408
+Prdm14.1756	Prdm14	383491	LIB	1756	0.005945122	0	0.011890244
+Prdm14.1934	Prdm14	383491	LIB	1934	0.293485392	0.527073733	0.059897052
+Prdm14.2271	Prdm14	383491	LIB	2271	0.111037316	0.097569355	0.124505277
+Prdm14.2348	Prdm14	383491	LIB	2348	0.492448295	0.042176871	0.94271972
+Prdm15.958	Prdm15	114604	LIB	958	0.98252896	1.932489451	0.032568468
+Prdm15.1034	Prdm15	114604	LIB	1034	0.004062756	0.003733333	0.004392179
+Prdm15.1690	Prdm15	114604	LIB	1690	0.524906994	0.429446747	0.620367241
+Prdm15.1796	Prdm15	114604	LIB	1796	0.174355348	0.183572542	0.165138154
+Prdm15.2734	Prdm15	114604	LIB	2734	0.038957255	0.003943577	0.073970934
+Prdm16.680	Prdm16	70673	LIB	680	0.533914395	0.660762545	0.407066246
+Prdm16.5683	Prdm16	70673	LIB	5683	0.096716361	0.180946552	0.01248617
+Prdm16.8212	Prdm16	70673	LIB	8212	NA	NA	NA
+Prdm16.8363	Prdm16	70673	LIB	8363	0.430720448	0.248793956	0.61264694
+Prdm16.8571	Prdm16	70673	LIB	8571	2.329170058	2.550566982	2.107773134
+Prdm2.1020	Prdm2	110593	LIB	1020	0.153596644	0.259297344	0.047895945
+Prdm2.4191	Prdm2	110593	LIB	4191	0.559676498	0.502441293	0.616911704
+Prdm2.4655	Prdm2	110593	LIB	4655	NA	NA	NA
+Prdm2.4956	Prdm2	110593	LIB	4956	0.090352843	0.160106435	0.020599251
+Prdm2.5781	Prdm2	110593	LIB	5781	0.2845147	0.353298153	0.215731247
+Prdm4.1943	Prdm4	72843	LIB	1943	0.115287664	0.047414054	0.183161274
+Prdm4.2535	Prdm4	72843	LIB	2535	0.085408022	0.000193199	0.170622844
+Prdm4.3139	Prdm4	72843	LIB	3139	0.001128668	0	0.002257336
+Prdm4.3391	Prdm4	72843	LIB	3391	0.069371374	0.05967095	0.079071797
+Prdm4.3667	Prdm4	72843	LIB	3667	NA	NA	NA
+Prdm5.908	Prdm5	70779	LIB	908	0.149313429	0.128342246	0.170284612
+Prdm5.984	Prdm5	70779	LIB	984	0.413409055	0.622305737	0.204512373
+Prdm5.1353	Prdm5	70779	LIB	1353	1.643969827	2.094062103	1.193877551
+Prdm5.2148	Prdm5	70779	LIB	2148	0.648213784	0.715798492	0.580629076
+Prdm6.1018	Prdm6	225518	LIB	1018	0.009633756	0.011159403	0.008108108
+Prdm6.1790	Prdm6	225518	LIB	1790	0.123211194	0.098809823	0.147612565
+Prdm6.1823	Prdm6	225518	LIB	1823	0.328175562	0.377128018	0.279223106
+Prdm6.1839	Prdm6	225518	LIB	1839	0.201249487	0.337440758	0.065058216
+Prdm8.2290	Prdm8	77630	LIB	2290	0.000542104	0.00048216	0.000602047
+Prdm8.3042	Prdm8	77630	LIB	3042	3.233747051	5.976620158	0.490873944
+Prdm8.3048	Prdm8	77630	LIB	3048	0.640755782	1.166720727	0.114790837
+Prdm8.3062	Prdm8	77630	LIB	3062	0.361793005	0.256726293	0.466859717
+Prdm9.77	Prdm9	213389	LIB	77	0.401141561	0.283516221	0.518766901
+Prdm9.496	Prdm9	213389	LIB	496	0.222497616	0.078468537	0.366526695
+Prdm9.1838	Prdm9	213389	LIB	1838	0.302877526	0.400302009	0.205453043
+Prkaa1.145	Prkaa1	105787	LIB	145	0.14165733	0.1690104	0.114304261
+Prkaa1.1981	Prkaa1	105787	LIB	1981	0.019533353	0.019407151	0.019659554
+Prkaa1.3080	Prkaa1	105787	LIB	3080	NA	NA	NA
+Prkaa1.3635	Prkaa1	105787	LIB	3635	3.189719542	4.278249106	2.101189977
+Prkaa1.3954	Prkaa1	105787	LIB	3954	0.013169577	0	0.026339154
+Prkaa1.4596	Prkaa1	105787	LIB	4596	0.034088344	0.058964593	0.009212095
+Prkaa2.2299	Prkaa2	108079	LIB	2299	0.004331754	0.000484027	0.008179481
+Prkaa2.2748	Prkaa2	108079	LIB	2748	0.340786503	0.362280234	0.319292772
+Prkaa2.4825	Prkaa2	108079	LIB	4825	NA	NA	NA
+Prkaa2.6172	Prkaa2	108079	LIB	6172	0.020265668	0	0.040531335
+Prkaa2.6849	Prkaa2	108079	LIB	6849	0.135065674	0.072316173	0.197815176
+Prkcd.161	Prkcd	18753	LIB	161	0.179448269	0.099882029	0.259014509
+Prkcd.441	Prkcd	18753	LIB	441	0.327507015	0.001459854	0.653554175
+Prkcd.707	Prkcd	18753	LIB	707	0.664294206	1.071999112	0.2565893
+Prkcd.1389	Prkcd	18753	LIB	1389	1.255652224	0.641311475	1.869992973
+Prmt1.243	Prmt1	15469	LIB	243	0.110664823	0.120254845	0.101074802
+Prmt1.264	Prmt1	15469	LIB	264	0.272777523	0.382384883	0.163170163
+Prmt1.630	Prmt1	15469	LIB	630	1.328852347	1.764027294	0.8936774
+Prmt1.1014	Prmt1	15469	LIB	1014	0.484140888	0.638219895	0.330061882
+Prmt2.151	Prmt2	15468	LIB	151	0.031631618	0.037750897	0.025512338
+Prmt2.154	Prmt2	15468	LIB	154	0.973162231	1.211030345	0.735294118
+Prmt2.1066	Prmt2	15468	LIB	1066	9.18E-05	0.000183688	0
+Prmt2.1067	Prmt2	15468	LIB	1067	0.815640774	0.654386731	0.976894818
+Prmt3.502	Prmt3	71974	LIB	502	0.157500935	0.315001871	0
+Prmt3.814	Prmt3	71974	LIB	814	4.89E-05	0	9.79E-05
+Prmt3.838	Prmt3	71974	LIB	838	3.559311442	4.211350585	2.907272299
+Prmt3.985	Prmt3	71974	LIB	985	0.274535697	0.423260006	0.125811388
+Prmt3.1839	Prmt3	71974	LIB	1839	0.113816928	0.148898678	0.078735178
+Prmt5.56	Prmt5	27374	LIB	56	0.778904793	0.453405018	1.104404568
+Prmt5.266	Prmt5	27374	LIB	266	0.201764199	0.173979378	0.22954902
+Prmt5.2152	Prmt5	27374	LIB	2152	0.126875652	0.076575692	0.177175612
+Prmt5.2293	Prmt5	27374	LIB	2293	2.188455879	0.469499821	3.907411937
+Prmt6.247	Prmt6	99890	LIB	247	0.033732942	0.000853242	0.066612642
+Prmt6.1493	Prmt6	99890	LIB	1493	0.134310673	0.232186732	0.036434613
+Prmt6.1983	Prmt6	99890	LIB	1983	0.154846836	0.167501928	0.142191745
+Prmt6.2355	Prmt6	99890	LIB	2355	0.50072786	0.541981695	0.459474025
+Prmt7.23	Prmt7	214572	LIB	23	0.009433344	0.004819277	0.01404741
+Prmt7.45	Prmt7	214572	LIB	45	0.543933929	0.518786922	0.569080936
+Prmt7.88	Prmt7	214572	LIB	88	0.080612502	0.04869904	0.112525964
+Prmt7.1284	Prmt7	214572	LIB	1284	0.06501016	0.126209284	0.003811036
+Prmt7.2135	Prmt7	214572	LIB	2135	0.23497578	0.386599091	0.083352468
+Prmt8.302	Prmt8	381813	LIB	302	0.244600451	0.198269736	0.290931167
+Prmt8.455	Prmt8	381813	LIB	455	0.59669119	0.802821189	0.390561191
+Prmt8.667	Prmt8	381813	LIB	667	0.045662786	0.087305569	0.004020002
+Prmt8.1854	Prmt8	381813	LIB	1854	0.108178455	0.06973876	0.146618151
+Psip1.763	Psip1	101739	LIB	763	0.008304892	0	0.016609784
+Psip1.1311	Psip1	101739	LIB	1311	0	0	0
+Psip1.1596	Psip1	101739	LIB	1596	0.059717843	0.087169563	0.032266123
+Psip1.2474	Psip1	101739	LIB	2474	0.006237689	0.012475378	0
+Psip1.2652	Psip1	101739	LIB	2652	0.06194056	0.10699453	0.016886591
+Rbbp4.2088	Rbbp4	19646	LIB	2088	0.193789327	0.126048165	0.261530489
+Rbbp4.2174	Rbbp4	19646	LIB	2174	0.005813953	0	0.011627907
+Rbbp4.2511	Rbbp4	19646	LIB	2511	0.928220759	1.004589667	0.851851852
+Rbbp4.3753	Rbbp4	19646	LIB	3753	0.073360623	0.135745027	0.010976218
+Rbbp5.1634	Rbbp5	213464	LIB	1634	1.015990856	1.156510409	0.875471303
+Rbbp5.2248	Rbbp5	213464	LIB	2248	0.000789875	0.00145743	0.00012232
+Rbbp5.2655	Rbbp5	213464	LIB	2655	0.121958567	0.170557717	0.073359417
+Rbbp5.2974	Rbbp5	213464	LIB	2974	1.399302063	1.445902998	1.352701127
+Renilla.713	Renilla	Luciferase	NC	713	1.666788004	1.533762916	1.799813091
+Ring1.260	Ring1	19763	LIB	260	0.286061741	0.026611473	0.54551201
+Ring1.669	Ring1	19763	LIB	669	0.165118469	0.170742026	0.159494912
+Ring1.1034	Ring1	19763	LIB	1034	0.180669238	0.016304348	0.345034127
+Rnf2.1856	Rnf2	19821	LIB	1856	0.673388184	0.833867094	0.512909274
+Rnf2.2203	Rnf2	19821	LIB	2203	0.954595303	0.850564925	1.05862568
+Rnf2.2538	Rnf2	19821	LIB	2538	0.837959761	0.541602515	1.134317006
+Rnf2.2809	Rnf2	19821	LIB	2809	0.187347204	0.081992104	0.292702304
+Rnf2.2875	Rnf2	19821	LIB	2875	0.546987675	0.692397599	0.401577752
+Rnf20.420	Rnf20	109331	LIB	420	0.063920224	0.054351697	0.073488751
+Rnf20.948	Rnf20	109331	LIB	948	0.278768206	0.423430663	0.134105749
+Rnf20.1295	Rnf20	109331	LIB	1295	0.000109004	0	0.000218007
+Rnf20.3244	Rnf20	109331	LIB	3244	NA	NA	NA
+Rnf20.3277	Rnf20	109331	LIB	3277	0.459938908	0.803347787	0.11653003
+Rnf20.3718	Rnf20	109331	LIB	3718	1.136821022	1.414336918	0.859305126
+Rpa1.1620	Rpa1	68275	PC	1620	0.007210873	0.000351973	0.014069774
+Rpa3.276	Rpa3	68240	PC	278	7.32E-05	0.000111564	3.48E-05
+Rpa3.455	Rpa3	68240	PC	457	0.018174308	0.02069689	0.015651726
+Rpa3.561	Rpa3	68240	PC	561	0.00476048	0.002574918	0.006946042
+Satb1.710	Satb1	20230	LIB	710	0.161960667	0.323389702	0.000531632
+Satb1.1401	Satb1	20230	LIB	1401	0.392569667	0.3563288	0.428810533
+Satb1.1478	Satb1	20230	LIB	1478	0.24003152	0.473695747	0.006367292
+Satb1.1709	Satb1	20230	LIB	1709	0.193635318	0.075057818	0.312212817
+Satb1.2566	Satb1	20230	LIB	2566	0.193845463	0.035309973	0.352380952
+Setd1a.119	Setd1a	233904	LIB	119	0.107452217	0.170620438	0.044283995
+Setd1a.388	Setd1a	233904	LIB	388	0.608381477	0.653331355	0.5634316
+Setd1a.643	Setd1a	233904	LIB	643	1.521441453	1.691804708	1.351078197
+Setd1a.5859	Setd1a	233904	LIB	5859	0.797831182	0.900645478	0.695016886
+Setd1b.3553	Setd1b	208043	LIB	3553	8.23E-05	0	0.0001646
+Setd1b.3557	Setd1b	208043	LIB	3557	0.18069148	0.180119102	0.181263858
+Setd1b.4520	Setd1b	208043	LIB	4520	0.199934074	0.05129672	0.348571429
+Setd1b.4522	Setd1b	208043	LIB	4522	0.003342509	0	0.006685018
+Setd1b.4699	Setd1b	208043	LIB	4699	0.137405083	0.097939189	0.176870978
+Setd2.182	Setd2	235626	LIB	182	0.040179039	0.047492416	0.032865662
+Setd2.1467	Setd2	235626	LIB	1467	0.00017313	0	0.00034626
+Setd2.1785	Setd2	235626	LIB	1785	0.038294803	0.027488932	0.049100673
+Setd2.3632	Setd2	235626	LIB	3632	0.377349359	0.44562685	0.309071868
+Setd2.4051	Setd2	235626	LIB	4051	0	0	0
+Setd3.795	Setd3	52690	LIB	795	0.126767545	0.027322404	0.226212687
+Setd3.1496	Setd3	52690	LIB	1496	NA	NA	NA
+Setd3.2395	Setd3	52690	LIB	2395	0.012222377	0	0.024444755
+Setd4.506	Setd4	224440	LIB	506	0.001721296	0.001794728	0.001647864
+Setd4.1308	Setd4	224440	LIB	1308	2.55E-05	5.10E-05	0
+Setd4.1517	Setd4	224440	LIB	1517	0	0	0
+Setd7.4328	Setd7	73251	LIB	4328	0.79628381	1.371309831	0.22125779
+Setd7.5317	Setd7	73251	LIB	5317	0.441117913	0.586184524	0.296051303
+Setd7.5342	Setd7	73251	LIB	5342	0.143929674	0.043706114	0.244153234
+Setd7.5940	Setd7	73251	LIB	5940	NA	NA	NA
+Setd7.7009	Setd7	73251	LIB	7009	0.066151971	0.049381188	0.082922753
+Setd8.2578	Setd8	67956	LIB	2578	0.189731658	0.000972526	0.37849079
+Setd8.2622	Setd8	67956	LIB	2622	0.411566348	0.623313229	0.199819467
+Setd8.2632	Setd8	67956	LIB	2632	1.643161397	2.493088617	0.793234176
+Setdb1.1145	Setdb1	84505	LIB	1145	0.517510269	0.470614035	0.564406503
+Setdb1.1925	Setdb1	84505	LIB	1925	0.086579742	0	0.173159485
+Setdb1.2174	Setdb1	84505	LIB	2174	0.146093257	0.000108015	0.292078499
+Setdb1.3684	Setdb1	84505	LIB	3684	0.010401671	8.66E-05	0.02071677
+Setdb2.809	Setdb2	239122	LIB	809	1.391206827	2.779885057	0.002528597
+Setdb2.810	Setdb2	239122	LIB	810	1.190095337	0.963319847	1.416870827
+Setdb2.990	Setdb2	239122	LIB	990	0.079364105	0.021533706	0.137194504
+Setdb2.1417	Setdb2	239122	LIB	1417	0.34737866	0.393661661	0.30109566
+Setmar.1193	Setmar	74729	LIB	1193	0.292843192	0.358163209	0.227523174
+Setmar.1195	Setmar	74729	LIB	1195	0.162091025	0.135760257	0.188421792
+Setmar.1589	Setmar	74729	LIB	1589	64.11298219	52.14726514	76.07869924
+Sfmbt1.868	Sfmbt1	54650	LIB	868	1.013294698	1.206846418	0.819742977
+Sfmbt1.1345	Sfmbt1	54650	LIB	1345	0.008587566	0.010476801	0.006698332
+Sfmbt1.1802	Sfmbt1	54650	LIB	1802	1.004772904	0.72139738	1.288148429
+Sfmbt1.2018	Sfmbt1	54650	LIB	2018	0.26726547	0.475359343	0.059171598
+Sfmbt1.2421	Sfmbt1	54650	LIB	2421	0.075539295	0.001624805	0.149453785
+Sfmbt2.602	Sfmbt2	353282	LIB	602	0.281181984	0.520202721	0.042161246
+Sfmbt2.3592	Sfmbt2	353282	LIB	3592	0.082878502	0.005644644	0.16011236
+Sfmbt2.5673	Sfmbt2	353282	LIB	5673	0.134401376	0.019676674	0.249126078
+Sin3a.531	Sin3a	20466	LIB	531	0	0	0
+Sin3a.3537	Sin3a	20466	LIB	3537	0.024340683	0	0.048681366
+Sin3a.3559	Sin3a	20466	LIB	3559	1.728939777	2.831898734	0.62598082
+Sin3a.4729	Sin3a	20466	LIB	4729	0	0	0
+Sin3b.188	Sin3b	20467	LIB	188	0.042293799	0.084587598	0
+Sin3b.326	Sin3b	20467	LIB	326	1.438726271	2.275190706	0.602261836
+Sin3b.338	Sin3b	20467	LIB	338	0.105590062	0	0.211180124
+Sin3b.381	Sin3b	20467	LIB	381	0.134926536	0.248162305	0.021690768
+Sin3b.475	Sin3b	20467	LIB	475	0.639579924	1.118636662	0.160523187
+Sirt1.688	Sirt1	93759	LIB	688	1.451209242	1.979805805	0.922612678
+Sirt1.1708	Sirt1	93759	LIB	1708	0.631165203	0.733237638	0.529092768
+Sirt1.1779	Sirt1	93759	LIB	1779	0.436869096	0.336818563	0.536919629
+Sirt1.2191	Sirt1	93759	LIB	2191	1.729713563	2.528467711	0.930959415
+Sirt2.735	Sirt2	64383	LIB	735	0.147707432	0.003062938	0.292351926
+Sirt2.1418	Sirt2	64383	LIB	1418	0.131476192	0.093366665	0.169585719
+Sirt2.1460	Sirt2	64383	LIB	1460	0.276894538	0.290329505	0.26345957
+Sirt2.1600	Sirt2	64383	LIB	1600	0.023729675	0.026015228	0.021444122
+Sirt3.462	Sirt3	64384	LIB	462	0.43015768	0.70883566	0.1514797
+Sirt3.869	Sirt3	64384	LIB	869	0.087373128	0.032567568	0.142178688
+Sirt3.993	Sirt3	64384	LIB	993	1.118453529	1.035942224	1.200964834
+Sirt3.1002	Sirt3	64384	LIB	1002	0.316055067	0.208823529	0.423286604
+Sirt3.1236	Sirt3	64384	LIB	1236	0.23257166	0.248811512	0.216331808
+Sirt4.105	Sirt4	75387	LIB	105	0.787448713	0.84617509	0.728722336
+Sirt4.633	Sirt4	75387	LIB	633	0.413766331	0.018150999	0.809381663
+Sirt4.1490	Sirt4	75387	LIB	1490	0.271724181	0.467032967	0.076415394
+Sirt4.1806	Sirt4	75387	LIB	1806	0.211146978	0.364117918	0.058176038
+Sirt5.586	Sirt5	68346	LIB	586	0.04315097	0.061098763	0.025203178
+Sirt5.1032	Sirt5	68346	LIB	1032	NA	NA	NA
+Sirt5.1219	Sirt5	68346	LIB	1219	1.159282043	1.459821841	0.858742245
+Sirt5.1290	Sirt5	68346	LIB	1290	0.148949431	0.165555092	0.132343769
+Sirt6.83	Sirt6	50721	LIB	83	0.036022476	0.05303979	0.019005162
+Sirt6.421	Sirt6	50721	LIB	421	0.000122991	0	0.000245982
+Sirt6.937	Sirt6	50721	LIB	937	0.232027633	0.160600291	0.303454974
+Sirt6.1609	Sirt6	50721	LIB	1609	0.364602844	0.086260111	0.642945578
+Sirt7.841	Sirt7	209011	LIB	841	0	0	0
+Sirt7.844	Sirt7	209011	LIB	844	0.221531023	0.111507818	0.331554227
+Sirt7.1238	Sirt7	209011	LIB	1238	0.21552915	0.207286174	0.223772125
+Sirt7.1604	Sirt7	209011	LIB	1604	0.118405846	0.003893381	0.232918312
+Sirt7.1677	Sirt7	209011	LIB	1677	0.451595828	0.535251456	0.367940199
+Smarca1.1401	Smarca1	93761	LIB	1401	1.153548695	1.688711584	0.618385807
+Smarca1.1430	Smarca1	93761	LIB	1430	0.46036335	0.786028584	0.134698116
+Smarca1.1613	Smarca1	93761	LIB	1613	0.11066776	0.061904944	0.159430577
+Smarca1.1893	Smarca1	93761	LIB	1893	0.213806299	0.218937644	0.208674954
+Smarca1.3418	Smarca1	93761	LIB	3418	0.607874304	1.091527057	0.124221551
+Smarca2.263	Smarca2	67155	LIB	263	0.172543567	0.178539893	0.166547241
+Smarca2.274	Smarca2	67155	LIB	274	0	0	0
+Smarca2.712	Smarca2	67155	LIB	712	0.035563959	0.003878282	0.067249636
+Smarca2.1061	Smarca2	67155	LIB	1061	0.08050899	0.120002107	0.041015873
+Smarca4.3232	Smarca4	20586	LIB	3232	0	0	0
+Smarca4.3364	Smarca4	20586	LIB	3364	0.185891845	0	0.371783689
+Smarca4.3633	Smarca4	20586	LIB	3633	0.101871507	0.169502565	0.03424045
+Smarca4.4935	Smarca4	20586	LIB	4935	0.464028994	0.638482699	0.28957529
+Smarca4.5466	Smarca4	20586	LIB	5466	0	0	0
+Smarca5.1139	Smarca5	93762	LIB	1139	39.02044459	29.48150462	48.55938456
+Smarca5.1264	Smarca5	93762	LIB	1264	0.051361802	0.102723605	0
+Smarca5.3886	Smarca5	93762	LIB	3886	2.889445252	4.275900073	1.502990431
+Smarca5.4421	Smarca5	93762	LIB	4421	0.027038126	0.047147846	0.006928406
+Smarca5.4522	Smarca5	93762	LIB	4522	1.659875833	1.301821998	2.017929668
+Smarcc2.1398	Smarcc2	68094	LIB	1398	5.667513887	8.025575273	3.309452502
+Smarcc2.1941	Smarcc2	68094	LIB	1941	0.671956498	0.125396825	1.21851617
+Smarcc2.2235	Smarcc2	68094	LIB	2235	0.277627685	0.414749573	0.140505797
+Smarcc2.2541	Smarcc2	68094	LIB	2541	0.369172133	0.397641112	0.340703153
+Smarcd1.690	Smarcd1	83797	LIB	690	0.029841397	0.009797964	0.049884831
+Smarcd1.986	Smarcd1	83797	LIB	986	0.145361327	0.246381645	0.044341009
+Smarcd1.1738	Smarcd1	83797	LIB	1738	0.763237236	1.299479167	0.226995305
+Smarcd1.1858	Smarcd1	83797	LIB	1858	0.19664493	0.30078986	0.0925
+Smarcd3.518	Smarcd3	66993	LIB	518	0.109320414	0.188431483	0.030209345
+Smarcd3.847	Smarcd3	66993	LIB	847	0.27744907	0.176790744	0.378107396
+Smarcd3.1323	Smarcd3	66993	LIB	1323	0.345474467	0.457416001	0.233532934
+Smarcd3.1591	Smarcd3	66993	LIB	1591	0.117582645	0.231035335	0.004129956
+Smarcd3.1708	Smarcd3	66993	LIB	1708	0	0	0
+Smarce1.2096	Smarce1	57376	LIB	2096	0.225624714	0.208014266	0.243235162
+Smarce1.2121	Smarce1	57376	LIB	2121	5.976009675	3.943683037	8.008336314
+Smarce1.2154	Smarce1	57376	LIB	2154	0.166161562	0.03823709	0.294086035
+Smarce1.2337	Smarce1	57376	LIB	2337	0.574918385	0.45703001	0.692806761
+Smarce1.2593	Smarce1	57376	LIB	2593	0.101831674	0.067653641	0.136009708
+Smyd1.1302	Smyd1	12180	LIB	1302	0.113264066	0.14391266	0.082615473
+Smyd1.1635	Smyd1	12180	LIB	1635	0.847881262	0.759523917	0.936238607
+Smyd1.1658	Smyd1	12180	LIB	1658	0.487657271	0.079701835	0.895612708
+Smyd2.334	Smyd2	226830	LIB	334	0.333287943	0.426382841	0.240193045
+Smyd2.640	Smyd2	226830	LIB	640	0	0	0
+Smyd2.1421	Smyd2	226830	LIB	1421	0.033647219	0.007321641	0.059972796
+Smyd2.1476	Smyd2	226830	LIB	1476	0.133552973	0.166871585	0.100234361
+Smyd3.306	Smyd3	69726	LIB	306	0.984033005	1.765638646	0.202427363
+Smyd3.438	Smyd3	69726	LIB	438	0.268051697	0.342375668	0.193727726
+Smyd3.980	Smyd3	69726	LIB	980	6.230065777	7.131274131	5.328857422
+Smyd3.1506	Smyd3	69726	LIB	1506	0	0	0
+Smyd3.2607	Smyd3	69726	LIB	2607	0.407196317	0.531783938	0.282608696
+Smyd4.693	Smyd4	319822	LIB	693	0.034680679	0	0.069361358
+Smyd4.2959	Smyd4	319822	LIB	2959	0.124362265	0.177337952	0.071386579
+Smyd4.3333	Smyd4	319822	LIB	3333	0.281233349	0.168597717	0.393868982
+Smyd4.3414	Smyd4	319822	LIB	3414	0.036082039	0.064381611	0.007782466
+Smyd4.3439	Smyd4	319822	LIB	3439	0.102705754	0.118006231	0.087405278
+Smyd5.1548	Smyd5	232187	LIB	1548	0.555290132	1.105784101	0.004796163
+Smyd5.1643	Smyd5	232187	LIB	1643	0.201223576	0.237695287	0.164751865
+Smyd5.2044	Smyd5	232187	LIB	2044	0.100536441	0	0.201072882
+Smyd5.2048	Smyd5	232187	LIB	2048	4.496682919	5.749585661	3.243780178
+Srcap.2697	Srcap	100043597	LIB	2697	0.349388033	0	0.698776065
+Srcap.3130	Srcap	100043597	LIB	3130	0.212521996	0.244648899	0.180395093
+Srcap.5342	Srcap	100043597	LIB	5342	0.052050563	0.074190594	0.029910532
+Srcap.7360	Srcap	100043597	LIB	7360	0.000185048	0.000370096	0
+Srcap.11381	Srcap	100043597	LIB	11381	0.306910194	0.366298636	0.247521752
+Ssrp1.306	Ssrp1	20833	LIB	306	0.130932283	0	0.261864566
+Ssrp1.577	Ssrp1	20833	LIB	577	0	0	0
+Ssrp1.897	Ssrp1	20833	LIB	897	0	0	0
+Ssrp1.975	Ssrp1	20833	LIB	975	0.173798872	0	0.347597744
+Ssrp1.2237	Ssrp1	20833	LIB	2237	0.516140607	0.49304499	0.539236223
+Supt16h.1672	Supt16h	114741	LIB	1672	0	0	0
+Supt16h.2037	Supt16h	114741	LIB	2037	0	0	0
+Supt16h.2827	Supt16h	114741	LIB	2827	0.254409407	0	0.508818813
+Supt16h.2999	Supt16h	114741	LIB	2999	1.544048922	1.927461878	1.160635965
+Suv39h1.496	Suv39h1	20937	LIB	496	0.00769067	0.00522541	0.010155929
+Suv39h1.1016	Suv39h1	20937	LIB	1016	0.16138236	0.206581683	0.116183036
+Suv39h1.1202	Suv39h1	20937	LIB	1202	0.443170347	0.001824633	0.884516062
+Suv39h1.1471	Suv39h1	20937	LIB	1471	0.813201059	0.763236816	0.863165302
+Suv39h1.1827	Suv39h1	20937	LIB	1827	0.001449922	0	0.002899844
+Suv39h2.1395	Suv39h2	64707	LIB	1395	1.277126142	1.595355855	0.958896428
+Suv39h2.1871	Suv39h2	64707	LIB	1871	1.121534494	0.83378821	1.409280778
+Suv39h2.2981	Suv39h2	64707	LIB	2981	0.431886028	0.596321373	0.267450683
+Suv39h2.4184	Suv39h2	64707	LIB	4184	0.175666404	0.146602132	0.204730676
+Suv420h1.1112	Suv420h1	225888	LIB	1112	0.524975639	0.491653823	0.558297455
+Suv420h1.1327	Suv420h1	225888	LIB	1327	0.116790353	0	0.233580705
+Suv420h1.3263	Suv420h1	225888	LIB	3263	0.368685154	0.493047776	0.244322531
+Suv420h1.3357	Suv420h1	225888	LIB	3357	1.324294468	2.048844691	0.599744246
+Suv420h2.287	Suv420h2	232811	LIB	287	0.022964894	0.007424692	0.038505096
+Suv420h2.686	Suv420h2	232811	LIB	686	0.11526632	0.108108108	0.122424533
+Suv420h2.825	Suv420h2	232811	LIB	825	0.001755618	0	0.003511236
+Suz12.909	Suz12	52615	LIB	909	0.039791094	0.041071615	0.038510573
+Suz12.1676	Suz12	52615	LIB	1676	0.485871904	0.850335377	0.121408431
+Suz12.1842	Suz12	52615	LIB	1842	0	0	0
+Suz12.3979	Suz12	52615	LIB	3979	0.728677324	0.747851003	0.709503645
+Suz12.4300	Suz12	52615	LIB	4300	2.273232665	3.766706979	0.779758351
+Taf1.928	Taf1	270627	LIB	928	0.422721162	0.600757627	0.244684697
+Taf1.3994	Taf1	270627	LIB	3994	2.625498891	2.982654402	2.26834338
+Taf1.5030	Taf1	270627	LIB	5030	64.36949812	5.851261461	122.8877348
+Taf1.7786	Taf1	270627	LIB	7786	0.523945504	0.14720006	0.900690947
+Taf3.1009	Taf3	209361	LIB	1009	0.630071751	0.858078928	0.402064575
+Taf3.1315	Taf3	209361	LIB	1315	0.261363856	0.00010287	0.522624842
+Taf3.1769	Taf3	209361	LIB	1769	0.29960417	0.043652785	0.555555556
+Taf3.2951	Taf3	209361	LIB	2951	0	0	0
+Taf3.3182	Taf3	209361	LIB	3182	1.204653902	1.789020893	0.620286911
+Ube2a.142	Ube2a	22209	LIB	142	0	0	0
+Ube2a.786	Ube2a	22209	LIB	786	0.120099234	0.13903066	0.101167809
+Ube2a.1206	Ube2a	22209	LIB	1206	0.144990808	0.114695126	0.17528649
+Ube2a.1411	Ube2a	22209	LIB	1411	0.060153226	0.085591229	0.034715222
+Ube2b.776	Ube2b	22210	LIB	776	0.058058259	0.051273228	0.06484329
+Ube2b.1626	Ube2b	22210	LIB	1626	0.068188614	0.039514731	0.096862497
+Ube2b.1661	Ube2b	22210	LIB	1661	0.499759711	0.928847363	0.070672059
+Ube2b.2075	Ube2b	22210	LIB	2075	0.330222156	0.308341814	0.352102499
+Ube2b.2079	Ube2b	22210	LIB	2079	2.317079085	1.318543552	3.315614618
+Ube2e1.228	Ube2e1	22194	LIB	228	0.029381966	0.058763931	0
+Ube2e1.858	Ube2e1	22194	LIB	858	1.993776879	3.221631126	0.765922632
+Ube2e1.1041	Ube2e1	22194	LIB	1041	1.358310257	1.871372176	0.845248338
+Ube2e1.1126	Ube2e1	22194	LIB	1126	0.041122487	0.005949233	0.07629574
+Ube2e1.1207	Ube2e1	22194	LIB	1207	0.58531289	0.718171988	0.452453792
+Ube2e1.1357	Ube2e1	22194	LIB	1357	0.28858651	0.211572207	0.365600814
+Ube2i.40	Ube2i	22196	LIB	40	0.497636722	0.420658059	0.574615385
+Ube2i.2212	Ube2i	22196	LIB	2212	1.277510212	1.011704567	1.543315856
+Ube2i.2447	Ube2i	22196	LIB	2447	0.048358827	0.096717655	0
+Ube2i.2498	Ube2i	22196	LIB	2498	1.139381303	0.697955118	1.580807487
+Usp22.1429	Usp22	216825	LIB	1429	0.478996919	0.42942241	0.528571429
+Usp22.2382	Usp22	216825	LIB	2382	0.111911328	0.109925123	0.113897532
+Usp22.2760	Usp22	216825	LIB	2760	0.061983148	0.031042902	0.092923394
+Usp22.3603	Usp22	216825	LIB	3603	NA	NA	NA
+Usp27x.1408	Usp27x	54651	LIB	1408	0.122921318	0.012626263	0.233216374
+Usp27x.2829	Usp27x	54651	LIB	2829	0.254051618	0.175833833	0.332269403
+Usp27x.2922	Usp27x	54651	LIB	2922	0.319959074	0.472527473	0.167390675
+Usp27x.3592	Usp27x	54651	LIB	3592	0.29489203	0.052753713	0.537030347
+Usp27x.3593	Usp27x	54651	LIB	3593	17.22570286	0.2671952	34.18421053
+Usp51.737	Usp51	635253	LIB	737	0.908903305	0.390760346	1.427046263
+Usp51.1997	Usp51	635253	LIB	1997	0.310486428	0.43330104	0.187671816
+Usp51.2109	Usp51	635253	LIB	2109	0.164332887	0.186081505	0.14258427
+Usp51.2114	Usp51	635253	LIB	2114	0.038897596	0.009535553	0.06825964
+Usp51.2194	Usp51	635253	LIB	2194	0.931503481	0.196846112	1.66616085
+Utx.652	Utx	22289	LIB	652	4.641855236	4.328129783	4.95558069
+Utx.888	Utx	22289	LIB	888	1.075866425	1.751019313	0.400713536
+Utx.1445	Utx	22289	LIB	1445	1.5705291	1.884518877	1.256539322
+Utx.4317	Utx	22289	LIB	4317	1.736188537	3.037108334	0.43526874
+Utx.4510	Utx	22289	LIB	4510	2.286589128	3.113532021	1.459646236
+Wbp7.2972	Wbp7	75410	LIB	2972	1.513599735	2.458444271	0.568755198
+Wbp7.3029	Wbp7	75410	LIB	3029	0.035307517	0	0.070615034
+Wbp7.5587	Wbp7	75410	LIB	5587	0	0	0
+Wbp7.6965	Wbp7	75410	LIB	6965	0	0	0
+Wdr5.501	Wdr5	140858	LIB	501	2.408515669	4.387538327	0.429493011
+Wdr5.502	Wdr5	140858	LIB	502	0.042069153	0.061053985	0.023084322
+Wdr5.1321	Wdr5	140858	LIB	1321	0.247222355	0.260246645	0.234198065
+Wdr5.1765	Wdr5	140858	LIB	1765	0	0	0
+Wdr5.2837	Wdr5	140858	LIB	2837	0.077594328	0.146670387	0.008518269
+Wdr82.1889	Wdr82	77305	LIB	1889	18.17214402	17.05537669	19.28891135
+Wdr82.3590	Wdr82	77305	LIB	3590	0.540832199	0.657836623	0.423827774
+Wdr82.3705	Wdr82	77305	LIB	3705	0.175116794	0.093333854	0.256899734
+Wdr82.4023	Wdr82	77305	LIB	4023	0.723659143	1.142793941	0.304524346
+Whsc1.812	Whsc1	107823	LIB	812	0.904200829	1.579513299	0.228888359
+Whsc1.818	Whsc1	107823	LIB	818	0.470434488	0.340148963	0.600720013
+Whsc1.3055	Whsc1	107823	LIB	3055	0.121372859	0.0001485	0.242597217
+Whsc1.3056	Whsc1	107823	LIB	3056	0.209818088	0.240167026	0.179469151
+Whsc1l1.276	Whsc1l1	234135	LIB	276	0.003690779	0.001781142	0.005600417
+Whsc1l1.373	Whsc1l1	234135	LIB	373	0.000537019	4.11E-05	0.001032946
+Whsc1l1.524	Whsc1l1	234135	LIB	524	1.108399963	1.304866171	0.911933755
+Whsc1l1.1307	Whsc1l1	234135	LIB	1307	0.11091394	0.105350477	0.116477403
+Whsc1l1.1653	Whsc1l1	234135	LIB	1653	0	0	0
+Wnt5a.2013	Wnt5a	22418	LIB	2013	0.364395259	0.140090029	0.588700489
+Wnt5a.2659	Wnt5a	22418	LIB	2659	0.746392031	0.784340702	0.708443359
+Wnt5a.2764	Wnt5a	22418	LIB	2764	0.057297605	0.114595211	0
+Wnt5a.4154	Wnt5a	22418	LIB	4154	1.074939471	1.697942922	0.45193602
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml	Mon Jan 19 22:14:10 2015 -0500
@@ -0,0 +1,29 @@
+<?xml version="1.0"?>
+<tool_dependency>
+    <package name="R" version="3.1.2">
+        <repository changeset_revision="f0626dac6765" name="package_r_3_1_2" owner="iuc" prior_installation_required="True" toolshed="https://testtoolshed.g2.bx.psu.edu" />
+    </package>
+    <package name="shrnaseq_r" version="0.1">
+        <install version="1.0">
+            <actions>
+                <action type="setup_r_environment">
+                    <repository changeset_revision="f0626dac6765" name="package_r_3_1_2" owner="iuc" toolshed="https://testtoolshed.g2.bx.psu.edu">
+                        <package name="R" version="3.1.2" />
+                    </repository>
+                    <package>https://github.com/fubar2/galaxy_tool_source/blob/master/RELEASE_2_14/locfit_1.5-9.1.tar.gz?raw=true</package>
+                    <package>https://github.com/fubar2/galaxy_tool_source/blob/master/RELEASE_2_14/limma_3.22.4.tar.gz?raw=true</package>
+                    <package>https://github.com/fubar2/galaxy_tool_source/blob/master/RELEASE_2_14/edgeR_3.8.5.tar.gz?raw=true</package>
+                    <package>https://github.com/fubar2/galaxy_tool_source/blob/master/RELEASE_2_14/statmod_1.4.20.tar.gz?raw=true</package>
+                </action>
+                <action type="chmod">
+                    <file mode="755">$REPOSITORY_INSTALL_DIR/hairpinTool.R</file>
+                </action>
+                <action type="set_environment">
+                    <environment_variable action="set_to" name="HAIRPINTOOL_R_SOURCE">$REPOSITORY_INSTALL_DIR/hairpinTool.R</environment_variable>
+                </action>
+            </actions>
+        </install>
+    </package>
+    <readme>
+    </readme>
+</tool_dependency>