Mercurial > repos > fubar > fastqc_dev
diff FastQC/rgFastQC.xml @ 0:57f890a5fa73 draft
Uploaded
| author | fubar |
|---|---|
| date | Tue, 04 Jun 2013 00:01:51 -0400 |
| parents | |
| children | 7e59ebcb25db |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/FastQC/rgFastQC.xml Tue Jun 04 00:01:51 2013 -0400 @@ -0,0 +1,102 @@ +<tool name="FastQC: Comprehensive QC" id="fastqc" version="0.53"> + <description>reporting for short read sequence</description> + <command interpreter="python"> + rgFastQC.py -i "$input_file" -d "$html_file.files_path" -o "$html_file" -n "$out_prefix" -f "$input_file.ext" -j "$input_file.name" -e "\$FASTQC_BINARY_PATH" +#if $contaminants.dataset and str($contaminants) > '' +-c "$contaminants" +#end if + </command> + <requirements> + <requirement type="set_environment">FASTQC_BINARY_PATH</requirement> + <requirement type="package" version="0.10.1">FastQC</requirement> + </requirements> + <inputs> + <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" /> + <param name="out_prefix" value="FastQC" type="text" label="Title for the output file - to remind you what the job was for" size="80" + help="Letters and numbers only please - other characters will be removed"> + <sanitizer invalid_char=""> + <valid initial="string.letters,string.digits"/> + </sanitizer> + </param> + <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" + help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/> + </inputs> + <outputs> + <data format="html" name="html_file" label="${out_prefix}_${input_file.name}.html" /> + </outputs> + <tests> + <test> + <param name="input_file" value="1000gsample.fastq" /> + <param name="out_prefix" value="fastqc_out" /> + <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" /> + <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/> + </test> + </tests> + <help> + +.. class:: infomark + +**Purpose** + +FastQC aims to provide a simple way to do some quality control checks on raw +sequence data coming from high throughput sequencing pipelines. +It provides a modular set of analyses which you can use to give a quick +impression of whether your data has any problems of +which you should be aware before doing any further analysis. + +The main functions of FastQC are: + +- Import of data from BAM, SAM or FastQ files (any variant) +- Providing a quick overview to tell you in which areas there may be problems +- Summary graphs and tables to quickly assess your data +- Export of results to an HTML based permanent report +- Offline operation to allow automated generation of reports without running the interactive application + + +----- + + +.. class:: infomark + +**FastQC** + +This is a Galaxy wrapper. It merely exposes the external package FastQC_ which is documented at FastQC_ +Kindly acknowledge it as well as this tool if you use it. +FastQC incorporates the Picard-tools_ libraries for sam/bam processing. + +The contaminants file parameter was borrowed from the independently developed +fastqcwrapper contributed to the Galaxy Community Tool Shed by J. Johnson. + +----- + +.. class:: infomark + +**Inputs and outputs** + +FastQC_ is the best place to look for documentation - it's very good. +A summary follows below for those in a tearing hurry. + +This wrapper will accept a Galaxy fastq, sam or bam as the input read file to check. +It will also take an optional file containing a list of contaminants information, in the form of +a tab-delimited file with 2 columns, name and sequence. + +The tool produces a single HTML output file that contains all of the results, including the following: + +- Basic Statistics +- Per base sequence quality +- Per sequence quality scores +- Per base sequence content +- Per base GC content +- Per sequence GC content +- Per base N content +- Sequence Length Distribution +- Sequence Duplication Levels +- Overrepresented sequences +- Kmer Content + +All except Basic Statistics and Overrepresented sequences are plots. + .. _FastQC: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/ + .. _Picard-tools: http://picard.sourceforge.net/index.shtml + +</help> +</tool>
