fastqc: FastQC/test-data/fastqc_report.html annotate

annotate FastQC/test-data/fastqc_report.html @ 13:c3ac02711af2 draft default tip

Uploaded

author	fubar
date	Mon, 03 Jun 2013 23:59:16 -0400
parents	42251cbdeeac
children

rev	line source
0 42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1 <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Strict//EN">
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	2 <html>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	3 <head><title>dataset_100.dat FastQC Report</title>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	4
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	5 <style type="text/css">
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	6
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	7 body {
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	8 font-family: sans-serif;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	9 color: #000000;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	10 background-color: #FFFFFF;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	11 border: 0;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	12 margin: 0;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	13 padding: 0;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	14 }
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	15
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	16 div.header {
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	17 background-color: #EEEEEE;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	18 border:0;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	19 margin:0;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	20 padding: 0.5em;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	21 font-size: 200%;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	22 font-weight: bold;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	23 }
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	24
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	25 div.footer {
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	26 background-color: #EEEEEE;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	27 border:0;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	28 margin:0;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	29 padding: 0.5em;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	30 font-size: 100%;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	31 font-weight: bold;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	32 }
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	33
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	34 div.main {
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	35 margin-left: 2em;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	36 margin-right: 2em;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	37 }
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	38
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	39 div.module {
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	40 padding-bottom:1.5em;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	41 padding-top:1.5em;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	42 }
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	43
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	44 a {
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	45 color: #000080;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	46 }
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	47
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	48 a:hover {
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	49 color: #800000;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	50 }
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	51
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	52 h2 {
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	53 color: #800000;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	54 padding-bottom: 0;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	55 margin-bottom: 0;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	56 }
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	57
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	58 table {
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	59 margin-left: 3em;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	60 text-align: center;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	61 }
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	62
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	63 th {
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	64 text-align: center;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	65 background-color: #000080;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	66 color: #FFFFFF;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	67 padding: 0.4em;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	68 }
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	69
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	70 td {
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	71 font-family: monospace;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	72 text-align: left;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	73 background-color: #EEEEEE;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	74 color: #000000;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	75 padding: 0.4em;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	76 }
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	77
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	78 img {
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	79 padding-top: 0;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	80 margin-top: 0;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	81 border-top: 0;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	82 }
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	83
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	84 img.indented {
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	85 margin-left: 3em;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	86 }
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	87
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	88 p {
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	89 padding-top: 0;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	90 margin-top: 0;
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	91 }
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	92 </style>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	93
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	94 </head>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	95 <body>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	96 <div class="header"><img src="fastqc_icon.png">FastQC Report</div>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	97 <div class="main">
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	98 <h3>Sun 29 May 2011</h3>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	99 <h3>dataset_100.dat</h3>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	100 <h2 id="summary">Summary</h2>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	101 <ul>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	102 <li><img src="tick.png" alt="[PASS]"> <a href="#M0">Basic Statistics</a></li>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	103 <li><img src="warning.png" alt="[WARNING]"> <a href="#M1">Per base sequence quality</a></li>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	104 <li><img src="warning.png" alt="[WARNING]"> <a href="#M2">Per sequence quality scores</a></li>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	105 <li><img src="tick.png" alt="[PASS]"> <a href="#M3">Per base sequence content</a></li>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	106 <li><img src="tick.png" alt="[PASS]"> <a href="#M4">Per base GC content</a></li>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	107 <li><img src="warning.png" alt="[WARNING]"> <a href="#M5">Per sequence GC content</a></li>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	108 <li><img src="tick.png" alt="[PASS]"> <a href="#M6">Per base N content</a></li>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	109 <li><img src="tick.png" alt="[PASS]"> <a href="#M7">Sequence Length Distribution</a></li>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	110 <li><img src="tick.png" alt="[PASS]"> <a href="#M8">Sequence Duplication Levels</a></li>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	111 <li><img src="warning.png" alt="[WARNING]"> <a href="#M9">Overrepresented sequences</a></li>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	112 <li><img src="error.png" alt="[FAIL]"> <a href="#M10">Kmer Content</a></li>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	113 </ul>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	114 <div class="module"><h2 id="M0"><img src="tick.png" alt="[FAIL]"> Basic Statistics</h2>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	115 <table>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	116 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	117 <th>Measure</th>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	118 <th>Value</th>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	119 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	120 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	121 <td>Filename</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	122 <td>dataset_100.dat</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	123 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	124 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	125 <td>File type</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	126 <td>Conventional base calls</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	127 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	128 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	129 <td>Encoding</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	130 <td>Sanger / Illumina 1.9</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	131 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	132 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	133 <td>Total Sequences</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	134 <td>5000</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	135 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	136 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	137 <td>Sequence length</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	138 <td>54</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	139 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	140 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	141 <td>%GC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	142 <td>43</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	143 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	144 </table>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	145 <p><a href="#summary">Back to summary</a></div>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	146 <div class="module"><h2 id="M1"><img src="warning.png" alt="[FAIL]"> Per base sequence quality</h2>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	147 <p><img class="indented" src="per_base_quality.png"></p>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	148 <p><a href="#summary">Back to summary</a></div>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	149 <div class="module"><h2 id="M2"><img src="warning.png" alt="[FAIL]"> Per sequence quality scores</h2>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	150 <p><img class="indented" src="per_sequence_quality.png"></p>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	151 <p><a href="#summary">Back to summary</a></div>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	152 <div class="module"><h2 id="M3"><img src="tick.png" alt="[FAIL]"> Per base sequence content</h2>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	153 <p><img class="indented" src="per_base_sequence_content.png"></p>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	154 <p><a href="#summary">Back to summary</a></div>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	155 <div class="module"><h2 id="M4"><img src="tick.png" alt="[FAIL]"> Per base GC content</h2>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	156 <p><img class="indented" src="per_base_gc_content.png"></p>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	157 <p><a href="#summary">Back to summary</a></div>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	158 <div class="module"><h2 id="M5"><img src="warning.png" alt="[FAIL]"> Per sequence GC content</h2>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	159 <p><img class="indented" src="per_sequence_gc_content.png"></p>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	160 <p><a href="#summary">Back to summary</a></div>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	161 <div class="module"><h2 id="M6"><img src="tick.png" alt="[FAIL]"> Per base N content</h2>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	162 <p><img class="indented" src="per_base_n_content.png"></p>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	163 <p><a href="#summary">Back to summary</a></div>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	164 <div class="module"><h2 id="M7"><img src="tick.png" alt="[FAIL]"> Sequence Length Distribution</h2>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	165 <p><img class="indented" src="sequence_length_distribution.png"></p>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	166 <p><a href="#summary">Back to summary</a></div>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	167 <div class="module"><h2 id="M8"><img src="tick.png" alt="[FAIL]"> Sequence Duplication Levels</h2>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	168 <p><img class="indented" src="duplication_levels.png"></p>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	169 <p><a href="#summary">Back to summary</a></div>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	170 <div class="module"><h2 id="M9"><img src="warning.png" alt="[FAIL]"> Overrepresented sequences</h2>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	171 <table>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	172 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	173 <th>Sequence</th>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	174 <th>Count</th>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	175 <th>Percentage</th>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	176 <th>Possible Source</th>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	177 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	178 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	179 <td>CGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGCAGGAAT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	180 <td>7</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	181 <td>0.13999999999999999</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	182 <td>Illumina Paired End PCR Primer 2 (96% over 33bp)</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	183 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	184 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	185 <td>CGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGAC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	186 <td>7</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	187 <td>0.13999999999999999</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	188 <td>Illumina Paired End PCR Primer 2 (100% over 35bp)</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	189 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	190 </table>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	191 <p><a href="#summary">Back to summary</a></div>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	192 <div class="module"><h2 id="M10"><img src="error.png" alt="[FAIL]"> Kmer Content</h2>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	193 <p><img class="indented" src="kmer_profiles.png"></p>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	194 <table>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	195 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	196 <th>Sequence</th>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	197 <th>Count</th>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	198 <th>Obs/Exp Overall</th>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	199 <th>Obs/Exp Max</th>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	200 <th>Max Obs/Exp Position</th>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	201 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	202 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	203 <td>CCCCC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	204 <td>1110</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	205 <td>9.557241</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	206 <td>23.193876</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	207 <td>44</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	208 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	209 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	210 <td>AAAAA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	211 <td>2130</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	212 <td>4.1300144</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	213 <td>5.698024</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	214 <td>7</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	215 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	216 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	217 <td>CTCCC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	218 <td>530</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	219 <td>3.5749238</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	220 <td>11.56272</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	221 <td>11</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	222 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	223 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	224 <td>CCTCC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	225 <td>510</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	226 <td>3.440021</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	227 <td>11.56272</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	228 <td>14</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	229 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	230 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	231 <td>CTGGG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	232 <td>465</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	233 <td>3.1575248</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	234 <td>8.314476</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	235 <td>45</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	236 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	237 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	238 <td>TGGAA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	239 <td>785</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	240 <td>2.929684</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	241 <td>6.397646</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	242 <td>17</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	243 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	244 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	245 <td>GGGGG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	246 <td>335</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	247 <td>2.9167063</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	248 <td>10.660779</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	249 <td>6</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	250 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	251 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	252 <td>GAATG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	253 <td>775</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	254 <td>2.8923633</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	255 <td>10.053445</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	256 <td>20</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	257 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	258 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	259 <td>CCCAG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	260 <td>450</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	261 <td>2.8820548</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	262 <td>7.8420706</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	263 <td>22</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	264 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	265 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	266 <td>GTGTG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	267 <td>520</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	268 <td>2.7661672</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	269 <td>6.513526</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	270 <td>23</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	271 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	272 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	273 <td>TGTGT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	274 <td>660</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	275 <td>2.744307</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	276 <td>6.109576</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	277 <td>27</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	278 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	279 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	280 <td>GGGAG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	281 <td>425</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	282 <td>2.7401958</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	283 <td>6.315732</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	284 <td>6</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	285 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	286 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	287 <td>ATGGA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	288 <td>730</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	289 <td>2.7244196</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	290 <td>6.397646</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	291 <td>20</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	292 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	293 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	294 <td>GCTGG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	295 <td>395</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	296 <td>2.6821985</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	297 <td>6.651581</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	298 <td>16</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	299 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	300 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	301 <td>GGAGG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	302 <td>410</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	303 <td>2.643483</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	304 <td>7.894665</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	305 <td>7</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	306 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	307 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	308 <td>GGAAT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	309 <td>700</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	310 <td>2.612457</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	311 <td>7.3115954</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	312 <td>19</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	313 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	314 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	315 <td>GCAGG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	316 <td>400</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	317 <td>2.5732677</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	318 <td>14.17877</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	319 <td>16</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	320 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	321 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	322 <td>CCTGG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	323 <td>370</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	324 <td>2.5068476</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	325 <td>6.6367774</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	326 <td>7</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	327 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	328 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	329 <td>CAGCC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	330 <td>380</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	331 <td>2.4337354</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	332 <td>6.273657</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	333 <td>4</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	334 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	335 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	336 <td>TGGGA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	337 <td>480</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	338 <td>2.419065</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	339 <td>7.40506</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	340 <td>20</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	341 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	342 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	343 <td>AATGG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	344 <td>645</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	345 <td>2.4071925</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	346 <td>5.4836965</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	347 <td>18</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	348 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	349 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	350 <td>GCCTC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	351 <td>355</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	352 <td>2.3998654</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	353 <td>6.622006</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	354 <td>2</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	355 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	356 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	357 <td>CCCTC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	358 <td>355</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	359 <td>2.394524</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	360 <td>8.259085</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	361 <td>13</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	362 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	363 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	364 <td>CCAGC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	365 <td>370</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	366 <td>2.3696895</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	367 <td>6.2736564</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	368 <td>14</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	369 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	370 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	371 <td>GGAAG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	372 <td>495</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	373 <td>2.3634295</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	374 <td>14.031037</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	375 <td>2</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	376 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	377 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	378 <td>GGCTG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	379 <td>345</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	380 <td>2.3426795</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	381 <td>9.97737</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	382 <td>24</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	383 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	384 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	385 <td>CAGGA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	386 <td>490</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	387 <td>2.3343499</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	388 <td>13.99981</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	389 <td>17</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	390 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	391 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	392 <td>CCAGG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	393 <td>360</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	394 <td>2.3107867</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	395 <td>6.2876506</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	396 <td>11</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	397 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	398 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	399 <td>CTGTG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	400 <td>435</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	401 <td>2.3088553</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	402 <td>9.09864</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	403 <td>44</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	404 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	405 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	406 <td>GCCTG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	407 <td>340</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	408 <td>2.3035896</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	409 <td>8.295971</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	410 <td>5</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	411 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	412 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	413 <td>TCCCA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	414 <td>460</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	415 <td>2.3028264</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	416 <td>6.1297736</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	417 <td>9</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	418 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	419 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	420 <td>CTGCC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	421 <td>340</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	422 <td>2.2984629</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	423 <td>8.277508</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	424 <td>10</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	425 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	426 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	427 <td>CAGCA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	428 <td>480</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	429 <td>2.2816207</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	430 <td>10.47649</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	431 <td>14</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	432 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	433 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	434 <td>TTCCT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	435 <td>545</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	436 <td>2.256056</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	437 <td>7.0961456</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	438 <td>1</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	439 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	440 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	441 <td>CTCCT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	442 <td>415</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	443 <td>2.1929073</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	444 <td>6.4701333</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	445 <td>15</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	446 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	447 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	448 <td>TCCCC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	449 <td>325</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	450 <td>2.1921701</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	451 <td>6.6072683</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	452 <td>28</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	453 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	454 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	455 <td>CAGGC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	456 <td>335</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	457 <td>2.1503155</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	458 <td>6.2876506</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	459 <td>14</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	460 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	461 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	462 <td>CCCCA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	463 <td>335</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	464 <td>2.1407545</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	465 <td>6.259694</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	466 <td>20</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	467 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	468 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	469 <td>TGGTG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	470 <td>400</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	471 <td>2.127821</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	472 <td>6.513526</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	473 <td>9</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	474 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	475 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	476 <td>CCCCT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	477 <td>315</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	478 <td>2.1247187</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	479 <td>6.607268</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	480 <td>12</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	481 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	482 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	483 <td>GGCAG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	484 <td>330</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	485 <td>2.122946</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	486 <td>6.301676</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	487 <td>16</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	488 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	489 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	490 <td>CTCTG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	491 <td>400</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	492 <td>2.1183603</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	493 <td>5.187652</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	494 <td>16</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	495 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	496 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	497 <td>TTCCA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	498 <td>540</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	499 <td>2.1177678</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	500 <td>6.7228537</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	501 <td>28</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	502 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	503 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	504 <td>CAGAG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	505 <td>440</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	506 <td>2.0961509</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	507 <td>5.833255</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	508 <td>28</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	509 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	510 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	511 <td>CCCTG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	512 <td>310</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	513 <td>2.095657</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	514 <td>6.622006</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	515 <td>24</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	516 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	517 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	518 <td>AGGGA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	519 <td>435</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	520 <td>2.0769534</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	521 <td>5.846266</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	522 <td>1</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	523 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	524 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	525 <td>CTCAG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	526 <td>410</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	527 <td>2.0570977</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	528 <td>6.143447</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	529 <td>24</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	530 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	531 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	532 <td>CTTCC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	533 <td>385</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	534 <td>2.034384</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	535 <td>6.4701333</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	536 <td>17</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	537 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	538 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	539 <td>AGCAG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	540 <td>425</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	541 <td>2.0246909</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	542 <td>10.499857</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	543 <td>15</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	544 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	545 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	546 <td>AGGAA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	547 <td>570</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	548 <td>2.015381</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	549 <td>10.390455</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	550 <td>18</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	551 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	552 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	553 <td>TCCTC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	554 <td>380</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	555 <td>2.0079634</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	556 <td>5.1761065</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	557 <td>1</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	558 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	559 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	560 <td>TCAGC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	561 <td>400</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	562 <td>2.0069244</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	563 <td>12.286894</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	564 <td>44</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	565 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	566 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	567 <td>AGAGC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	568 <td>420</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	569 <td>2.0008712</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	570 <td>10.499858</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	571 <td>5</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	572 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	573 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	574 <td>TCCTG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	575 <td>375</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	576 <td>1.9859626</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	577 <td>6.4845653</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	578 <td>8</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	579 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	580 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	581 <td>TCTCC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	582 <td>375</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	583 <td>1.9815428</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	584 <td>5.1761065</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	585 <td>8</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	586 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	587 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	588 <td>CACCC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	589 <td>310</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	590 <td>1.9809967</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	591 <td>6.259694</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	592 <td>9</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	593 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	594 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	595 <td>TGTGG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	596 <td>370</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	597 <td>1.9682345</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	598 <td>5.210821</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	599 <td>4</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	600 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	601 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	602 <td>GATGG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	603 <td>390</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	604 <td>1.9654902</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	605 <td>6.1708827</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	606 <td>1</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	607 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	608 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	609 <td>TGGCT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	610 <td>370</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	611 <td>1.9638538</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	612 <td>9.098641</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	613 <td>45</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	614 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	615 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	616 <td>TCCCT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	617 <td>370</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	618 <td>1.9551222</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	619 <td>5.1761065</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	620 <td>37</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	621 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	622 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	623 <td>CAGGG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	624 <td>300</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	625 <td>1.9299511</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	626 <td>6.3016763</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	627 <td>21</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	628 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	629 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	630 <td>AAGAG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	631 <td>545</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	632 <td>1.9269869</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	633 <td>9.524584</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	634 <td>4</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	635 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	636 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	637 <td>CAGAA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	638 <td>545</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	639 <td>1.9226985</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	640 <td>6.0476103</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	641 <td>6</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	642 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	643 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	644 <td>CTGAG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	645 <td>380</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	646 <td>1.9108309</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	647 <td>6.15715</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	648 <td>11</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	649 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	650 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	651 <td>TCTCT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	652 <td>460</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	653 <td>1.9041945</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	654 <td>5.068676</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	655 <td>8</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	656 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	657 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	658 <td>GAGGC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	659 <td>295</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	660 <td>1.897785</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	661 <td>6.301676</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	662 <td>22</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	663 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	664 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	665 <td>CCCAC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	666 <td>295</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	667 <td>1.885142</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	668 <td>6.259694</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	669 <td>4</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	670 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	671 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	672 <td>CCTGC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	673 <td>275</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	674 <td>1.8590509</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	675 <td>9.93301</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	676 <td>6</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	677 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	678 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	679 <td>CCTGT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	680 <td>350</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	681 <td>1.8535651</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	682 <td>6.4845653</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	683 <td>6</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	684 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	685 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	686 <td>TTTCC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	687 <td>445</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	688 <td>1.8421009</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	689 <td>5.0686755</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	690 <td>14</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	691 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	692 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	693 <td>TGCCT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	694 <td>345</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	695 <td>1.8270856</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	696 <td>5.187652</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	697 <td>12</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	698 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	699 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	700 <td>CACAC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	701 <td>380</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	702 <td>1.8022629</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	703 <td>5.8073177</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	704 <td>17</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	705 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	706 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	707 <td>CCTCT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	708 <td>340</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	709 <td>1.7965988</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	710 <td>7.7641597</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	711 <td>2</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	712 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	713 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	714 <td>TTCCC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	715 <td>340</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	716 <td>1.7965986</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	717 <td>6.470133</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	718 <td>18</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	719 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	720 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	721 <td>GAAGA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	722 <td>500</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	723 <td>1.767878</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	724 <td>7.792842</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	725 <td>26</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	726 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	727 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	728 <td>CTGGC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	729 <td>260</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	730 <td>1.7615684</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	731 <td>6.636777</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	732 <td>8</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	733 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	734 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	735 <td>TTCAG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	736 <td>440</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	737 <td>1.7294377</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	738 <td>9.6255</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	739 <td>12</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	740 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	741 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	742 <td>CTCTC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	743 <td>325</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	744 <td>1.717337</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	745 <td>5.1761065</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	746 <td>3</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	747 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	748 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	749 <td>GTGGT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	750 <td>320</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	751 <td>1.7022567</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	752 <td>5.2108207</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	753 <td>24</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	754 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	755 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	756 <td>GGGTG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	757 <td>250</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	758 <td>1.7013805</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	759 <td>8.333022</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	760 <td>28</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	761 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	762 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	763 <td>TGCTT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	764 <td>410</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	765 <td>1.7010024</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	766 <td>5.0799813</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	767 <td>4</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	768 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	769 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	770 <td>CTTTG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	771 <td>405</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	772 <td>1.6802584</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	773 <td>5.0799813</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	774 <td>2</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	775 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	776 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	777 <td>AGAAG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	778 <td>475</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	779 <td>1.6794841</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	780 <td>5.1952276</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	781 <td>22</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	782 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	783 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	784 <td>ACTCC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	785 <td>330</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	786 <td>1.6520276</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	787 <td>6.1297736</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	788 <td>10</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	789 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	790 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	791 <td>CTGCT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	792 <td>310</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	793 <td>1.6417291</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	794 <td>6.4845653</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	795 <td>3</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	796 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	797 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	798 <td>GCCCC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	799 <td>190</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	800 <td>1.6395733</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	801 <td>6.339712</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	802 <td>37</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	803 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	804 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	805 <td>AGTGG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	806 <td>325</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	807 <td>1.6379085</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	808 <td>6.1708827</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	809 <td>3</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	810 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	811 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	812 <td>TGGCA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	813 <td>325</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	814 <td>1.6342632</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	815 <td>6.1571493</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	816 <td>16</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	817 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	818 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	819 <td>GGCTC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	820 <td>240</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	821 <td>1.626063</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	822 <td>6.636776</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	823 <td>25</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	824 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	825 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	826 <td>ACACA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	827 <td>460</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	828 <td>1.6192161</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	829 <td>5.1721287</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	830 <td>14</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	831 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	832 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	833 <td>GCTTT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	834 <td>390</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	835 <td>1.6180266</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	836 <td>5.0799813</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	837 <td>5</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	838 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	839 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	840 <td>TTCTG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	841 <td>390</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	842 <td>1.6180266</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	843 <td>5.0799813</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	844 <td>3</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	845 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	846 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	847 <td>TCCTT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	848 <td>390</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	849 <td>1.6144258</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	850 <td>6.0824113</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	851 <td>16</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	852 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	853 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	854 <td>CCCAA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	855 <td>335</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	856 <td>1.588837</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	857 <td>5.8073177</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	858 <td>10</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	859 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	860 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	861 <td>GCACA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	862 <td>330</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	863 <td>1.5686142</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	864 <td>5.8202715</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	865 <td>18</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	866 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	867 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	868 <td>GTTCA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	869 <td>395</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	870 <td>1.5525635</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	871 <td>7.700401</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	872 <td>11</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	873 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	874 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	875 <td>TCTTC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	876 <td>375</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	877 <td>1.5523325</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	878 <td>5.068676</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	879 <td>4</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	880 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	881 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	882 <td>AGGCA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	883 <td>325</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	884 <td>1.5482932</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	885 <td>5.8332543</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	886 <td>6</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	887 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	888 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	889 <td>GGGGA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	890 <td>240</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	891 <td>1.5474048</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	892 <td>6.3157325</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	893 <td>7</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	894 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	895 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	896 <td>CCTTC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	897 <td>290</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	898 <td>1.5323931</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	899 <td>6.4701333</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	900 <td>17</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	901 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	902 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	903 <td>ATGCC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	904 <td>305</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	905 <td>1.5302798</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	906 <td>12.286893</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	907 <td>22</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	908 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	909 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	910 <td>GAAGG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	911 <td>320</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	912 <td>1.5278738</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	913 <td>5.8462653</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	914 <td>8</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	915 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	916 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	917 <td>GGGAT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	918 <td>295</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	919 <td>1.4867171</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	920 <td>7.40506</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	921 <td>21</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	922 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	923 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	924 <td>TGTGC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	925 <td>280</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	926 <td>1.4861598</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	927 <td>5.199224</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	928 <td>7</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	929 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	930 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	931 <td>AACAG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	932 <td>420</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	933 <td>1.4817125</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	934 <td>5.1836653</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	935 <td>10</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	936 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	937 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	938 <td>TCTTT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	939 <td>455</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	940 <td>1.4755235</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	941 <td>5.5590916</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	942 <td>1</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	943 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	944 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	945 <td>TTGGC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	946 <td>275</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	947 <td>1.4596211</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	948 <td>5.199223</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	949 <td>15</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	950 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	951 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	952 <td>GAGAT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	953 <td>385</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	954 <td>1.4368514</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	955 <td>6.397646</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	956 <td>27</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	957 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	958 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	959 <td>TTTGG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	960 <td>345</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	961 <td>1.4345239</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	962 <td>6.1095753</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	963 <td>3</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	964 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	965 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	966 <td>GGTTC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	967 <td>270</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	968 <td>1.4330826</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	969 <td>10.398446</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	970 <td>10</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	971 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	972 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	973 <td>CCTTG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	974 <td>265</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	975 <td>1.4034137</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	976 <td>5.187652</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	977 <td>18</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	978 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	979 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	980 <td>CCCTT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	981 <td>265</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	982 <td>1.4002901</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	983 <td>5.176106</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	984 <td>14</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	985 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	986 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	987 <td>CTGTT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	988 <td>335</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	989 <td>1.3898433</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	990 <td>5.0799813</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	991 <td>10</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	992 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	993 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	994 <td>CCTTT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	995 <td>335</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	996 <td>1.3867503</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	997 <td>5.068676</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	998 <td>8</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	999 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1000 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1001 <td>GGCAC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1002 <td>215</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1003 <td>1.3800533</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1004 <td>6.2876506</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1005 <td>17</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1006 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1007 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1008 <td>TTGAA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1009 <td>465</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1010 <td>1.3564935</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1011 <td>6.4295163</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1012 <td>7</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1013 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1014 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1015 <td>CTTGG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1016 <td>255</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1017 <td>1.3534669</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1018 <td>5.1992235</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1019 <td>18</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1020 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1021 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1022 <td>GTGTT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1023 <td>325</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1024 <td>1.3513632</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1025 <td>5.091313</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1026 <td>28</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1027 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1028 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1029 <td>GGCCC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1030 <td>155</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1031 <td>1.3405302</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1032 <td>6.353853</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1033 <td>2</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1034 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1035 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1036 <td>TGGTT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1037 <td>320</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1038 <td>1.330573</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1039 <td>5.091313</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1040 <td>25</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1041 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1042 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1043 <td>TTCTT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1044 <td>410</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1045 <td>1.3295923</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1046 <td>7.941558</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1047 <td>4</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1048 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1049 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1050 <td>GGGGT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1051 <td>195</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1052 <td>1.327077</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1053 <td>8.333022</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1054 <td>45</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1055 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1056 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1057 <td>AAGGA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1058 <td>375</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1059 <td>1.3259085</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1060 <td>5.1952276</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1061 <td>44</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1062 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1063 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1064 <td>CAGAT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1065 <td>350</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1066 <td>1.3033215</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1067 <td>5.471493</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1068 <td>10</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1069 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1070 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1071 <td>CTGGT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1072 <td>245</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1073 <td>1.3003898</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1074 <td>5.1992235</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1075 <td>12</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1076 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1077 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1078 <td>TGTCC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1079 <td>245</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1080 <td>1.2974956</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1081 <td>5.187652</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1082 <td>21</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1083 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1084 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1085 <td>GCTCC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1086 <td>190</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1087 <td>1.2844352</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1088 <td>8.277508</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1089 <td>26</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1090 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1091 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1092 <td>GACAG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1093 <td>265</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1094 <td>1.2624544</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1095 <td>5.833254</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1096 <td>27</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1097 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1098 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1099 <td>GAGCG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1100 <td>195</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1101 <td>1.2544682</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1102 <td>12.603353</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1103 <td>6</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1104 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1105 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1106 <td>TTGGG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1107 <td>235</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1108 <td>1.2500948</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1109 <td>6.5135255</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1110 <td>6</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1111 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1112 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1113 <td>AATGC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1114 <td>335</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1115 <td>1.2474647</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1116 <td>10.031068</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1117 <td>21</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1118 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1119 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1120 <td>GGCTT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1121 <td>235</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1122 <td>1.2473125</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1123 <td>5.199223</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1124 <td>4</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1125 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1126 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1127 <td>TTTGC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1128 <td>295</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1129 <td>1.223892</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1130 <td>5.0799813</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1131 <td>9</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1132 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1133 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1134 <td>GGTGT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1135 <td>230</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1136 <td>1.223497</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1137 <td>5.21082</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1138 <td>27</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1139 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1140 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1141 <td>GATCG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1142 <td>235</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1143 <td>1.181698</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1144 <td>6.1571493</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1145 <td>45</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1146 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1147 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1148 <td>AGCTC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1149 <td>225</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1150 <td>1.1288949</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1151 <td>6.1434464</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1152 <td>25</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1153 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1154 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1155 <td>ACCCT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1156 <td>225</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1157 <td>1.1263824</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1158 <td>6.129773</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1159 <td>10</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1160 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1161 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1162 <td>CGGAA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1163 <td>235</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1164 <td>1.119535</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1165 <td>9.333206</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1166 <td>1</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1167 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1168 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1169 <td>CCCAT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1170 <td>220</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1171 <td>1.1013516</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1172 <td>6.129773</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1173 <td>21</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1174 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1175 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1176 <td>TCTTG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1177 <td>265</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1178 <td>1.0994283</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1179 <td>5.0799813</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1180 <td>21</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1181 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1182 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1183 <td>ATGCA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1184 <td>295</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1185 <td>1.0985136</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1186 <td>5.4714913</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1187 <td>37</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1188 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1189 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1190 <td>GCTTG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1191 <td>205</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1192 <td>1.0880812</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1193 <td>5.199223</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1194 <td>2</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1195 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1196 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1197 <td>AGCGG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1198 <td>165</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1199 <td>1.061473</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1200 <td>12.603352</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1201 <td>7</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1202 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1203 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1204 <td>AACCA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1205 <td>300</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1206 <td>1.0560105</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1207 <td>5.1721287</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1208 <td>22</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1209 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1210 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1211 <td>AACCT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1212 <td>280</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1213 <td>1.0403365</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1214 <td>5.4593143</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1215 <td>13</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1216 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1217 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1218 <td>CCGAG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1219 <td>160</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1220 <td>1.0270164</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1221 <td>12.575301</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1222 <td>25</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1223 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1224 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1225 <td>TTGCC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1226 <td>190</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1227 <td>1.0062209</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1228 <td>5.1876516</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1229 <td>3</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1230 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1231 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1232 <td>ACTCA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1233 <td>265</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1234 <td>0.9846043</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1235 <td>5.4593153</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1236 <td>11</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1237 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1238 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1239 <td>CTCAT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1240 <td>250</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1241 <td>0.98044825</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1242 <td>5.7624474</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1243 <td>4</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1244 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1245 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1246 <td>GTTCC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1247 <td>185</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1248 <td>0.9797416</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1249 <td>6.4845653</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1250 <td>27</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1251 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1252 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1253 <td>GAACC</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1254 <td>205</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1255 <td>0.97444224</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1256 <td>5.820272</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1257 <td>25</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1258 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1259 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1260 <td>GGCGG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1261 <td>110</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1262 <td>0.9555928</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1263 <td>10.637051</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1264 <td>44</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1265 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1266 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1267 <td>GCGGT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1268 <td>130</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1269 <td>0.8827489</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1270 <td>13.303162</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1271 <td>8</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1272 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1273 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1274 <td>GCGGG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1275 <td>100</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1276 <td>0.86872077</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1277 <td>6.3822303</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1278 <td>45</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1279 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1280 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1281 <td>TGCCG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1282 <td>125</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1283 <td>0.846908</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1284 <td>14.93275</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1285 <td>23</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1286 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1287 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1288 <td>AGGCG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1289 <td>120</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1290 <td>0.7719804</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1291 <td>6.3016763</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1292 <td>15</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1293 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1294 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1295 <td>CGGTT</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1296 <td>140</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1297 <td>0.74307984</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1298 <td>10.398446</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1299 <td>9</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1300 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1301 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1302 <td>GCCGA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1303 <td>115</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1304 <td>0.738168</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1305 <td>12.575301</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1306 <td>24</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1307 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1308 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1309 <td>CGAGA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1310 <td>130</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1311 <td>0.61931723</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1312 <td>9.333206</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1313 <td>26</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1314 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1315 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1316 <td>CGGGA</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1317 <td>85</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1318 <td>0.5468194</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1319 <td>6.301676</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1320 <td>24</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1321 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1322 <tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1323 <td>CACGG</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1324 <td>85</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1325 <td>0.54560244</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1326 <td>6.2876506</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1327 <td>37</td>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1328 </tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1329 </table>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1330 <p><a href="#summary">Back to summary</a></div>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1331 </div><div class="footer">Produced by <a href="http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/">FastQC</a> (version 0.9.1)</div>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1332 <table>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1333 <tr><td><a href="dataset_100.dat_fastqc.zip">dataset_100.dat_fastqc.zip (294.3 KB)</a></td></tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1334 <tr><td><a href="duplication_levels.png">duplication_levels.png (14.4 KB)</a></td></tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1335 <tr><td><a href="fastqc_data.txt">fastqc_data.txt (11.6 KB)</a></td></tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1336 <tr><td><a href="fastqc_report.html">fastqc_report.html (19.8 KB)</a></td></tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1337 <tr><td><a href="kmer_profiles.png">kmer_profiles.png (172.2 KB)</a></td></tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1338 <tr><td><a href="per_base_gc_content.png">per_base_gc_content.png (12.0 KB)</a></td></tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1339 <tr><td><a href="per_base_n_content.png">per_base_n_content.png (7.4 KB)</a></td></tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1340 <tr><td><a href="per_base_quality.png">per_base_quality.png (9.4 KB)</a></td></tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1341 <tr><td><a href="per_base_sequence_content.png">per_base_sequence_content.png (23.8 KB)</a></td></tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1342 <tr><td><a href="per_sequence_gc_content.png">per_sequence_gc_content.png (29.4 KB)</a></td></tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1343 <tr><td><a href="per_sequence_quality.png">per_sequence_quality.png (21.7 KB)</a></td></tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1344 <tr><td><a href="sequence_length_distribution.png">sequence_length_distribution.png (18.8 KB)</a></td></tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1345 <tr><td><a href="summary.txt">summary.txt (487 B)</a></td></tr>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1346 </table><p/>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1347 <a href="http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/">FastQC documentation and full attribution is here</a><br/><hr/>
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1348 FastQC was run by Galaxy using the rgenetics rgFastQC wrapper - see http://rgenetics.org for details and licensing
42251cbdeeac Initial commit of test for FastQC with installation of the java stuff fubar parents: diff changeset	1349 </body></html>

Mercurial > repos > fubar > fastqc_320

annotate FastQC/test-data/fastqc_report.html @ 13:c3ac02711af2 draft default tip