Mercurial > repos > fubar > clustalw

changeset 1:e49657d6921e draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded
author fubar
date Wed, 10 Jul 2013 20:38:37 -0400
parents 332e4617d267
children fb301c318fec
files rgclustal/README rgclustal/rgClustal_testin.fasta rgclustal/rgClustal_testout.fasta rgclustal/rgClustal_testout.log rgclustal/rgClustalw.xml rgclustal/test-data/rgClustal_testin.fasta rgclustal/test-data/rgClustal_testout.fasta rgclustal/test-data/rgClustal_testout.log rgclustal/tool_dependencies.xml
diffstat 9 files changed, 215 insertions(+), 187 deletions(-) [+]
line wrap: on
line diff
--- a/rgclustal/README	Tue Jun 07 16:14:32 2011 -0400
+++ b/rgclustal/README	Wed Jul 10 20:38:37 2013 -0400
@@ -1,4 +1,6 @@
-This is a wrapper for ClustalW.
+Updated july 11 2013 for automated toolshed installation
+
+** This is a wrapper for ClustalW **
 
 This tool allows you to align multiple sequences in Galaxy, using ClustalW2_ with mostly default options which should work reasonably well for many alignments.
 DNA or protein sequences can be aligned. The input file must be a fasta file in your current history.
@@ -12,6 +14,10 @@
 
 **Installation**
 
+As of July 2013, automated installation from the tool shed should have worked.
+
+Otherwise, the old skool way was:
+
 Make sure clustalw2 is available on the path for all your nodes
 
 Move the test data files to your galaxy root test-data
--- a/rgclustal/rgClustal_testin.fasta	Tue Jun 07 16:14:32 2011 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,25 +0,0 @@
->c_briggsae-chrII(+)/43862-46313
-ATGAGCTTCCACAAAAGCATGAGCTTTCTCAGCTTCTGCCACATCAGCATTCAAATGATC
->c_remanei-Crem_Contig172(-)/123228-124941
-ATGAGCCTCTACAACCGCATGATTCTTTTCAGCCTCTGCCACGTCCGCATTCAAATGCTC
->c_brenneri-Cbre_Contig60(+)/627772-630087
-ATGAGCCTCCACAACAGCATGATTTTTCTCGGCTTCCGCCACATCCGCATTCAAATGATC
->c_elegans-II(+)/9706834-9708803
-ATGAGCCTCTACTACAGCATGATTCTTCTCAGCTTCTGCAACGTCAGCATTCAGATGATC
->c_briggsae-chrIfooI(+)/43862-46313
-CGCACAAATATGATGCACAAATCCACAACCTAAAGCATCTCCGATAACGTTGACCGAAGT
->c_remanei-Crem_Contig172foo(-)/123228-124941
-AGCACAAATGTAATGAACGAATCCGCATCCCAACGCATCGCCAATCACATTCACAGATGT
->c_brenneri-Cbre_Contig60gak(+)/627772-630087
-CGCACAAATGTAGTGGACAAATCCGCATCCCAAAGCGTCTCCGATAACATTTACCGAAGT
->c_elegans-II(+)more/9706834-9708803
-TGCACAAATGTGATGAACGAATCCACATCCCAATGCATCACCGATCACATTGACAGATGT
->c_briggsae-chrII(+)bar/43862-46313
-CCGGAGTCGATCCCTGAAT-----------------------------------------
->c_remanei-Crem_Contig172zot(-)/123228-124941
-ACGAAGTCGGTCCCTATAAGGTATGATTTTATATGA----TGTACCATAAGGAAATAGTC
->c_brenneri-Cbre_Contig60fee(+)/627772-630087
-ACGAAGTCGATCCCTGAAA---------TCAGATGAGCGGTTGACCA---GAGAACAACC
->c_elegans-II(+)meh/9706834-9708803
-ACGAAGTCGGTCCCTGAAC--AATTATTT----TGA----TATA---GAAAGAAACGGTA
-
--- a/rgclustal/rgClustal_testout.fasta	Tue Jun 07 16:14:32 2011 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,48 +0,0 @@
->c_briggsae-chrII_+_
----ATGAGCTTCCACAAAAGCATGAGCTTT
-CTCAGCTTCTGCCACATCAGCATTCAAATG
-ATC
->c_brenneri-Cbre_Contig60_+_
----ATGAGCCTCCACAACAGCATGATTTTT
-CTCGGCTTCCGCCACATCCGCATTCAAATG
-ATC
->c_remanei-Crem_Contig172_-_
----ATGAGCCTCTACAACCGCATGATTCTT
-TTCAGCCTCTGCCACGTCCGCATTCAAATG
-CTC
->c_elegans-II_+_
----ATGAGCCTCTACTACAGCATGATTCTT
-CTCAGCTTCTGCAACGTCAGCATTCAGATG
-ATC
->c_briggsae-chrII_+_bar
----CCGGAGTCGATCCCTGAAT--------
-------------------------------
----
->c_brenneri-Cbre_Contig60fee_+_
----ACGAAGTCGATCCCTGAAA--------
--TCAGATGAGCGGTTGACCA---GAGAACA
-ACC
->c_remanei-Crem_Contig172zot_-_
----ACGAAGTCGGTCCCTATAAGGTATGAT
-TTTATATGA----TGTACCATAAGGAAATA
-GTC
->c_elegans-II_+_meh
----ACGAAGTCGGTCCCTGAAC--AATTAT
-TT----TGA----TATA---GAAAGAAACG
-GTA
->c_briggsae-chrIfooI_+_
-CGCACAAATATGATGCACAAATCCACAACC
-TAAAGCATCTCCGATAACGTTGACCGAAGT
----
->c_brenneri-Cbre_Contig60gak_+_
-CGCACAAATGTAGTGGACAAATCCGCATCC
-CAAAGCGTCTCCGATAACATTTACCGAAGT
----
->c_remanei-Crem_Contig172foo_-_
-AGCACAAATGTAATGAACGAATCCGCATCC
-CAACGCATCGCCAATCACATTCACAGATGT
----
->c_elegans-II_+_more
-TGCACAAATGTGATGAACGAATCCACATCC
-CAATGCATCACCGATCACATTGACAGATGT
----
--- a/rgclustal/rgClustal_testout.log	Tue Jun 07 16:14:32 2011 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,112 +0,0 @@
-
-
-
- CLUSTAL 2.1 Multiple Sequence Alignments
-
-
-Sequence type explicitly set to DNA
-Sequence format is Pearson
-Sequence 1: c_briggsae-chrII_+_/43862-46313                 60 bp
-Sequence 2: c_remanei-Crem_Contig172_-_/123228-124941       60 bp
-Sequence 3: c_brenneri-Cbre_Contig60_+_/627772-630087       60 bp
-Sequence 4: c_elegans-II_+_/9706834-9708803                 60 bp
-Sequence 5: c_briggsae-chrIfooI_+_/43862-46313              60 bp
-Sequence 6: c_remanei-Crem_Contig172foo_-_/123228-124941    60 bp
-Sequence 7: c_brenneri-Cbre_Contig60gak_+_/627772-630087    60 bp
-Sequence 8: c_elegans-II_+_more/9706834-9708803             60 bp
-Sequence 9: c_briggsae-chrII_+_bar/43862-46313              60 bp
-Sequence 10: c_remanei-Crem_Contig172zot_-_/123228-124941    60 bp
-Sequence 11: c_brenneri-Cbre_Contig60fee_+_/627772-630087    60 bp
-Sequence 12: c_elegans-II_+_meh/9706834-9708803              60 bp
-Start of Pairwise alignments
-Aligning...
-
-Sequences (1:2) Aligned. Score:  80
-Sequences (1:3) Aligned. Score:  88
-Sequences (1:4) Aligned. Score:  83
-Sequences (1:5) Aligned. Score:  21
-Sequences (1:6) Aligned. Score:  20
-Sequences (1:7) Aligned. Score:  23
-Sequences (1:8) Aligned. Score:  18
-Sequences (1:9) Aligned. Score:  21
-Sequences (1:10) Aligned. Score:  16
-Sequences (1:11) Aligned. Score:  25
-Sequences (1:12) Aligned. Score:  10
-Sequences (2:3) Aligned. Score:  85
-Sequences (2:4) Aligned. Score:  86
-Sequences (2:5) Aligned. Score:  21
-Sequences (2:6) Aligned. Score:  20
-Sequences (2:7) Aligned. Score:  25
-Sequences (2:8) Aligned. Score:  20
-Sequences (2:9) Aligned. Score:  36
-Sequences (2:10) Aligned. Score:  16
-Sequences (2:11) Aligned. Score:  22
-Sequences (2:12) Aligned. Score:  17
-Sequences (3:4) Aligned. Score:  85
-Sequences (3:5) Aligned. Score:  13
-Sequences (3:6) Aligned. Score:  20
-Sequences (3:7) Aligned. Score:  25
-Sequences (3:8) Aligned. Score:  20
-Sequences (3:9) Aligned. Score:  36
-Sequences (3:10) Aligned. Score:  16
-Sequences (3:11) Aligned. Score:  18
-Sequences (3:12) Aligned. Score:  25
-Sequences (4:5) Aligned. Score:  13
-Sequences (4:6) Aligned. Score:  11
-Sequences (4:7) Aligned. Score:  20
-Sequences (4:8) Aligned. Score:  10
-Sequences (4:9) Aligned. Score:  31
-Sequences (4:10) Aligned. Score:  17
-Sequences (4:11) Aligned. Score:  29
-Sequences (4:12) Aligned. Score:  14
-Sequences (5:6) Aligned. Score:  73
-Sequences (5:7) Aligned. Score:  83
-Sequences (5:8) Aligned. Score:  80
-Sequences (5:9) Aligned. Score:  31
-Sequences (5:10) Aligned. Score:  14
-Sequences (5:11) Aligned. Score:  14
-Sequences (5:12) Aligned. Score:  12
-Sequences (6:7) Aligned. Score:  80
-Sequences (6:8) Aligned. Score:  88
-Sequences (6:9) Aligned. Score:  26
-Sequences (6:10) Aligned. Score:  16
-Sequences (6:11) Aligned. Score:  25
-Sequences (6:12) Aligned. Score:  12
-Sequences (7:8) Aligned. Score:  78
-Sequences (7:9) Aligned. Score:  31
-Sequences (7:10) Aligned. Score:  10
-Sequences (7:11) Aligned. Score:  12
-Sequences (7:12) Aligned. Score:  12
-Sequences (8:9) Aligned. Score:  31
-Sequences (8:10) Aligned. Score:  10
-Sequences (8:11) Aligned. Score:  14
-Sequences (8:12) Aligned. Score:  12
-Sequences (9:10) Aligned. Score:  63
-Sequences (9:11) Aligned. Score:  84
-Sequences (9:12) Aligned. Score:  78
-Sequences (10:11) Aligned. Score:  64
-Sequences (10:12) Aligned. Score:  76
-Sequences (11:12) Aligned. Score:  46
-Guide tree file created:   [/share/shared/galaxy/database/files/002/dataset_2705.dnd]
-
-There are 11 groups
-Start of Multiple Alignment
-
-Aligning...
-Group 1: Sequences:   2      Score:1045
-Group 2: Sequences:   2      Score:1016
-Group 3: Sequences:   4      Score:1001
-Group 4: Sequences:   2      Score:313
-Group 5: Sequences:   2      Score:731
-Group 6: Sequences:   4      Score:516
-Group 7: Sequences:   8      Score:344
-Group 8: Sequences:   2      Score:1016
-Group 9: Sequences:   2      Score:1054
-Group 10: Sequences:   4      Score:945
-Group 11: Sequences:  12      Score:380
-Alignment Score 6283
-firstres = 1 lastres = 63
-FASTA file created!
-
-Fasta-Alignment file created    [/share/shared/galaxy/database/files/002/dataset_2726.dat]
-
--- a/rgclustal/rgClustalw.xml	Tue Jun 07 16:14:32 2011 -0400
+++ b/rgclustal/rgClustalw.xml	Wed Jul 10 20:38:37 2013 -0400
@@ -1,7 +1,10 @@
 <tool id="clustalw" name="ClustalW" version="0.1">
    <description>multiple sequence alignment program for DNA or proteins</description>
+   <requirements>
+      <requirement type="package" version="2.1">package_clustalw</requirement>
+  </requirements>
    <command> 
-    #if   ($range.mode=="part")
+    #if ($range.mode=="part")
     clustalw2 -infile=$input -outfile=$output -OUTORDER=$out_order -RANGE=$range.seq_range_start,$range.seq_range_end
     #elif ($range.mode=="complete")
     clustalw2 -infile=$input -outfile=$output -OUTORDER=$out_order 
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/rgclustal/test-data/rgClustal_testin.fasta	Wed Jul 10 20:38:37 2013 -0400
@@ -0,0 +1,25 @@
+>c_briggsae-chrII(+)/43862-46313
+ATGAGCTTCCACAAAAGCATGAGCTTTCTCAGCTTCTGCCACATCAGCATTCAAATGATC
+>c_remanei-Crem_Contig172(-)/123228-124941
+ATGAGCCTCTACAACCGCATGATTCTTTTCAGCCTCTGCCACGTCCGCATTCAAATGCTC
+>c_brenneri-Cbre_Contig60(+)/627772-630087
+ATGAGCCTCCACAACAGCATGATTTTTCTCGGCTTCCGCCACATCCGCATTCAAATGATC
+>c_elegans-II(+)/9706834-9708803
+ATGAGCCTCTACTACAGCATGATTCTTCTCAGCTTCTGCAACGTCAGCATTCAGATGATC
+>c_briggsae-chrIfooI(+)/43862-46313
+CGCACAAATATGATGCACAAATCCACAACCTAAAGCATCTCCGATAACGTTGACCGAAGT
+>c_remanei-Crem_Contig172foo(-)/123228-124941
+AGCACAAATGTAATGAACGAATCCGCATCCCAACGCATCGCCAATCACATTCACAGATGT
+>c_brenneri-Cbre_Contig60gak(+)/627772-630087
+CGCACAAATGTAGTGGACAAATCCGCATCCCAAAGCGTCTCCGATAACATTTACCGAAGT
+>c_elegans-II(+)more/9706834-9708803
+TGCACAAATGTGATGAACGAATCCACATCCCAATGCATCACCGATCACATTGACAGATGT
+>c_briggsae-chrII(+)bar/43862-46313
+CCGGAGTCGATCCCTGAAT-----------------------------------------
+>c_remanei-Crem_Contig172zot(-)/123228-124941
+ACGAAGTCGGTCCCTATAAGGTATGATTTTATATGA----TGTACCATAAGGAAATAGTC
+>c_brenneri-Cbre_Contig60fee(+)/627772-630087
+ACGAAGTCGATCCCTGAAA---------TCAGATGAGCGGTTGACCA---GAGAACAACC
+>c_elegans-II(+)meh/9706834-9708803
+ACGAAGTCGGTCCCTGAAC--AATTATTT----TGA----TATA---GAAAGAAACGGTA
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/rgclustal/test-data/rgClustal_testout.fasta	Wed Jul 10 20:38:37 2013 -0400
@@ -0,0 +1,48 @@
+>c_briggsae-chrII_+_
+---ATGAGCTTCCACAAAAGCATGAGCTTT
+CTCAGCTTCTGCCACATCAGCATTCAAATG
+ATC
+>c_brenneri-Cbre_Contig60_+_
+---ATGAGCCTCCACAACAGCATGATTTTT
+CTCGGCTTCCGCCACATCCGCATTCAAATG
+ATC
+>c_remanei-Crem_Contig172_-_
+---ATGAGCCTCTACAACCGCATGATTCTT
+TTCAGCCTCTGCCACGTCCGCATTCAAATG
+CTC
+>c_elegans-II_+_
+---ATGAGCCTCTACTACAGCATGATTCTT
+CTCAGCTTCTGCAACGTCAGCATTCAGATG
+ATC
+>c_briggsae-chrII_+_bar
+---CCGGAGTCGATCCCTGAAT--------
+------------------------------
+---
+>c_brenneri-Cbre_Contig60fee_+_
+---ACGAAGTCGATCCCTGAAA--------
+-TCAGATGAGCGGTTGACCA---GAGAACA
+ACC
+>c_remanei-Crem_Contig172zot_-_
+---ACGAAGTCGGTCCCTATAAGGTATGAT
+TTTATATGA----TGTACCATAAGGAAATA
+GTC
+>c_elegans-II_+_meh
+---ACGAAGTCGGTCCCTGAAC--AATTAT
+TT----TGA----TATA---GAAAGAAACG
+GTA
+>c_briggsae-chrIfooI_+_
+CGCACAAATATGATGCACAAATCCACAACC
+TAAAGCATCTCCGATAACGTTGACCGAAGT
+---
+>c_brenneri-Cbre_Contig60gak_+_
+CGCACAAATGTAGTGGACAAATCCGCATCC
+CAAAGCGTCTCCGATAACATTTACCGAAGT
+---
+>c_remanei-Crem_Contig172foo_-_
+AGCACAAATGTAATGAACGAATCCGCATCC
+CAACGCATCGCCAATCACATTCACAGATGT
+---
+>c_elegans-II_+_more
+TGCACAAATGTGATGAACGAATCCACATCC
+CAATGCATCACCGATCACATTGACAGATGT
+---
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/rgclustal/test-data/rgClustal_testout.log	Wed Jul 10 20:38:37 2013 -0400
@@ -0,0 +1,112 @@
+
+
+
+ CLUSTAL 2.1 Multiple Sequence Alignments
+
+
+Sequence type explicitly set to DNA
+Sequence format is Pearson
+Sequence 1: c_briggsae-chrII_+_/43862-46313                 60 bp
+Sequence 2: c_remanei-Crem_Contig172_-_/123228-124941       60 bp
+Sequence 3: c_brenneri-Cbre_Contig60_+_/627772-630087       60 bp
+Sequence 4: c_elegans-II_+_/9706834-9708803                 60 bp
+Sequence 5: c_briggsae-chrIfooI_+_/43862-46313              60 bp
+Sequence 6: c_remanei-Crem_Contig172foo_-_/123228-124941    60 bp
+Sequence 7: c_brenneri-Cbre_Contig60gak_+_/627772-630087    60 bp
+Sequence 8: c_elegans-II_+_more/9706834-9708803             60 bp
+Sequence 9: c_briggsae-chrII_+_bar/43862-46313              60 bp
+Sequence 10: c_remanei-Crem_Contig172zot_-_/123228-124941    60 bp
+Sequence 11: c_brenneri-Cbre_Contig60fee_+_/627772-630087    60 bp
+Sequence 12: c_elegans-II_+_meh/9706834-9708803              60 bp
+Start of Pairwise alignments
+Aligning...
+
+Sequences (1:2) Aligned. Score:  80
+Sequences (1:3) Aligned. Score:  88
+Sequences (1:4) Aligned. Score:  83
+Sequences (1:5) Aligned. Score:  21
+Sequences (1:6) Aligned. Score:  20
+Sequences (1:7) Aligned. Score:  23
+Sequences (1:8) Aligned. Score:  18
+Sequences (1:9) Aligned. Score:  21
+Sequences (1:10) Aligned. Score:  16
+Sequences (1:11) Aligned. Score:  25
+Sequences (1:12) Aligned. Score:  10
+Sequences (2:3) Aligned. Score:  85
+Sequences (2:4) Aligned. Score:  86
+Sequences (2:5) Aligned. Score:  21
+Sequences (2:6) Aligned. Score:  20
+Sequences (2:7) Aligned. Score:  25
+Sequences (2:8) Aligned. Score:  20
+Sequences (2:9) Aligned. Score:  36
+Sequences (2:10) Aligned. Score:  16
+Sequences (2:11) Aligned. Score:  22
+Sequences (2:12) Aligned. Score:  17
+Sequences (3:4) Aligned. Score:  85
+Sequences (3:5) Aligned. Score:  13
+Sequences (3:6) Aligned. Score:  20
+Sequences (3:7) Aligned. Score:  25
+Sequences (3:8) Aligned. Score:  20
+Sequences (3:9) Aligned. Score:  36
+Sequences (3:10) Aligned. Score:  16
+Sequences (3:11) Aligned. Score:  18
+Sequences (3:12) Aligned. Score:  25
+Sequences (4:5) Aligned. Score:  13
+Sequences (4:6) Aligned. Score:  11
+Sequences (4:7) Aligned. Score:  20
+Sequences (4:8) Aligned. Score:  10
+Sequences (4:9) Aligned. Score:  31
+Sequences (4:10) Aligned. Score:  17
+Sequences (4:11) Aligned. Score:  29
+Sequences (4:12) Aligned. Score:  14
+Sequences (5:6) Aligned. Score:  73
+Sequences (5:7) Aligned. Score:  83
+Sequences (5:8) Aligned. Score:  80
+Sequences (5:9) Aligned. Score:  31
+Sequences (5:10) Aligned. Score:  14
+Sequences (5:11) Aligned. Score:  14
+Sequences (5:12) Aligned. Score:  12
+Sequences (6:7) Aligned. Score:  80
+Sequences (6:8) Aligned. Score:  88
+Sequences (6:9) Aligned. Score:  26
+Sequences (6:10) Aligned. Score:  16
+Sequences (6:11) Aligned. Score:  25
+Sequences (6:12) Aligned. Score:  12
+Sequences (7:8) Aligned. Score:  78
+Sequences (7:9) Aligned. Score:  31
+Sequences (7:10) Aligned. Score:  10
+Sequences (7:11) Aligned. Score:  12
+Sequences (7:12) Aligned. Score:  12
+Sequences (8:9) Aligned. Score:  31
+Sequences (8:10) Aligned. Score:  10
+Sequences (8:11) Aligned. Score:  14
+Sequences (8:12) Aligned. Score:  12
+Sequences (9:10) Aligned. Score:  63
+Sequences (9:11) Aligned. Score:  84
+Sequences (9:12) Aligned. Score:  78
+Sequences (10:11) Aligned. Score:  64
+Sequences (10:12) Aligned. Score:  76
+Sequences (11:12) Aligned. Score:  46
+Guide tree file created:   [/share/shared/galaxy/database/files/002/dataset_2705.dnd]
+
+There are 11 groups
+Start of Multiple Alignment
+
+Aligning...
+Group 1: Sequences:   2      Score:1045
+Group 2: Sequences:   2      Score:1016
+Group 3: Sequences:   4      Score:1001
+Group 4: Sequences:   2      Score:313
+Group 5: Sequences:   2      Score:731
+Group 6: Sequences:   4      Score:516
+Group 7: Sequences:   8      Score:344
+Group 8: Sequences:   2      Score:1016
+Group 9: Sequences:   2      Score:1054
+Group 10: Sequences:   4      Score:945
+Group 11: Sequences:  12      Score:380
+Alignment Score 6283
+firstres = 1 lastres = 63
+FASTA file created!
+
+Fasta-Alignment file created    [/share/shared/galaxy/database/files/002/dataset_2726.dat]
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/rgclustal/tool_dependencies.xml	Wed Jul 10 20:38:37 2013 -0400
@@ -0,0 +1,19 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<tool_dependency>
+    <package name="package_clustalw" version="2.1">
+        <install version="1.0"> 
+           <actions>
+                <action type="make_directory">$INSTALL_DIR</action>
+                <action type="download_by_url">http://www.clustal.org/download/current/clustalw-2.1.tar.gz</action>
+                <action type="shell_command">./configure --prefix=$INSTALL_DIR &amp;&amp; make &amp;&amp; cp $INSTALL_DIR/src/clustalw $INSTALL_DIR</action>
+                <action type="set_environment">
+                    <environment_variable action="prepend_to" name="PATH">$INSTALL_DIR</environment_variable>
+                </action>
+           </actions>
+        </install>
+        <readme>Installs clustalw from http://www.clustal.org/download/current/clustalw-2.1.tar.gz
+       </readme>
+    </package>
+</tool_dependency>
+
+