Mercurial > repos > erinija > plot_selected
view dnp-subset-dinuc-profile.sh @ 0:448204d12325 draft default tip
"planemo upload commit 1a32efb8343938e8d49190003f251c78b5a58225-dirty"
| author | erinija |
|---|---|
| date | Fri, 01 May 2020 12:13:00 +0000 |
| parents | |
| children |
line wrap: on
line source
#!/bin/sh if test "$#" -ne 3; then echo " CALL " echo " sh subset_dinuc_profile.sh input.fasta dinucleotides output" echo "" echo " INPUT" echo " input.fasta - a batch of nucleosome (or any DNA) DNA sequences " echo " dinucleotides - any subset of dinucleotides enclosed by quotes as 'AA AC AG AT CA CC' " echo "" echo " OUTPUT" echo " output - file name to write the output in tabular format, columns have names as AA.f AA.r ..." echo "" echo " DESCRIPTION" echo " Compute dinucleotide frequency profiles on forward and its complementary " echo " sequences from a batch of fasta sequences. Output columns are labelled by AA.f, AA.r ... " echo "" echo " Example of input fasta lines" echo " >chr9:42475963-42476182" echo " CCAGGCAGACCCCATATTCAAGCTGCTGCCCCAGGGTGGTGTACAGATCTGGGGAGAAGAAGGATGA" echo " >chr9:42476175-42476394" echo " TCTGCACTCCAGCATGCCTGAGGAGAGGAGGGAATGCAGGATCCTAGTGGAAAGAGTACCAAGCTGG" echo "" echo " Example of output table" echo " AA.f AA.r AC.f AC.r ..." echo " 0.076000 0.059000 0.065000 0.078000 ..." echo " 0.082000 0.060000 0.057000 0.076000 ..." echo " 0.067000 0.075000 0.049000 0.071000 ..." echo "" echo "" echo " REQUIREMENT" echo " dnp-diprofile installed" echo " conda install -c bioconda dnp-diprofile" exit 0 fi name=$1 diset=$2 out=$3 call=dnp-diprofile ## the dinucleotide profiles are computed for the subset of dinucleotides listed in $diset ## the profiles are outputs as columns of a table # prepare fasta, we copy here because # in galaxy we don't have fa ending which is required by the dinuc cp ${name} ${name}.fa # compute length of the fasta sequence seq=`head -n2 $name | tail -n1` len=${#seq} #echo "Sequence length = " $len # for each dinucleotide compute the forward # and complementary profile and save # in separate columns that will be merged in the end for di in ${diset} do #echo ${di} echo ${di}.f > ${di}.f ${call} ${name}.fa -di ${di} -sl ${len} >> ${di}.f echo ${di}.r > ${di}.r ${call} ${name}.fa -di ${di} -sl ${len} -c >> ${di}.r echo ${di}.f >> names echo ${di}.r >> names done; paste `cat names` > ${out} rm names rm ${name}.fa rm *.f *.r exit 0
