Mercurial > repos > erinija > dnp_binary_strings
diff dnp-subset-dinuc-profile.sh @ 0:611156829647 draft default tip
"planemo upload commit 1a32efb8343938e8d49190003f251c78b5a58225-dirty"
| author | erinija |
|---|---|
| date | Fri, 01 May 2020 12:07:46 +0000 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/dnp-subset-dinuc-profile.sh Fri May 01 12:07:46 2020 +0000 @@ -0,0 +1,74 @@ +#!/bin/sh +if test "$#" -ne 3; then + +echo " CALL " +echo " sh subset_dinuc_profile.sh input.fasta dinucleotides output" +echo "" +echo " INPUT" +echo " input.fasta - a batch of nucleosome (or any DNA) DNA sequences " +echo " dinucleotides - any subset of dinucleotides enclosed by quotes as 'AA AC AG AT CA CC' " +echo "" +echo " OUTPUT" +echo " output - file name to write the output in tabular format, columns have names as AA.f AA.r ..." +echo "" +echo " DESCRIPTION" +echo " Compute dinucleotide frequency profiles on forward and its complementary " +echo " sequences from a batch of fasta sequences. Output columns are labelled by AA.f, AA.r ... " +echo "" +echo " Example of input fasta lines" +echo " >chr9:42475963-42476182" +echo " CCAGGCAGACCCCATATTCAAGCTGCTGCCCCAGGGTGGTGTACAGATCTGGGGAGAAGAAGGATGA" +echo " >chr9:42476175-42476394" +echo " TCTGCACTCCAGCATGCCTGAGGAGAGGAGGGAATGCAGGATCCTAGTGGAAAGAGTACCAAGCTGG" +echo "" +echo " Example of output table" +echo " AA.f AA.r AC.f AC.r ..." +echo " 0.076000 0.059000 0.065000 0.078000 ..." +echo " 0.082000 0.060000 0.057000 0.076000 ..." +echo " 0.067000 0.075000 0.049000 0.071000 ..." +echo "" +echo "" +echo " REQUIREMENT" +echo " dnp-diprofile installed" +echo " conda install -c bioconda dnp-diprofile" + + exit 0 +fi + +name=$1 +diset=$2 +out=$3 + +call=dnp-diprofile + +## the dinucleotide profiles are computed for the subset of dinucleotides listed in $diset +## the profiles are outputs as columns of a table + +# prepare fasta, we copy here because +# in galaxy we don't have fa ending which is required by the dinuc +cp ${name} ${name}.fa + +# compute length of the fasta sequence +seq=`head -n2 $name | tail -n1` +len=${#seq} +#echo "Sequence length = " $len + + +# for each dinucleotide compute the forward +# and complementary profile and save +# in separate columns that will be merged in the end +for di in ${diset} +do + #echo ${di} + echo ${di}.f > ${di}.f + ${call} ${name}.fa -di ${di} -sl ${len} >> ${di}.f + echo ${di}.r > ${di}.r + ${call} ${name}.fa -di ${di} -sl ${len} -c >> ${di}.r + echo ${di}.f >> names + echo ${di}.r >> names +done; +paste `cat names` > ${out} +rm names +rm ${name}.fa +rm *.f *.r +exit 0
