Mercurial > repos > eric-rasche > circos
view test-data/1/1.gff3 @ 8:eb3af6e9f633 draft
planemo upload for repository https://github.com/TAMU-CPT/galaxy-circos-tool commit 3ac672baa4a93250828fd4a450cb5689b0b03474
| author | eric-rasche |
|---|---|
| date | Sat, 10 Jun 2017 16:21:01 -0400 |
| parents | e8475d0195fe |
| children | e6440d0201f7 |
line wrap: on
line source
##gff-version 3 # Note: See http://song.sourceforge.net ctgA example contig 1 50001 . . . Name=ctgA ctgA example remark 1659 1984 1110 + . Name=f07;Note=This is an example ctgA example remark 3014 6130 999 + . Name=f06;Note=This is another example ctgA example remark 4715 5968 444 - . Name=f05;Note=Ok! Ok! I get the message. ctgA example remark 13280 16394 203 + . Name=f08 ctgA example remark 15329 15533 1000 + . Name=f10 ctgA example remark 19157 22915 100 - . Name=f13 ctgA example remark 22132 24633 320 + . Name=f15 ctgA example remark 23072 23185 850 + . Name=f14 ctgA example remark 24562 28338 208 + . Name=f02 ctgA example remark 36034 38167 100 + . Name=f09 ctgA example remark 36649 40440 300 - . Name=f03 ctgA example remark 37242 38653 10 + . Name=f04 ctgA example remark 44705 47713 400 - . Name=f01 ctgA example remark 46990 48410 100 - . Name=f11 ctgA example remark 49758 50000 3040 - . Name=f12 ctgA example SNP 1000 1000 0.987 . . ID=FakeSNP1;Name=FakeSNP;Note=This is a fake SNP that should appear at 1000 with length 1 ctgA example remark 1000 2000 . . . Name=Remark:hga;Alias=hga ctgA example protein_coding_primary_transcript 1100 2000 . + . Name=Gene:hga;Alias=hga ctgA example polypeptide 1200 1900 . + . Name=Protein:HGA;Alias=hga ctgA example protein_coding_primary_transcript 1600 3000 . - . Name=Gene:hgb;Alias=hgb ctgA example polypeptide 1800 2900 . - . Name=Protein:HGB;Alias=hgb ctgA example polypeptide_domain 11911 15561 . + . Name=m11;Note=kinase ctgA example polypeptide_domain 13801 14007 . - . Name=m05;Note=helix loop helix ctgA example polypeptide_domain 14731 17239 . - . Name=m14;Note=kinase ctgA example polypeptide_domain 15396 16159 . + . Name=m03;Note=zinc finger ctgA example polypeptide_domain 17023 17675 . + . Name=m08;Note=7-transmembrane ctgA example polypeptide_domain 17667 17690 . + . Name=m13;Note=DEAD box ctgA example polypeptide_domain 18048 18552 . - . Name=m07;Note=7-transmembrane ctgA example polypeptide_domain 21748 25612 . + . Name=m12;Note=kinase ctgA example polypeptide_domain 28332 30033 . - . Name=m02;Note=HOX ctgA example polypeptide_domain 28342 28447 . - . Name=m10;Note=DEAD box ctgA example polypeptide_domain 30578 31748 . + . Name=m06;Note=SUSHI repeat ctgA example polypeptide_domain 33325 35791 . + . Name=m04;Note=Ig-like ctgA example polypeptide_domain 37497 40559 . - . Name=m15;Note=7-transmembrane ctgA example polypeptide_domain 46012 48851 . + . Name=m09;Note=kinase ctgA example polypeptide_domain 48253 48366 . + . Name=m01;Note=WD40 ctgA example match 32329 32359 . + . Name=seg01 ctgA example match 26122 26126 . + . Name=seg02 ctgA example match 26497 26869 . + . Name=seg02 ctgA example match 27201 27325 . + . Name=seg02 ctgA example match 27372 27433 . + . Name=seg02 ctgA example match 27565 27565 . + . Name=seg02 ctgA example match 27813 28091 . + . Name=seg02 ctgA example match 28093 28201 . + . Name=seg02 ctgA example match 28329 28377 . + . Name=seg02 ctgA example match 28829 29194 . + . Name=seg02 ctgA example match 29517 29702 . + . Name=seg02 ctgA example match 29713 30061 . + . Name=seg02 ctgA example match 30329 30774 . + . Name=seg02 ctgA example match 30808 31306 . + . Name=seg02 ctgA example match 31516 31729 . + . Name=seg02 ctgA example match 31753 32154 . + . Name=seg02 ctgA example match 32595 32696 . + . Name=seg02 ctgA example match 32892 32901 . + . Name=seg02 ctgA example match 33127 33388 . + . Name=seg02 ctgA example match 33439 33443 . + . Name=seg02 ctgA example match 33759 34209 . + . Name=seg02 ctgA example match 34401 34466 . + . Name=seg02 ctgA example match 6885 7241 . - . Name=seg03 ctgA example match 7410 7737 . - . Name=seg03 ctgA example match 8055 8080 . - . Name=seg03 ctgA example match 8306 8999 . - . Name=seg03 ctgA example match 5233 5302 . - . Name=seg04 ctgA example match 5800 6101 . - . Name=seg04 ctgA example match 6442 6854 . - . Name=seg04 ctgA example match 7106 7211 . - . Name=seg04 ctgA example match 7695 8177 . - . Name=seg04 ctgA example match 8545 8783 . - . Name=seg04 ctgA example match 8869 8935 . - . Name=seg04 ctgA example match 9404 9825 . - . Name=seg04 ctgA example match 26503 26799 . - . Name=seg05 ctgA example match 27172 27185 . - . Name=seg05 ctgA example match 27448 27860 . - . Name=seg05 ctgA example match 27887 28076 . - . Name=seg05 ctgA example match 28225 28316 . - . Name=seg05 ctgA example match 28777 29058 . - . Name=seg05 ctgA example match 29513 29647 . - . Name=seg05 ctgA example match 30108 30216 . - . Name=seg05 ctgA example match 30465 30798 . - . Name=seg05 ctgA example match 31232 31236 . - . Name=seg05 ctgA example match 31421 31817 . - . Name=seg05 ctgA example match 32010 32057 . - . Name=seg05 ctgA example match 32208 32680 . - . Name=seg05 ctgA example match 33053 33325 . - . Name=seg05 ctgA example match 33438 33868 . - . Name=seg05 ctgA example match 34244 34313 . - . Name=seg05 ctgA example match 34605 34983 . - . Name=seg05 ctgA example match 35333 35507 . - . Name=seg05 ctgA example match 35642 35904 . - . Name=seg05 ctgA example match 19249 19559 . + . Name=seg06 ctgA example match 19975 20260 . + . Name=seg06 ctgA example match 20379 20491 . + . Name=seg06 ctgA example match 20533 21005 . + . Name=seg06 ctgA example match 21122 21331 . + . Name=seg06 ctgA example match 21682 22176 . + . Name=seg06 ctgA example match 22374 22570 . + . Name=seg06 ctgA example match 23025 23427 . + . Name=seg06 ctgA example match 44191 44514 . - . Name=seg07 ctgA example match 44552 45043 . - . Name=seg07 ctgA example match 45373 45600 . - . Name=seg07 ctgA example match 45897 46315 . - . Name=seg07 ctgA example match 46491 46890 . - . Name=seg07 ctgA example match 47126 47297 . - . Name=seg07 ctgA example match 47735 47983 . - . Name=seg07 ctgA example match 48447 48709 . - . Name=seg07 ctgA example match 48931 49186 . - . Name=seg07 ctgA example match 49472 49699 . - . Name=seg07 ctgA example match 49957 50000 . - . Name=seg07 ctgA example match 18509 18985 . + . Name=seg08 ctgA example match 18989 19388 . + . Name=seg08 ctgA example match 19496 19962 . + . Name=seg08 ctgA example match 20093 20580 . + . Name=seg08 ctgA example match 20970 21052 . + . Name=seg08 ctgA example match 21270 21277 . + . Name=seg08 ctgA example match 21685 22168 . + . Name=seg08 ctgA example match 22564 22869 . + . Name=seg08 ctgA example match 22958 23298 . + . Name=seg08 ctgA example match 23412 23469 . + . Name=seg08 ctgA example match 23932 23932 . + . Name=seg08 ctgA example match 24328 24787 . + . Name=seg08 ctgA example match 25228 25367 . + . Name=seg08 ctgA example match 36616 37057 . - . Name=seg09 ctgA example match 37208 37227 . - . Name=seg09 ctgA example match 29771 29942 . + . Name=seg10 ctgA example match 30042 30340 . + . Name=seg10 ctgA example match 30810 31307 . + . Name=seg10 ctgA example match 31761 31984 . + . Name=seg10 ctgA example match 32374 32937 . + . Name=seg10 ctgA example match 24228 24510 . + . Name=seg11 ctgA example match 24868 25012 . + . Name=seg11 ctgA example match 25212 25426 . + . Name=seg11 ctgA example match 25794 25874 . + . Name=seg11 ctgA example match 26075 26519 . + . Name=seg11 ctgA example match 26930 26940 . + . Name=seg11 ctgA example match 26975 27063 . + . Name=seg11 ctgA example match 27415 27799 . + . Name=seg11 ctgA example match 27880 27943 . + . Name=seg11 ctgA example match 28225 28346 . + . Name=seg11 ctgA example match 28375 28570 . + . Name=seg11 ctgA example match 28758 29041 . + . Name=seg11 ctgA example match 29101 29302 . + . Name=seg11 ctgA example match 29604 29702 . + . Name=seg11 ctgA example match 29867 29885 . + . Name=seg11 ctgA example match 30241 30246 . + . Name=seg11 ctgA example match 30575 30738 . + . Name=seg11 ctgA example match 12531 12895 . + . Name=seg12 ctgA example match 13122 13449 . + . Name=seg12 ctgA example match 13452 13745 . + . Name=seg12 ctgA example match 13908 13965 . + . Name=seg12 ctgA example match 13998 14488 . + . Name=seg12 ctgA example match 14564 14899 . + . Name=seg12 ctgA example match 15185 15276 . + . Name=seg12 ctgA example match 15639 15736 . + . Name=seg12 ctgA example match 15745 15870 . + . Name=seg12 ctgA example match 49406 49476 . + . Name=seg13 ctgA example match 49762 50000 . + . Name=seg13 ctgA example match 41137 41318 . - . Name=seg14 ctgA example match 41754 41948 . - . Name=seg14 ctgA example match 42057 42474 . - . Name=seg14 ctgA example match 42890 43270 . - . Name=seg14 ctgA example match 43395 43811 . - . Name=seg14 ctgA example match 44065 44556 . - . Name=seg14 ctgA example match 44763 45030 . - . Name=seg14 ctgA example match 45231 45488 . - . Name=seg14 ctgA example match 45790 46022 . - . Name=seg14 ctgA example match 46092 46318 . - . Name=seg14 ctgA example match 46816 46992 . - . Name=seg14 ctgA example match 47449 47829 . - . Name=seg14 ctgA example match 39265 39361 . - . Name=seg15 ctgA example match 39753 40034 . - . Name=seg15 ctgA example match 40515 40954 . - . Name=seg15 ctgA example match 41252 41365 . - . Name=seg15 ctgA example match 41492 41504 . - . Name=seg15 ctgA example match 41941 42377 . - . Name=seg15 ctgA example match 42748 42954 . - . Name=seg15 ctgA example match 43401 43897 . - . Name=seg15 ctgA example match 44043 44113 . - . Name=seg15 ctgA example match 44399 44888 . - . Name=seg15 ctgA example match 45281 45375 . - . Name=seg15 ctgA example match 45711 46041 . - . Name=seg15 ctgA example match 46425 46564 . - . Name=seg15 ctgA example match 46738 47087 . - . Name=seg15 ctgA example match 47329 47595 . - . Name=seg15 ctgA example match 47858 47979 . - . Name=seg15 ctgA example match 48169 48453 . - . Name=seg15 # single exon gene - one CDS only ctgA bare_predicted CDS 10000 11500 . + 0 Name=Apple1;Note=CDS with no parent # multi-exon gene - several linked CDSs ctgA predicted mRNA 13000 17200 . + 0 ID=cds-Apple2;Name=Apple2;Note=mRNA with CDSs but no UTRs ctgA predicted CDS 13500 13800 . + 0 Parent=cds-Apple2 ctgA predicted CDS 15000 15500 . + 1 Parent=cds-Apple2 ctgA predicted CDS 16500 17000 . + 2 Parent=cds-Apple2 ctgA exonerate mRNA 17400 23000 . + . ID=rna-Apple3;Name=Apple3;Note=mRNA with both CDSs and UTRs ctgA exonerate UTR 17400 17999 . + . Parent=rna-Apple3 ctgA exonerate CDS 18000 18800 . + 0 Parent=rna-Apple3 ctgA exonerate CDS 19000 19500 . + 1 Parent=rna-Apple3 ctgA exonerate CDS 21000 21200 . + 2 Parent=rna-Apple3 ctgA exonerate UTR 21201 23000 . + . Parent=rna-Apple3 ctgA example gene 1050 9000 . + . ID=EDEN;Name=EDEN;Note=protein kinase ctgA example mRNA 1050 9000 . + . ID=EDEN.1;Parent=EDEN;Name=EDEN.1;Note=Eden splice form 1;Index=1 ctgA example five_prime_UTR 1050 1200 . + . Parent=EDEN.1 ctgA example CDS 1201 1500 . + 0 Parent=EDEN.1 ctgA example CDS 3000 3902 . + 0 Parent=EDEN.1 ctgA example CDS 5000 5500 . + 0 Parent=EDEN.1 ctgA example CDS 7000 7608 . + 0 Parent=EDEN.1 ctgA example three_prime_UTR 7609 9000 . + . Parent=EDEN.1 ctgA example mRNA 1050 9000 . + . ID=EDEN.2;Parent=EDEN;Name=EDEN.2;Note=Eden splice form 2;Index=1 ctgA example five_prime_UTR 1050 1200 . + . Parent=EDEN.2 ctgA example CDS 1201 1500 . + 0 Parent=EDEN.2 ctgA example CDS 5000 5500 . + 0 Parent=EDEN.2 ctgA example CDS 7000 7608 . + 0 Parent=EDEN.2 ctgA example three_prime_UTR 7609 9000 . + . Parent=EDEN.2 ctgA example mRNA 1300 9000 . + . ID=EDEN.3;Parent=EDEN;Name=EDEN.3;Note=Eden splice form 3;Index=1 ctgA example five_prime_UTR 1300 1500 . + . Parent=EDEN.3 ctgA example five_prime_UTR 3000 3300 . + . Parent=EDEN.3 ctgA example CDS 3301 3902 . + 0 Parent=EDEN.3 ctgA example CDS 5000 5500 . + 1 Parent=EDEN.3 ctgA example CDS 7000 7600 . + 1 Parent=EDEN.3 ctgA example three_prime_UTR 7601 9000 . + . Parent=EDEN.3 ctgA example BAC 1000 20000 . . . ID=b101.2;Name=b101.2;Note=Fingerprinted BAC with end reads ctgA example clone_start 1000 1500 . + . Parent=b101.2 ctgA example clone_end 19500 20000 . - . Parent=b101.2 ctgA est EST_match 1050 3202 . + . ID=Match1;Name=agt830.5;Target=agt830.5 1 654 ctgA est match_part 1050 1500 . + . Parent=Match1;Name=agt830.5;Target=agt830.5 1 451 ctgA est match_part 3000 3202 . + . Parent=Match1;Name=agt830.5;Target=agt830.5 452 654 ctgA est EST_match 5410 7503 . - . ID=Match2;Name=agt830.3;Target=agt830.3 1 595 ctgA est match_part 5410 5500 . - . Parent=Match2;Name=agt830.3;Target=agt830.3 505 595 ctgA est match_part 7000 7503 . - . Parent=Match2;Name=agt830.3;Target=agt830.3 1 504 ctgA est EST_match 1050 7300 . + . ID=Match3;Name=agt221.5;Target=agt221.5 1 1253 ctgA est match_part 1050 1500 . + . Parent=Match3;Name=agt221.5;Target=agt221.5 1 451 ctgA est match_part 5000 5500 . + . Parent=Match3;Name=agt221.5;Target=agt221.5 452 952 ctgA est match_part 7000 7300 . + . Parent=Match3;Name=agt221.5;Target=agt221.5 953 1253 ctgA est EST_match 7500 8000 . - . ID=Match4;Name=agt221.3;Target=agt221.3 1 501 ctgA est EST_match 1150 7200 . + . ID=Match5;Name=agt767.5;Target=agt767.5 1 1153 ctgA est match_part 1150 1500 . + . Parent=Match5;Name=agt767.5;Target=agt767.5 1 351 ctgA est match_part 5000 5500 . + . Parent=Match5;Name=agt767.5;Target=agt767.5 352 852 ctgA est match_part 7000 7200 . + . Parent=Match5;Name=agt767.5;Target=agt767.5 853 1153 ctgA est EST_match 8000 9000 . - . ID=Match6;Name=agt767.3;Target=agt767.3 1 1001 ctgB example contig 1 6079 . . . Name=ctgB ctgB example remark 1659 1984 . + . Name=f07;Note=This is an example ctgB example remark 3014 6130 . + . Name=f06;Note=This is another example ctgB example remark 4715 5968 . - . Name=f05;Note=ああ、この機能は、世界中を旅しています! ##FASTA >foobar ACTGATGATCGCTAGATGCTCGACTAGC
