comparison YAC/yac.xml @ 5:ad813be00215 draft default tip

Uploaded

5:ad813be00215

 <tool id="yac" name="Clip adapter" version="1.0.0">
  <description></description>
  <command interpreter="python">yac.py $input $output $clip_source.clip_sequence $min $max $Nmode</command>
  <inputs>
    <param format="fastq" name="input" type="data" label="Source file"/>
    <param name="min" type="integer" size="4" value="15" label="min size"/>
    <param name="max" type="integer" size="4" value="36" label="max size"/>
    <param name="Nmode" type="select" label="Reads containing Nst">
        <option value="accept" selected="True">accept</option>
        <option value="reject">reject</option>
    </param>
    <conditional name="clip_source">
   	 <param name="clip_source_list" type="select" label="Source" help="Built-in adapters or User-provided">
         	<option value="prebuilt" selected="True">Use a built-in adapter (select from the list below)</option>
         	<option value="user">Use custom sequence</option>
         </param>
         <when value="prebuilt">
         	<param name="clip_sequence" type="select" label="Select Adapter to clip" help="if your adapter is not listed, input your own sequence">
                	<option value="TCGTATGCCGTCTTCTGCTTG">Solexa TCGTATGCCGTCTTCTGCTTG</option>
                        <option value="ATCTCGTATGCCGTCTTCTGCTT">Illumina ATCTCGTATGCCGTCTTCTGCTT</option>
                        <option value="TGGAATTCTCGGGTGCCAAG" selected="True">Illumina TruSeq  TGGAATTCTCGGGTGCCAAG</option>
                        <option value="CTGTAGGCACCATCAATCGT">IdT CTGTAGGCACCATCAATCGT</option>
		</param>
	</when>
        <when value="user">
		 <param name="clip_sequence" type="text" size="35"  label="Enter your Sequence" value="GAATCC"/>
	</when>
    </conditional>
  </inputs>
  <outputs>
    <data format="fasta" name="output"  metadata="input" />
  </outputs>

  <help>
<!-- write a decent doc ! -->
This tool clips adapter sequences from a fastq file and fasta file of clipped reads with renumbered fasta headers.

Clipped sequences with Ns can be discarded.

Min size and max size filter clipped reads on their size.

Note that unclipped reads that satisfy the min and max size conditions are kept.
  </help>

<!-- write a <test> section -->
	<tests>
                <test>
                        <param name="input" value="yac.fastq" ftype="fastqsanger"/>
                        <param name="min" value="18" />
                        <param name="max" value="29" />
                        <param name="clip_source_list" value="prebuilt" />
                        <param name="clip_sequence" value="ATCTCGTATGCCGTCTTCTGCTT" />
                        <param name="Nmode" value="accept" />
                        <output name="output" file="yac.out" />
                </test>
        </tests>

</tool>