# HG changeset patch
# User devteam
# Date 1390498259 18000
# Node ID f64b81fda06230b81c2971e8f9614e251f2d745e
Imported from capsule None
diff -r 000000000000 -r f64b81fda062 rgWebLogo3.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/rgWebLogo3.py Thu Jan 23 12:30:59 2014 -0500
@@ -0,0 +1,157 @@
+"""
+# modified june 2 ross lazarus to add units option at Assaf Gordon's suggestion
+# rgWebLogo3.py
+# wrapper to check that all fasta files are same length
+
+"""
+import optparse, os, sys, subprocess, tempfile
+
+WEBLOGO = 'weblogo' # executable name for weblogo3 - confusing isn't it?
+
+class WL3:
+ """
+ simple wrapper class to check fasta sequence lengths are all identical
+ """
+ FASTASTARTSYM = '>'
+ badseq = '## error - sequences in file %s are not all the same length - cannot proceed. Please read the tool documentation carefully'
+
+ def __init__(self,opts=None):
+ assert opts<>None,'WL3 class needs opts passed in - got None'
+ self.opts = opts
+ self.fastaf = file(self.opts.input,'r')
+ self.clparams = {}
+
+ def whereis(self,program):
+ for path in os.environ.get('PATH', '').split(':'):
+ if os.path.exists(os.path.join(path, program)) and not os.path.isdir(os.path.join(path, program)):
+ return os.path.join(path, program)
+ return None
+
+ def runCL(self):
+ """ construct and run a command line
+ """
+ wl = self.whereis(WEBLOGO)
+ if not wl:
+ print >> sys.stderr, '## rgWebLogo3.py error - cannot locate the weblogo binary %s on the current path' % WEBLOGO
+ print >> sys.stderr, '## Please ensure it is installed and working from http://code.google.com/p/weblogo'
+ sys.exit(1)
+ cll = [WEBLOGO,]
+ cll += [' '.join(it) for it in list(self.clparams.items())]
+ cl = ' '.join(cll)
+ assert cl > '', 'runCL needs a command line as clparms'
+ fd,templog = tempfile.mkstemp(suffix='rgtempRun.txt')
+ tlf = open(templog,'w')
+ process = subprocess.Popen(cl, shell=True, stderr=tlf, stdout=tlf)
+ rval = process.wait()
+ tlf.close()
+ tlogs = ''.join(open(templog,'r').readlines())
+ if len(tlogs) > 1:
+ s = '## executing %s returned status %d and log (stdout/stderr) records: \n%s\n' % (cl,rval,tlogs)
+ else:
+ s = '## executing %s returned status %d. Nothing appeared on stderr/stdout\n' % (cl,rval)
+ os.unlink(templog) # always
+ if rval <> 0:
+ print >> sys.stderr, '## rgWebLogo3.py error - executing %s returned error code %d' % (cl,rval)
+ print >> sys.stderr, '## This may be a data problem or a tool dependency (%s) installation problem' % WEBLOGO
+ print >> sys.stderr, '## Please ensure %s is correctly installed and working on the command line -see http://code.google.com/p/weblogo' % WEBLOGO
+ sys.exit(1)
+ return s
+
+
+ def iter_fasta(self):
+ """
+ generator for fasta sequences from a file
+ """
+ aseq = []
+ seqname = None
+ for i,row in enumerate(self.fastaf):
+ if row.startswith(self.FASTASTARTSYM):
+ if seqname <> None: # already in a sequence
+ s = ''.join(aseq)
+ l = len(s)
+ yield (seqname,l)
+ seqname = row[1:].strip()
+ aseq = []
+ else:
+ if i > 0:
+ print >> sys.stderr,'Invalid fasta file %s - does not start with %s - please read the tool documentation carefully' % (self.opts.input,self.FASTASTARTSYM)
+ sys.exit(1)
+ else:
+ seqname = row[1:].strip()
+ else: # sequence row
+ if seqname == None:
+ print >> sys.stderr,'Invalid fasta file %s - does not start with %s - please read the tool documentation carefully' % (self.opts.input,self.FASTASTARTSYM)
+ sys.exit(1)
+ else:
+ aseq.append(row.strip())
+
+ if seqname <> None: # last one
+ l = len(''.join(aseq))
+ yield (seqname,l)
+
+
+ def fcheck(self):
+ """ are all fasta sequence same length?
+ might be mongo big
+ """
+ flen = None
+ lasti = None
+ f = self.iter_fasta()
+ for i,(seqname,seqlen) in enumerate(f):
+ lasti = i
+ if i == 0:
+ flen = seqlen
+ else:
+ if seqlen <> flen:
+ print >> sys.stderr,self.badseq % self.opts.input
+ sys.exit(1)
+ return '# weblogo input %s has %d sequences all of length %d' % (self.opts.input,lasti,flen)
+
+
+ def run(self):
+ check = self.fcheck()
+ self.clparams['-f'] = self.opts.input
+ self.clparams['-o'] = self.opts.output
+ self.clparams['-t'] = '"%s"' % self.opts.logoname # must be wrapped as a string
+ self.clparams['-F'] = self.opts.outformat
+ if self.opts.size <> None:
+ self.clparams['-s'] = self.opts.size
+ if self.opts.lower <> None:
+ self.clparams['-l'] = self.opts.lower
+ if self.opts.upper <> None:
+ self.clparams['-u'] = self.opts.upper
+ if self.opts.colours <> None:
+ self.clparams['-c'] = self.opts.colours
+ if self.opts.units <> None:
+ self.clparams['-U'] = self.opts.units
+ s = self.runCL()
+ return check,s
+
+
+if __name__ == '__main__':
+ '''
+ called as
+
+ rgWebLogo3.py --outformat $outformat -s $size -i $input -o $output -t "$logoname" -c "$colours"
+#if $range.mode == 'part'
+-l "$range.seqstart" -u "$range.seqend"
+#end if
+
+
+ '''
+ op = optparse.OptionParser()
+ op.add_option('-i', '--input', default=None)
+ op.add_option('-F', '--outformat', default='png')
+ op.add_option('-s', '--size', default=None)
+ op.add_option('-o', '--output', default='rgWebLogo3')
+ op.add_option('-t', '--logoname', default='rgWebLogo3')
+ op.add_option('-c', '--colours', default=None)
+ op.add_option('-l', '--lower', default=None)
+ op.add_option('-u', '--upper', default=None)
+ op.add_option('-U', '--units', default=None)
+ opts, args = op.parse_args()
+ assert opts.input <> None,'weblogo3 needs a -i parameter with a fasta input file - cannot open'
+ assert os.path.isfile(opts.input),'weblogo3 needs a valid fasta input file - cannot open %s' % opts.input
+ w = WL3(opts)
+ checks,s = w.run()
+ print >> sys.stdout, checks # for info
diff -r 000000000000 -r f64b81fda062 rgWebLogo3.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/rgWebLogo3.xml Thu Jan 23 12:30:59 2014 -0500
@@ -0,0 +1,141 @@
+
+ generator for fasta (eg Clustal alignments)
+
+ weblogo
+ ghostscript
+
+
+ rgWebLogo3.py -F $outformat -s $size -i $input -o $output -t "$logoname" -c "$colours" -U "$units"
+#if $range.mode == 'part'
+-l "$range.seqstart" -u "$range.seqend"
+#end if
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+**Note**
+
+This tool uses Weblogo3_ in Galaxy to generate a sequence logo. The input file must be a fasta file in your current history.
+
+It is recommended for (eg) viewing multiple sequence alignments output from the clustalw tool - set the output to fasta and feed
+it in to this tool.
+
+A typical output looks like this
+
+.. image:: ${static_path}/images/rgWebLogo3_test.jpg
+
+----
+
+**Warning about input Fasta format files**
+
+The Weblogo3 program used by this tool will fail if your fasta sequences are not all EXACTLY the same length. The tool will provide a warning
+and refuse to call the weblogo3 executable if irregular length sequences are detected.
+
+Fasta alignments from the companion ClustalW Galaxy tool will work but many other fasta files may cause this tool to fail - please do not file
+a Galaxy bug report - this is a feature of the tool and a problem with your source data - not a tool error - please make certain all your fasta
+sequences are the same length!
+
+----
+
+**Attribution**
+
+Weblogo attribution and associated documentation are available at Weblogo3_
+
+This Galaxy wrapper was written by Ross Lazarus for the rgenetics project and the source code is licensed under the LGPL_ like other rgenetics artefacts
+
+.. _Weblogo3: http://weblogo.berkeley.edu/
+
+.. _LGPL: http://www.gnu.org/copyleft/lesser.html
+
+
+
+
+
+
diff -r 000000000000 -r f64b81fda062 test-data/rgClustal_testout.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rgClustal_testout.fasta Thu Jan 23 12:30:59 2014 -0500
@@ -0,0 +1,48 @@
+>c_briggsae-chrII_+_
+---ATGAGCTTCCACAAAAGCATGAGCTTT
+CTCAGCTTCTGCCACATCAGCATTCAAATG
+ATC
+>c_brenneri-Cbre_Contig60_+_
+---ATGAGCCTCCACAACAGCATGATTTTT
+CTCGGCTTCCGCCACATCCGCATTCAAATG
+ATC
+>c_remanei-Crem_Contig172_-_
+---ATGAGCCTCTACAACCGCATGATTCTT
+TTCAGCCTCTGCCACGTCCGCATTCAAATG
+CTC
+>c_elegans-II_+_
+---ATGAGCCTCTACTACAGCATGATTCTT
+CTCAGCTTCTGCAACGTCAGCATTCAGATG
+ATC
+>c_briggsae-chrII_+_bar
+---CCGGAGTCGATCCCTGAAT--------
+------------------------------
+---
+>c_brenneri-Cbre_Contig60fee_+_
+---ACGAAGTCGATCCCTGAAA--------
+-TCAGATGAGCGGTTGACCA---GAGAACA
+ACC
+>c_remanei-Crem_Contig172zot_-_
+---ACGAAGTCGGTCCCTATAAGGTATGAT
+TTTATATGA----TGTACCATAAGGAAATA
+GTC
+>c_elegans-II_+_meh
+---ACGAAGTCGGTCCCTGAAC--AATTAT
+TT----TGA----TATA---GAAAGAAACG
+GTA
+>c_briggsae-chrIfooI_+_
+CGCACAAATATGATGCACAAATCCACAACC
+TAAAGCATCTCCGATAACGTTGACCGAAGT
+---
+>c_brenneri-Cbre_Contig60gak_+_
+CGCACAAATGTAGTGGACAAATCCGCATCC
+CAAAGCGTCTCCGATAACATTTACCGAAGT
+---
+>c_remanei-Crem_Contig172foo_-_
+AGCACAAATGTAATGAACGAATCCGCATCC
+CAACGCATCGCCAATCACATTCACAGATGT
+---
+>c_elegans-II_+_more
+TGCACAAATGTGATGAACGAATCCACATCC
+CAATGCATCACCGATCACATTGACAGATGT
+---
diff -r 000000000000 -r f64b81fda062 test-data/rgWebLogo3_test.jpg
Binary file test-data/rgWebLogo3_test.jpg has changed
diff -r 000000000000 -r f64b81fda062 test-data/rgWebLogo3_test2.png
Binary file test-data/rgWebLogo3_test2.png has changed
diff -r 000000000000 -r f64b81fda062 tool_dependencies.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml Thu Jan 23 12:30:59 2014 -0500
@@ -0,0 +1,9 @@
+
+
+
+
+
+
+
+
+