# HG changeset patch
# User devteam
# Date 1473969879 14400
# Node ID c3a5388628b510a39376adc8b951b8b1bc93636b
# Parent  15de96f45d4d144b589e4c654d3cf1bb5fc95598
planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/vcflib/vcfprimers commit 0b9b6512272b82637c2f1e831367e89aed77ae79

diff -r 15de96f45d4d -r c3a5388628b5 macros.xml
--- a/macros.xml	Thu Nov 12 10:01:54 2015 -0500
+++ b/macros.xml	Thu Sep 15 16:04:39 2016 -0400
@@ -1,7 +1,7 @@
 <macros>
     <xml name="requirements">
         <requirements>
-            <requirement type="package" version="8a5602bf07">vcflib</requirement>
+            <requirement type="package" version="1.0.0_rc1">vcflib</requirement>
             <yield/>
         </requirements>
     </xml>
@@ -10,6 +10,7 @@
             <exit_code range="1:" level="fatal" />
         </stdio>
     </xml>
+   <token name="@WRAPPER_VERSION@">1.0.0_rc1</token>
    	<xml name="citations">
    	     <citations>
              <citation type="bibtex">
diff -r 15de96f45d4d -r c3a5388628b5 tool_dependencies.xml
--- a/tool_dependencies.xml	Thu Nov 12 10:01:54 2015 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,6 +0,0 @@
-<?xml version="1.0"?>
-<tool_dependency>
-    <package name="vcflib" version="8a5602bf07">
-        <repository changeset_revision="3ac0905f7b7c" name="package_vcflib_8a5602bf07" owner="iuc" toolshed="https://testtoolshed.g2.bx.psu.edu" />
-    </package>
-</tool_dependency>
diff -r 15de96f45d4d -r c3a5388628b5 vcfprimers.xml
--- a/vcfprimers.xml	Thu Nov 12 10:01:54 2015 -0500
+++ b/vcfprimers.xml	Thu Sep 15 16:04:39 2016 -0400
@@ -1,67 +1,67 @@
-<tool id="vcfprimers" name="VCFprimers:" version="0.0.3">
-  <description>Extract flanking sequences for each VCF record</description>
-  <macros>
-    <import>macros.xml</import>
-  </macros>
-  <expand macro="requirements"></expand>
-  <expand macro="stdio"></expand>
-  <command>
-    #set $reference_fasta_filename = "localref.fa"
-    #if str( $reference_source.reference_source_selector ) == "history":
-       ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" &amp;&amp;
-    #else:
-       #set $reference_fasta_filename = str( $reference_source.ref_file.fields.path )
-    #end if    
-   vcfprimers -f "${reference_fasta_filename}" -l "${primer_length}" "${input_vcf}" > "${out_file1}"</command>
-  <inputs>
-<param name="input_vcf" type="data" format="vcf" label="VCF dataset to extract flanks" />
-    <conditional name="reference_source">
-       <param name="reference_source_selector" type="select" label="Choose the source for the reference genome">
-         <option value="cached">Locally cached</option>
-         <option value="history">History</option>
-       </param>
-       <when value="cached">
-         <param name="ref_file" type="select" label="Select reference genome">
-           <options from_data_table="fasta_indexes">
-           </options>
-	   <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
-         </param>
-       </when>
-       <when value="history"> <!-- FIX ME!!!! -->
-         <param name="ref_file" type="data" format="fasta" label="Using reference file" />
-       </when>
-     </conditional>
-     <param name="primer_length" type="integer" value="20" label="The length of the primer sequences on each side of the variant" help="default = 20 bp" />
-  </inputs>
-  <outputs>
-    <data format="fasta" name="out_file1" />
-  </outputs>
-  <tests>
-    <test>
-      <param name="reference_source_selector" value="history" />
-      <param name="input_vcf" value="vcflib-phix.vcf"/>
-      <param name="ref_file" value="vcflib-test-genome-phix.fa" />
-      <param name="primer_length" value="5" />
-      <output name="out_file1" file="vcfprimers-test1.fasta"/>
-    </test>
-    </tests>
-  <help>
-
-For each VCF record, extract the flanking sequences, and write them as FASTA
-records suitable for alignment.  This tool is intended for use in designing validation
-experiments.  Primers extracted which would flank all of the alleles at multi-allelic
-sites.  The name of the FASTA "reads" indicates the VCF record which they apply to.
-The form is >CHROM_POS_LEFT for the 3' primer and >CHROM_POS_RIGHT for the 5' primer,
-for example::
-
- >20_233255_LEFT
- CCATTGTATATATAGACCATAATTTCTTTATCCAATCATCTGTTGATGGA
- >20_233255_RIGHT
- ACTCAGTTGATTCCATACCTTTGCCATCATGAATCATGTTGTAATAAACA
-
-----
-
-Vcfprimers @IS_PART_OF_VCFLIB@
-</help>
-  <expand macro="citations" />
-</tool>
+<tool id="vcfprimers" name="VCFprimers:" version="@WRAPPER_VERSION@.0">
+  <description>Extract flanking sequences for each VCF record</description>
+  <macros>
+    <import>macros.xml</import>
+  </macros>
+  <expand macro="requirements"/>
+  <expand macro="stdio" />
+  <command>
+    #set $reference_fasta_filename = "localref.fa"
+    #if str( $reference_source.reference_source_selector ) == "history":
+       ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" &amp;&amp;
+    #else:
+       #set $reference_fasta_filename = str( $reference_source.ref_file.fields.path )
+    #end if    
+   vcfprimers -f "${reference_fasta_filename}" -l "${primer_length}" "${input_vcf}" > "${out_file1}"</command>
+  <inputs>
+<param name="input_vcf" type="data" format="vcf" label="VCF dataset to extract flanks" />
+    <conditional name="reference_source">
+       <param name="reference_source_selector" type="select" label="Choose the source for the reference genome">
+         <option value="cached">Locally cached</option>
+         <option value="history">History</option>
+       </param>
+       <when value="cached">
+         <param name="ref_file" type="select" label="Select reference genome">
+           <options from_data_table="fasta_indexes">
+           </options>
+	   <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
+         </param>
+       </when>
+       <when value="history"> <!-- FIX ME!!!! -->
+         <param name="ref_file" type="data" format="fasta" label="Using reference file" />
+       </when>
+     </conditional>
+     <param name="primer_length" type="integer" value="20" label="The length of the primer sequences on each side of the variant" help="default = 20 bp" />
+  </inputs>
+  <outputs>
+    <data format="fasta" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="reference_source_selector" value="history" />
+      <param name="input_vcf" value="vcflib-phix.vcf"/>
+      <param name="ref_file" value="vcflib-test-genome-phix.fa" />
+      <param name="primer_length" value="5" />
+      <output name="out_file1" file="vcfprimers-test1.fasta"/>
+    </test>
+    </tests>
+  <help>
+
+For each VCF record, extract the flanking sequences, and write them as FASTA
+records suitable for alignment.  This tool is intended for use in designing validation
+experiments.  Primers extracted which would flank all of the alleles at multi-allelic
+sites.  The name of the FASTA "reads" indicates the VCF record which they apply to.
+The form is >CHROM_POS_LEFT for the 3' primer and >CHROM_POS_RIGHT for the 5' primer,
+for example::
+
+ >20_233255_LEFT
+ CCATTGTATATATAGACCATAATTTCTTTATCCAATCATCTGTTGATGGA
+ >20_233255_RIGHT
+ ACTCAGTTGATTCCATACCTTTGCCATCATGAATCATGTTGTAATAAACA
+
+----
+
+Vcfprimers @IS_PART_OF_VCFLIB@
+</help>
+  <expand macro="citations" />
+</tool>