Mercurial > repos > devteam > vcfprimers
diff vcfprimers.xml @ 2:c3a5388628b5 draft
planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/vcflib/vcfprimers commit 0b9b6512272b82637c2f1e831367e89aed77ae79
| author | devteam |
|---|---|
| date | Thu, 15 Sep 2016 16:04:39 -0400 |
| parents | 15ec0bdaf4dd |
| children | 086d3cd0aaf9 |
line wrap: on
line diff
--- a/vcfprimers.xml Thu Nov 12 10:01:54 2015 -0500 +++ b/vcfprimers.xml Thu Sep 15 16:04:39 2016 -0400 @@ -1,67 +1,67 @@ -<tool id="vcfprimers" name="VCFprimers:" version="0.0.3"> - <description>Extract flanking sequences for each VCF record</description> - <macros> - <import>macros.xml</import> - </macros> - <expand macro="requirements"></expand> - <expand macro="stdio"></expand> - <command> - #set $reference_fasta_filename = "localref.fa" - #if str( $reference_source.reference_source_selector ) == "history": - ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" && - #else: - #set $reference_fasta_filename = str( $reference_source.ref_file.fields.path ) - #end if - vcfprimers -f "${reference_fasta_filename}" -l "${primer_length}" "${input_vcf}" > "${out_file1}"</command> - <inputs> -<param name="input_vcf" type="data" format="vcf" label="VCF dataset to extract flanks" /> - <conditional name="reference_source"> - <param name="reference_source_selector" type="select" label="Choose the source for the reference genome"> - <option value="cached">Locally cached</option> - <option value="history">History</option> - </param> - <when value="cached"> - <param name="ref_file" type="select" label="Select reference genome"> - <options from_data_table="fasta_indexes"> - </options> - <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> - </param> - </when> - <when value="history"> <!-- FIX ME!!!! --> - <param name="ref_file" type="data" format="fasta" label="Using reference file" /> - </when> - </conditional> - <param name="primer_length" type="integer" value="20" label="The length of the primer sequences on each side of the variant" help="default = 20 bp" /> - </inputs> - <outputs> - <data format="fasta" name="out_file1" /> - </outputs> - <tests> - <test> - <param name="reference_source_selector" value="history" /> - <param name="input_vcf" value="vcflib-phix.vcf"/> - <param name="ref_file" value="vcflib-test-genome-phix.fa" /> - <param name="primer_length" value="5" /> - <output name="out_file1" file="vcfprimers-test1.fasta"/> - </test> - </tests> - <help> - -For each VCF record, extract the flanking sequences, and write them as FASTA -records suitable for alignment. This tool is intended for use in designing validation -experiments. Primers extracted which would flank all of the alleles at multi-allelic -sites. The name of the FASTA "reads" indicates the VCF record which they apply to. -The form is >CHROM_POS_LEFT for the 3' primer and >CHROM_POS_RIGHT for the 5' primer, -for example:: - - >20_233255_LEFT - CCATTGTATATATAGACCATAATTTCTTTATCCAATCATCTGTTGATGGA - >20_233255_RIGHT - ACTCAGTTGATTCCATACCTTTGCCATCATGAATCATGTTGTAATAAACA - ----- - -Vcfprimers @IS_PART_OF_VCFLIB@ -</help> - <expand macro="citations" /> -</tool> +<tool id="vcfprimers" name="VCFprimers:" version="@WRAPPER_VERSION@.0"> + <description>Extract flanking sequences for each VCF record</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <expand macro="stdio" /> + <command> + #set $reference_fasta_filename = "localref.fa" + #if str( $reference_source.reference_source_selector ) == "history": + ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" && + #else: + #set $reference_fasta_filename = str( $reference_source.ref_file.fields.path ) + #end if + vcfprimers -f "${reference_fasta_filename}" -l "${primer_length}" "${input_vcf}" > "${out_file1}"</command> + <inputs> +<param name="input_vcf" type="data" format="vcf" label="VCF dataset to extract flanks" /> + <conditional name="reference_source"> + <param name="reference_source_selector" type="select" label="Choose the source for the reference genome"> + <option value="cached">Locally cached</option> + <option value="history">History</option> + </param> + <when value="cached"> + <param name="ref_file" type="select" label="Select reference genome"> + <options from_data_table="fasta_indexes"> + </options> + <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> + </param> + </when> + <when value="history"> <!-- FIX ME!!!! --> + <param name="ref_file" type="data" format="fasta" label="Using reference file" /> + </when> + </conditional> + <param name="primer_length" type="integer" value="20" label="The length of the primer sequences on each side of the variant" help="default = 20 bp" /> + </inputs> + <outputs> + <data format="fasta" name="out_file1" /> + </outputs> + <tests> + <test> + <param name="reference_source_selector" value="history" /> + <param name="input_vcf" value="vcflib-phix.vcf"/> + <param name="ref_file" value="vcflib-test-genome-phix.fa" /> + <param name="primer_length" value="5" /> + <output name="out_file1" file="vcfprimers-test1.fasta"/> + </test> + </tests> + <help> + +For each VCF record, extract the flanking sequences, and write them as FASTA +records suitable for alignment. This tool is intended for use in designing validation +experiments. Primers extracted which would flank all of the alleles at multi-allelic +sites. The name of the FASTA "reads" indicates the VCF record which they apply to. +The form is >CHROM_POS_LEFT for the 3' primer and >CHROM_POS_RIGHT for the 5' primer, +for example:: + + >20_233255_LEFT + CCATTGTATATATAGACCATAATTTCTTTATCCAATCATCTGTTGATGGA + >20_233255_RIGHT + ACTCAGTTGATTCCATACCTTTGCCATCATGAATCATGTTGTAATAAACA + +---- + +Vcfprimers @IS_PART_OF_VCFLIB@ +</help> + <expand macro="citations" /> +</tool>