Mercurial > repos > devteam > tophat
changeset 0:51c6602b46b9 draft
Imported from capsule None
| author | devteam |
|---|---|
| date | Thu, 23 Jan 2014 12:30:49 -0500 |
| parents | |
| children | af089ca8b4ee |
| files | test-data/tophat_in1.fasta test-data/tophat_in2.fastqsanger test-data/tophat_in3.fastqsanger test-data/tophat_out1h.bam test-data/tophat_out1j.bed test-data/tophat_out2h.bam test-data/tophat_out2j.bed test-data/tophat_out3d.bed test-data/tophat_out3h.bam test-data/tophat_out3i.bed test-data/tophat_out3j.bed test-data/tophat_out4h.bam test-data/tophat_out4j.bed tool-data/bowtie_indices.loc.sample tool_data_table_conf.xml.sample tool_dependencies.xml tophat_macros.xml tophat_wrapper.py tophat_wrapper.xml |
| diffstat | 19 files changed, 1758 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tophat_in1.fasta Thu Jan 23 12:30:49 2014 -0500 @@ -0,0 +1,14 @@ +>test_chromosome +AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA +ACTACTATCTGACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGCC +ACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGC +AGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCT +ACGTATTTGGCGCGCGGCGCTACGGCTGAGCGTCGAGCTTGCGATACGCC +GTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA +AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG +ACTATTACTTTATTATCTTACTCGGACGTAGACGGATCGGCAACGGGACT +GTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA +AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG +TTTTCTACTTGAGACTGGGATCGAGGCGGACTTTTTAGGACGGGACTTGC +AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA +AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tophat_in2.fastqsanger Thu Jan 23 12:30:49 2014 -0500 @@ -0,0 +1,400 @@ +@test_mRNA_150_290_0/1 +TCCTAAAAAGTCCGCCTCGGTCTCAGTCTCAAGTAGAAAAAGTCCCGTTGGCGATCCGTCTACGTCCGAGTAAGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_8_197_1/1 +TCTGACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGACACTACGGGGATGGCGACTAGGACTACGGACGG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_82_255_2/1 +GAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAATATAGTAAAGTAATAGTGGCGTATCGCAAGCTCGACG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_96_238_3/1 +GATCCGTCTACGTCCGCGTAAGATAATAAAGTACTAGTAGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_72_258_4/1 +GTAGAAAAAGTCCCGTTGCCCATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_107_286_5/1 +AAAAAGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAAT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_122_299_6/1 +CAAGTCCCGTCCTAAAAAGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGCTCCGTCTACGTC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_58_234_7/1 +AGTCTACGTCCGAGTCAGATAATAAACTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_57_231_8/1 +GGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCACCGACTGGACTATTTAGGACGATCGGACTG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_8_155_9/1 +TACGTAGCGTCCTACTGCCCTCCTCAGTCCGATCGTCCTAAATAGTACAGTCGCTGCATCTGACGCTCGAAGTCC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_51_237_a/1 +ACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_89_230_b/1 +TACGTCCGAGTGAGTTAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_105_276_c/1 +CCTCGATCCCAGTCTCAAGTAGAAAAAGCCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_111_268_d/1 +CCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAATAATAGTGGCGTAT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_151_286_e/1 +ACGTATTTGGCGCGCGGCCGTACGGCTGAGCGTCGAGCTTGCGATACGCCACTATTACTTTATTATCTTACTCGG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_118_297_f/1 +AGTCCCGTCCTAAAAAGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_16_194_10/1 +TCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCAGTCCGATCGT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_28_188_11/1 +TTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGAACGGACTTAGAGCGTCAGATGCAG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_36_218_12/1 +GAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGCCTTAGAGCGTCAGATGCAGCGACTGGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_105_266_13/1 +AGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGGATCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_51_248_14/1 +ACTACGGGGATGACGACGAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGAACTTTTTAGGACGATC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_89_245_15/1 +AGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_58_218_16/1 +AGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_46_195_17/1 +ATCCCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGACAAATATGTAGCGTCCTACTGCCCTCCTCAGTCCAATCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_126_282_18/1 +AGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_53_212_19/1 +TACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGAATATTTAGGACGATCGG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_11_190_1a/1 +GACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_52_261_1b/1 +CTACGGGAATGACGACTAGGGCTACGGAGGGACTTACAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_104_274_1c/1 +TCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_151_297_1d/1 +ACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATACGCCACTATTACTTTATTATCTTACTCGG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_44_225_1e/1 +CCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCATATACGT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_28_206_1f/1 +TTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGACGCAG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_48_249_20/1 +GTCCCGTTGCCGATCCGTCTCCGTCCGAGTAAGATAGTAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_75_235_21/1 +ACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGCACGATCGGACTGAGGAGGGCAGTAGAACGT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_110_267_22/1 +CAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_69_229_23/1 +ACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTAGACGCTCAGCCGTAGGGCCGCGCGCCAAAG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_21_208_24/1 +GTAATAGTGGCGTATCGCAAGCTCGACGCTCAGGCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_42_209_25/1 +GGACGTGCCACTACGTGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_97_275_26/1 +ATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_36_146_27/1 +ACCTACTGCACTCCTCAGTCCGATCGTCCTAAATAGTCCAGTCGCTGCATCTGACGCTCTAAGTCCGTCCGTAGT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_110_271_28/1 +ACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_38_199_29/1 +GCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_103_284_2a/1 +AAAGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_116_271_2b/1 +ATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCTGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_77_256_2c/1 +GGACGGACTTAGAGCATCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_50_224_2d/1 +CGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_65_238_2e/1 +GACTAGGACTACGGACGGACTTAGAGCGTCAGAAGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_46_232_2f/1 +GTGCCACTACGGGGATGACGACTAGGACTACGGCCGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_26_189_30/1 +AGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTACCGTCCTACTGCCCTCCTCAGTCCGATCGTCCTAA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_79_256_31/1 +AGAAAAAGTCCCGTTGCCGATCCGGCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATGGCAAGCTCGAC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_89_267_32/1 +CAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGAAAGATAATAAAGTAATAGTGCCGTATC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_131_260_33/1 +GAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATACGCCACTAT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_73_240_34/1 +CTACGGACGGACTTAGAGCGTCAGATGCAGCGAATGGACTATTTAGGACGCTCGGACTGAGGAGGGCAGTAGGAC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_44_197_35/1 +ACGTGCAACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_128_252_36/1 +ACTGAGGAGGGCAGTAGGACGCTACGCATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATAGGCCAC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_145_300_37/1 +GCAAGTCCCGTCCTAAAAAGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTTCCGATCCGTCTACGT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_85_275_38/1 +TTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGAAGCTACGTCTTTC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_48_207_39/1 +GCCCCTACGGGGATGACGACTAGGACTACGGACGGATTTAGACCGTCAGATGCAGCGACTGGACTATTTAGGACG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_81_228_3a/1 +CCTACGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCATAGGGCCGCGCGCCAAATA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_75_277_3b/1 +ACGGACGGACTTAAAGCTTCAGATGCAGCGACAGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_30_231_3c/1 +CTACGTGCGAGTAAGATATTAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTTAGCCGTAGGGCCGCGCGCCAA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_58_220_3d/1 +GAAGATAATAAAGTAATAGTGGCGTATCGCAACCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_104_278_3e/1 +CGCCTCGATTCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAAT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_44_193_3f/1 +ACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGTCTATTTAG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_94_291_40/1 +CAGATGCAGCGACTGTACTATTTAGGACGACCTGACTGAGGAGGGTAGTAGGACGCTACGTATTTGGCGCGCGGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_91_256_41/1 +CGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_23_186_42/1 +TCGACGCTCAGTCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTTCTGCCCTCCTCCGTCCGATCGTCCTAAATA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_92_266_43/1 +GTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTCAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_92_250_44/1 +GTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_106_253_45/1 +AAAAGTCCCGTTGCCGATCCGTTTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_5_197_46/1 +CTATCTGACTAGACTCGAGGCGCTTGCGTCTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_51_194_47/1 +TCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCAGTCCGATCGT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_125_280_48/1 +CGGACTGAGGAGGGCAGTAGGACGCTATGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGAAACGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_51_194_49/1 +ACTACGGGGATGACGACTAGGCCTACGGATGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_33_189_4a/1 +AGCCCGACGCTCAGCCGTAGGGCCGCGCGCCAAATAGGTAGCGTCCTACTGCCCTCCTCAGTCCGATCGTCCTAA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_78_276_4b/1 +GACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGGCGCTAC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_63_229_4c/1 +ACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACACTCAGCCGTAGGGCCGCGCGCCAAAT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_81_245_4d/1 +CGTTGCCGATCCGTCTACGTCCGAGTAAGATTATAAAGTAATAGTGGCGTATCGCAACCTCGACGCTCAGCCGTA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_33_223_4e/1 +ACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_172_294_4f/1 +ACGGATGAGCGTCGAGCTTGCGATACGCCACTATTACTTTATTATCTTCCTCGGACGTAGACGGATCGCCAACGG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_88_257_50/1 +TAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_3_187_51/1 +TACTATTTGACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTCGGACTACG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_9_179_52/1 +TCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCAGTCCGATCGTCCTAAATGGTCCAGT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_85_268_53/1 +TTAGTGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_75_204_54/1 +ACGGACGGACTTCGAGCCTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_41_236_55/1 +AGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGAATATT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_56_183_56/1 +GGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTGGGACGATCGGACT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_87_250_57/1 +AGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_82_271_58/1 +GACTTAGAGCGTCAGTTGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTAT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_6_182_59/1 +TATCTGACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGCCAGTACGGGGATGACGACTAGGACTACGGAC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_53_272_5a/1 +GATCCCAGTGTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_114_277_5b/1 +GCCTCGATCCCAGTCTCAAGCAGAAAAAGTCCCGTTGCCGTTCCGTCTACCTCCGAGTAAGATAATAAAGTAATA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_39_219_5c/1 +CTAGGACGTCCCACTATGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGGCTGGACTA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_4_191_5d/1 +CAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGTGTCCTACTGCCCTACTCAGTCCGATCGTCCT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_73_259_5e/1 +CTACGGACGGACTTAGAGCGTCAGATGCTGCGACTGGACTATTTGGGACGATCGGACTGAGGAGGGCAGTAGGAC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_87_279_5f/1 +CCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_125_293_60/1 +CCGTCCTAAAAAGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_111_297_61/1 +AGTCCCGTCCTAAAAAGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCGGATCCGTCTACGTCCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_22_173_62/1 +AGGCGCTTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_116_295_63/1 +TCCCGTCCTAAAAAGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tophat_in3.fastqsanger Thu Jan 23 12:30:49 2014 -0500 @@ -0,0 +1,400 @@ +@test_mRNA_150_290_0/2 +TACGTATTTGTCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATCCGCCACTATTACTTTATTATCTTACTCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_8_197_1/2 +GTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCAGTCCGAT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_82_255_2/2 +GACTTAGAGCGTCAGATGCAGCGACTGGACTTTTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTAT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_96_238_3/2 +GATGCAGCGACTGGACTATTTAGGACGATCGGACGGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGACC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_72_258_4/2 +ACTACGGACGGACTTAGAGCGTCAGATGCAGCAACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_107_286_5/2 +TGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGCATTTGGCGCGCGGCCCTACGGCTGAGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_122_299_6/2 +GATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_58_234_7/2 +GGATGACGCCTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_57_231_8/2 +CTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCCTAGGGCCGCGCGCCAA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_8_155_9/2 +TGTGACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_51_237_a/2 +ATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_89_230_b/2 +AGCGTCAGGTGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_105_276_c/2 +ACTGGACTATTTAGGACGATCGGACTGAGGAAGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_111_268_d/2 +CTATTTAAGACGTTCCGCCTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_151_286_e/2 +AAAAAGTCCGCCTCGATCCCAGTCTCAAGTAGATAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAAT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_118_297_f/2 +GGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_16_194_10/2 +GACTGGATGCGCTTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTCGGACTACGGACGGACTTAAAG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_28_188_11/2 +GCTCGACGCTCAGCCGTAGGGCCTCGCGCCAAATACGAAGCGTCCTACTGCCTTCCTCAGTCCGATCGTCCTAAA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_36_218_12/2 +AGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_105_266_13/2 +ACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_51_248_14/2 +TCCCGTTGCCGTTCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_89_245_15/2 +CGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAGAGAAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_58_218_16/2 +GGATGACGACTAGGACTACGGACGGACTTAGAACGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_46_195_17/2 +GTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_126_282_18/2 +GGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATACGCC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_53_212_19/2 +TAAAGAAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_11_190_1a/2 +AAGCTCGACGCTCAGCCGTAGGGCCACGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCAGTCCCATCGACCTA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_52_261_1b/2 +CAAGTAGAAAAAGTCCCGTTGCCGATCCTTCTACGTCCGAGTAAGATAATTAAGTAATAGTGGCGTATCGCAAGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_104_274_1c/2 +GAGTGTACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATGTGCCGCGCGGCCCTACGGCTG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_151_297_1d/2 +AGTCCCGTCCTAAAATGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_44_225_1e/2 +ACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCGGGTGCAGCGACTGGACTATTTAG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_28_206_1f/2 +AATAGTGGCTTATCGCAAGCTCGACTCTCAGCCGTAGGGCCGCGCGCCAAATACGTGGCGTCCTACTGCCCTCCT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_48_249_20/2 +GCCACTACGGGGATGACGACTAGGACGACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_75_235_21/2 +CCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCAACGCTCAGCCGTAGGGCCGTGCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_110_267_22/2 +ACTAGTTAGGGCGATCGGACTGAGGAGGGCAGTAGGACGCTACGTAGTTGGCGCGCGGCCCTACGACTGAGCGTC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_69_229_23/2 +AGGACTACGGACGGACTTATAGGGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_21_208_24/2 +GAGGCGCTTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_42_209_25/2 +AGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_97_275_26/2 +CTCGATCCCAGTCTCAAGTAGAAAGAGTCCCGTTTCCGATCCGTCTACGTCCGACTAAGATAATAAAGTAATAGT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_36_146_27/2 +GCGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACAGACGGACTTAGAGCGTCAGATGCAGCGACTGGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_110_271_28/2 +ATCCCAGTCTCAAGTAGAAAAAGCCCCGTTGCCGATCCGTCTTCGTCCGAGTAAGATAATAAAGTAATAGTGGCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_38_199_29/2 +GCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCAGTCCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_103_284_2a/2 +CGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_116_271_2b/2 +TAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_77_256_2c/2 +AGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGAC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_50_224_2d/2 +CACTACGAGGATGACGTCTAGGACTACGGACGGACTTAGAGCGTCAGACGCAGCGACTGGACTATTTAGGACGAT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_65_238_2e/2 +GATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCGCAGCCGTAGGGCCGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_46_232_2f/2 +TCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_26_189_30/2 +GCTTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_79_256_31/2 +ACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_89_267_32/2 +AGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGAGTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_131_260_33/2 +AAGTAAAAAAAGTCCCGTGGCCGATCCGTTTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCACAAGCT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_73_240_34/2 +CCGATCCGTCTACGTCCGAGAAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_44_197_35/2 +GTATCGCAAGCTCGACGATCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCAGTCCGAT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_128_252_36/2 +AAAGTCCCGTTCCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_145_300_37/2 +GACGCTACGTATTTGGCGCGGGGCCCTATGGCTGAGCGTCGAGCTTGCGATACGCCACTATTACTTTAGTATATT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_85_275_38/2 +CTCGATCCCAGTCTCAAGTAGTAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAAGAGT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_48_207_39/2 +TAAGAGTGGCGTATCGCAAGATCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTTCCCTCC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_81_228_3a/2 +GGACTGAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGTAGTAGGACGCTACGTA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_75_277_3b/2 +GCCTCGATCCCAGTCTCAGGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_30_231_3c/2 +GCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_58_220_3d/2 +GGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_104_278_3e/2 +GACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTTTTTGGCGCGCGGCCCTACGGCTG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_44_193_3f/2 +CGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCTCTCCCCAGTCCGATCGTC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_94_291_40/2 +GTCCCAAAAAGTCCGCCTCGATCCCAGTCTCAAGTAGAAAATGTCGCGTTGCCGATCCGTCTACGTCCCAGGAAG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_91_256_41/2 +AGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGAC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_23_186_42/2 +GGCGCTTGTGACTGAGCTAGGACGTGCCACTACGGGGATGAAGACTAGGACTACGGACGGACTTAGAGCGTCAGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_92_266_43/2 +GGTCTCAAGTAGAAAAAGTCCCGTTGCCGCTCCGTCTACGTCCGAGTAAGATAAGAAAGTAATAGTGGCGTATCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_92_250_44/2 +AGTCCCGTACCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_106_253_45/2 +CTGGACTATTTAGGTCGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_5_197_46/2 +GTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCCCGCCAAATACGTAGCGTCCTACTGCCCTCCTCCGTCCGAT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_51_194_47/2 +ACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_125_280_48/2 +TCCGCCTCGCTCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCAGAGTAAGATAATAAAGTA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_51_194_49/2 +CCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTGGCGTCCTACTGCCCTCCTCAGTCCGAACGT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_33_189_4a/2 +ACTGAGCTAGGACGTGCCACTACGGGGATTACCACTAGGGCTACGGACGGACTTAGAGCGTCAGATGCAGCGACT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_78_276_4b/2 +CCTCGATCCTAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_63_229_4c/2 +ACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGGGACTGGACTATTTAGGACGATCGGACTGAGGAGG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_81_245_4d/2 +GGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGATGAGGGCAGTAGGACGCTACGTA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_33_223_4e/2 +GAGTTAGATAATAAAGTAATAGTGGCTTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACCTAG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_172_294_4f/2 +CCCGTCCTAAAACGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGCTGCCGACCCGTCTACGTCCGAGT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_88_257_50/2 +GAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_3_187_51/2 +CTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCAGTCCGATCGTCCTAAAT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_9_179_52/2 +CTGACTAGACTGGAGGCGCTCGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_85_268_53/2 +CCAGTCTCAAGTAGAAAAAGTCCCGTTGACGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTAT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_75_204_54/2 +TCGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_41_236_55/2 +TCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_56_183_56/2 +ACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCAGTCCGATCGTCCTAAATAGTC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_87_250_57/2 +AGAGCGTCAGATGCAGAGACTGGACTATTTAGGACGATCGGACTGAGGAGTGCAGTAGGACGCTACGTATTTGGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_82_271_58/2 +ATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATGCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_6_182_59/2 +CGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCAGTCCGATCGTCCTAAATAGTCC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_53_272_5a/2 +TACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_114_277_5b/2 +TTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGCCTGAGCGTCGAGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_39_219_5c/2 +AAGATAATAAAGTAATAGTGGCGTATCGCAAGCTGGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_4_191_5d/2 +ACTATCTGACGAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTACCATTACGCGGATGACGACTAGGACTACGG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_73_259_5e/2 +AGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATACAGTAATAGTGGCGTATCGCAAGCTC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_87_279_5f/2 +AGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACCGAGGAGGGCAGTAGGACGCTACGTATTTGGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_125_293_60/2 +CGGACTGAGGAGGGCAGTAGGACGCTATGTATTTGGCGCGCGGCCCTACGGCTGAGCTTCGAGGTTGCGATACGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_111_297_61/2 +CTATTTAGGACGATCGGACTGGGGAGGGCAGTAGGACGCTACGGATTTGGCGCGCGGCCCTACGGCTGAGCGTCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_22_173_62/2 +GTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCAGTCCGATCGTCCTAAATAGTCCAGTCGCTGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_116_295_63/2 +TAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tophat_out1j.bed Thu Jan 23 12:30:49 2014 -0500 @@ -0,0 +1,3 @@ +track name=junctions description="TopHat junctions" +test_chromosome 180 400 JUNC00000001 23 + 180 400 255,0,0 2 70,50 0,170 +test_chromosome 350 550 JUNC00000002 24 + 350 550 255,0,0 2 50,50 0,150
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tophat_out2j.bed Thu Jan 23 12:30:49 2014 -0500 @@ -0,0 +1,3 @@ +track name=junctions description="TopHat junctions" +test_chromosome 179 400 JUNC00000001 38 + 179 400 255,0,0 2 71,50 0,171 +test_chromosome 350 549 JUNC00000002 30 + 350 549 255,0,0 2 50,49 0,150
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tophat_out3d.bed Thu Jan 23 12:30:49 2014 -0500 @@ -0,0 +1,1 @@ +track name=deletions description="TopHat deletions"
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tophat_out3i.bed Thu Jan 23 12:30:49 2014 -0500 @@ -0,0 +1,1 @@ +track name=insertions description="TopHat insertions"
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tophat_out3j.bed Thu Jan 23 12:30:49 2014 -0500 @@ -0,0 +1,3 @@ +track name=junctions description="TopHat junctions" +test_chromosome 180 400 JUNC00000001 23 + 180 400 255,0,0 2 70,50 0,170 +test_chromosome 350 550 JUNC00000002 24 + 350 550 255,0,0 2 50,50 0,150
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tophat_out4j.bed Thu Jan 23 12:30:49 2014 -0500 @@ -0,0 +1,3 @@ +track name=junctions description="TopHat junctions" +test_chromosome 179 400 JUNC00000001 38 + 179 400 255,0,0 2 71,50 0,171 +test_chromosome 350 549 JUNC00000002 30 + 350 549 255,0,0 2 50,49 0,150
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/bowtie_indices.loc.sample Thu Jan 23 12:30:49 2014 -0500 @@ -0,0 +1,37 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of Bowtie indexed sequences data files. You will +#need to create these data files and then create a bowtie_indices.loc +#file similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The bowtie_indices.loc +#file has this format (longer white space characters are TAB characters): +# +#<unique_build_id> <dbkey> <display_name> <file_base_path> +# +#So, for example, if you had hg18 indexed stored in +#/depot/data2/galaxy/bowtie/hg18/, +#then the bowtie_indices.loc entry would look like this: +# +#hg18 hg18 hg18 /depot/data2/galaxy/bowtie/hg18/hg18 +# +#and your /depot/data2/galaxy/bowtie/hg18/ directory +#would contain hg18.*.ebwt files: +# +#-rw-r--r-- 1 james universe 830134 2005-09-13 10:12 hg18.1.ebwt +#-rw-r--r-- 1 james universe 527388 2005-09-13 10:12 hg18.2.ebwt +#-rw-r--r-- 1 james universe 269808 2005-09-13 10:12 hg18.3.ebwt +#...etc... +# +#Your bowtie_indices.loc file should include an entry per line for each +#index set you have stored. The "file" in the path does not actually +#exist, but it is the prefix for the actual index files. For example: +# +#hg18canon hg18 hg18 Canonical /depot/data2/galaxy/bowtie/hg18/hg18canon +#hg18full hg18 hg18 Full /depot/data2/galaxy/bowtie/hg18/hg18full +#/orig/path/hg19 hg19 hg19 /depot/data2/galaxy/bowtie/hg19/hg19 +#...etc... +# +#Note that for backwards compatibility with workflows, the unique ID of +#an entry must be the path that was in the original loc file, because that +#is the value stored in the workflow for that parameter. That is why the +#hg19 entry above looks odd. New genomes can be better-looking. +#
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.sample Thu Jan 23 12:30:49 2014 -0500 @@ -0,0 +1,8 @@ +<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc--> +<tables> + <!-- Locations of indexes in the Bowtie mapper format for TopHat to use --> + <table name="tophat_indexes" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="tool-data/bowtie_indices.loc" /> + </table> +</tables>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_dependencies.xml Thu Jan 23 12:30:49 2014 -0500 @@ -0,0 +1,12 @@ +<?xml version="1.0"?> +<tool_dependency> + <package name="bowtie" version="0.12.7"> + <repository changeset_revision="f54826948b0b" name="package_bowtie_0_12_7" owner="devteam" prior_installation_required="False" toolshed="http://testtoolshed.g2.bx.psu.edu" /> + </package> + <package name="samtools" version="0.1.18"> + <repository changeset_revision="c0f72bdba484" name="package_samtools_0_1_18" owner="devteam" prior_installation_required="False" toolshed="http://testtoolshed.g2.bx.psu.edu" /> + </package> + <package name="tophat" version="1.4.0"> + <repository changeset_revision="765982facf05" name="package_tophat_1_4_0" owner="devteam" prior_installation_required="False" toolshed="http://testtoolshed.g2.bx.psu.edu" /> + </package> +</tool_dependency>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tophat_macros.xml Thu Jan 23 12:30:49 2014 -0500 @@ -0,0 +1,72 @@ +<macros> + <macro name="refGenomeSourceConditional"> + <conditional name="refGenomeSource"> + <param name="genomeSource" type="select" label="Use a built in reference genome or own from your history" help="Built-ins genomes were created using default options"> + <option value="indexed" selected="True">Use a built-in genome</option> + <option value="history">Use a genome from history</option> + </param> + <when value="indexed"> + <param name="index" type="select" label="Select a reference genome" help="If your genome of interest is not listed, contact the Galaxy team"> + <yield /> + </param> + </when> + <when value="history"> + <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" /> + </when> <!-- history --> + </conditional> <!-- refGenomeSource --> + </macro> + <macro name="indel_searchConditional"> + <conditional name="indel_search"> + <param name="allow_indel_search" type="select" label="Allow indel search"> + <option value="Yes">Yes</option> + <option value="No">No</option> + </param> + <when value="No"/> + <when value="Yes"> + <param name="max_insertion_length" type="integer" value="3" label="Max insertion length." help="The maximum insertion length." /> + <param name="max_deletion_length" type="integer" value="3" label="Max deletion length." help="The maximum deletion length." /> + </when> + </conditional> + </macro> + <macro name="own_junctionsConditional"> + <conditional name="own_junctions"> + <param name="use_junctions" type="select" label="Use Own Junctions"> + <option value="No">No</option> + <option value="Yes">Yes</option> + </param> + <when value="Yes"> + <conditional name="gene_model_ann"> + <param name="use_annotations" type="select" label="Use Gene Annotation Model"> + <option value="No">No</option> + <option value="Yes">Yes</option> + </param> + <when value="No" /> + <when value="Yes"> + <param format="gtf,gff3" name="gene_annotation_model" type="data" label="Gene Model Annotations" help="TopHat will use the exon records in this file to build a set of known splice junctions for each gene, and will attempt to align reads to these junctions even if they would not normally be covered by the initial mapping."/> + </when> + </conditional> + <expand macro="raw_juncsConditional" /> + <expand macro="no_novel_juncsParam" /> + </when> + <when value="No" /> + </conditional> <!-- /own_junctions --> + </macro> + <macro name="raw_juncsConditional"> + <conditional name="raw_juncs"> + <param name="use_juncs" type="select" label="Use Raw Junctions"> + <option value="No">No</option> + <option value="Yes">Yes</option> + </param> + <when value="No" /> + <when value="Yes"> + <param format="interval" name="raw_juncs" type="data" label="Raw Junctions" help="Supply TopHat with a list of raw junctions. Junctions are specified one per line, in a tab-delimited format. Records look like: [chrom] [left] [right] [+/-] left and right are zero-based coordinates, and specify the last character of the left sequenced to be spliced to the first character of the right sequence, inclusive."/> + </when> + </conditional> + </macro> + <macro name="no_novel_juncsParam"> + <param name="no_novel_juncs" type="select" label="Only look for supplied junctions"> + <option value="No">No</option> + <option value="Yes">Yes</option> + </param> + </macro> +</macros>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tophat_wrapper.py Thu Jan 23 12:30:49 2014 -0500 @@ -0,0 +1,238 @@ +#!/usr/bin/env python + +import optparse, os, shutil, subprocess, sys, tempfile, fileinput + +def stop_err( msg ): + sys.stderr.write( "%s\n" % msg ) + sys.exit() + +def __main__(): + #Parse Command Line + parser = optparse.OptionParser() + parser.add_option( '-p', '--num-threads', dest='num_threads', help='Use this many threads to align reads. The default is 1.' ) + parser.add_option( '-C', '--color-space', dest='color_space', action='store_true', help='This indicates color-space data' ) + parser.add_option( '-J', '--junctions-output', dest='junctions_output_file', help='Junctions output file; formate is BED.' ) + parser.add_option( '-H', '--hits-output', dest='accepted_hits_output_file', help='Accepted hits output file; formate is BAM.' ) + parser.add_option( '', '--own-file', dest='own_file', help='' ) + parser.add_option( '-D', '--indexes-path', dest='index_path', help='Indexes directory; location of .ebwt and .fa files.' ) + parser.add_option( '-r', '--mate-inner-dist', dest='mate_inner_dist', help='This is the expected (mean) inner distance between mate pairs. \ + For, example, for paired end runs with fragments selected at 300bp, \ + where each end is 50bp, you should set -r to be 200. There is no default, \ + and this parameter is required for paired end runs.') + parser.add_option( '', '--mate-std-dev', dest='mate_std_dev', help='Standard deviation of distribution on inner distances between male pairs.' ) + parser.add_option( '-a', '--min-anchor-length', dest='min_anchor_length', + help='The "anchor length". TopHat will report junctions spanned by reads with at least this many bases on each side of the junction.' ) + parser.add_option( '-m', '--splice-mismatches', dest='splice_mismatches', help='The maximum number of mismatches that can appear in the anchor region of a spliced alignment.' ) + parser.add_option( '-i', '--min-intron-length', dest='min_intron_length', + help='The minimum intron length. TopHat will ignore donor/acceptor pairs closer than this many bases apart.' ) + parser.add_option( '-I', '--max-intron-length', dest='max_intron_length', + help='The maximum intron length. When searching for junctions ab initio, TopHat will ignore donor/acceptor pairs farther than this many bases apart, except when such a pair is supported by a split segment alignment of a long read.' ) + parser.add_option( '-g', '--max_multihits', dest='max_multihits', help='Maximum number of alignments to be allowed' ) + parser.add_option( '', '--initial-read-mismatches', dest='initial_read_mismatches', help='Number of mismatches allowed in the initial read mapping' ) + parser.add_option( '', '--seg-mismatches', dest='seg_mismatches', help='Number of mismatches allowed in each segment alignment for reads mapped independently' ) + parser.add_option( '', '--seg-length', dest='seg_length', help='Minimum length of read segments' ) + parser.add_option( '', '--library-type', dest='library_type', help='TopHat will treat the reads as strand specific. Every read alignment will have an XS attribute tag. Consider supplying library type options below to select the correct RNA-seq protocol.' ) + parser.add_option( '', '--allow-indels', action="store_true", help='Allow indel search. Indel search is disabled by default.(Not used since version 1.3.0)' ) + parser.add_option( '', '--max-insertion-length', dest='max_insertion_length', help='The maximum insertion length. The default is 3.' ) + parser.add_option( '', '--max-deletion-length', dest='max_deletion_length', help='The maximum deletion length. The default is 3.' ) + + # Options for supplying own junctions + parser.add_option( '-G', '--GTF', dest='gene_model_annotations', help='Supply TopHat with a list of gene model annotations. \ + TopHat will use the exon records in this file to build \ + a set of known splice junctions for each gene, and will \ + attempt to align reads to these junctions even if they \ + would not normally be covered by the initial mapping.') + parser.add_option( '-j', '--raw-juncs', dest='raw_juncs', help='Supply TopHat with a list of raw junctions. Junctions are \ + specified one per line, in a tab-delimited format. Records \ + look like: <chrom> <left> <right> <+/-> left and right are \ + zero-based coordinates, and specify the last character of the \ + left sequenced to be spliced to the first character of the right \ + sequence, inclusive.') + parser.add_option( '', '--no-novel-juncs', action="store_true", dest='no_novel_juncs', help="Only look for junctions indicated in the \ + supplied GFF file. (ignored without -G)") + parser.add_option( '', '--no-novel-indels', action="store_true", dest='no_novel_indels', help="Skip indel search. Indel search is enabled by default.") + # Types of search. + parser.add_option( '', '--microexon-search', action="store_true", dest='microexon_search', help='With this option, the pipeline will attempt to find alignments incident to microexons. Works only for reads 50bp or longer.') + parser.add_option( '', '--closure-search', action="store_true", dest='closure_search', help='Enables the mate pair closure-based search for junctions. Closure-based search should only be used when the expected inner distance between mates is small (<= 50bp)') + parser.add_option( '', '--no-closure-search', action="store_false", dest='closure_search' ) + parser.add_option( '', '--coverage-search', action="store_true", dest='coverage_search', help='Enables the coverage based search for junctions. Use when coverage search is disabled by default (such as for reads 75bp or longer), for maximum sensitivity.') + parser.add_option( '', '--no-coverage-search', action="store_false", dest='coverage_search' ) + parser.add_option( '', '--min-segment-intron', dest='min_segment_intron', help='Minimum intron length that may be found during split-segment search' ) + parser.add_option( '', '--max-segment-intron', dest='max_segment_intron', help='Maximum intron length that may be found during split-segment search' ) + parser.add_option( '', '--min-closure-exon', dest='min_closure_exon', help='Minimum length for exonic hops in potential splice graph' ) + parser.add_option( '', '--min-closure-intron', dest='min_closure_intron', help='Minimum intron length that may be found during closure search' ) + parser.add_option( '', '--max-closure-intron', dest='max_closure_intron', help='Maximum intron length that may be found during closure search' ) + parser.add_option( '', '--min-coverage-intron', dest='min_coverage_intron', help='Minimum intron length that may be found during coverage search' ) + parser.add_option( '', '--max-coverage-intron', dest='max_coverage_intron', help='Maximum intron length that may be found during coverage search' ) + + # Wrapper options. + parser.add_option( '-1', '--input1', dest='input1', help='The (forward or single-end) reads file in Sanger FASTQ format' ) + parser.add_option( '-2', '--input2', dest='input2', help='The reverse reads file in Sanger FASTQ format' ) + parser.add_option( '', '--single-paired', dest='single_paired', help='' ) + parser.add_option( '', '--settings', dest='settings', help='' ) + + (options, args) = parser.parse_args() + + # output version # of tool + try: + tmp = tempfile.NamedTemporaryFile().name + tmp_stdout = open( tmp, 'wb' ) + proc = subprocess.Popen( args='tophat -v', shell=True, stdout=tmp_stdout ) + tmp_stdout.close() + returncode = proc.wait() + stdout = open( tmp_stdout.name, 'rb' ).readline().strip() + if stdout: + sys.stdout.write( '%s\n' % stdout ) + else: + raise Exception + except: + sys.stdout.write( 'Could not determine Tophat version\n' ) + + # Color or base space + space = '' + if options.color_space: + space = '-C' + + # Creat bowtie index if necessary. + tmp_index_dir = tempfile.mkdtemp() + if options.own_file: + index_path = os.path.join( tmp_index_dir, '.'.join( os.path.split( options.own_file )[1].split( '.' )[:-1] ) ) + try: + os.link( options.own_file, index_path + '.fa' ) + except: + # Tophat prefers (but doesn't require) fasta file to be in same directory, with .fa extension + pass + cmd_index = 'bowtie-build %s -f %s %s' % ( space, options.own_file, index_path ) + try: + tmp = tempfile.NamedTemporaryFile( dir=tmp_index_dir ).name + tmp_stderr = open( tmp, 'wb' ) + proc = subprocess.Popen( args=cmd_index, shell=True, cwd=tmp_index_dir, stderr=tmp_stderr.fileno() ) + returncode = proc.wait() + tmp_stderr.close() + # get stderr, allowing for case where it's very large + tmp_stderr = open( tmp, 'rb' ) + stderr = '' + buffsize = 1048576 + try: + while True: + stderr += tmp_stderr.read( buffsize ) + if not stderr or len( stderr ) % buffsize != 0: + break + except OverflowError: + pass + tmp_stderr.close() + if returncode != 0: + raise Exception, stderr + except Exception, e: + if os.path.exists( tmp_index_dir ): + shutil.rmtree( tmp_index_dir ) + stop_err( 'Error indexing reference sequence\n' + str( e ) ) + else: + index_path = options.index_path + + # Build tophat command. + cmd = 'tophat %s %s %s' + reads = options.input1 + if options.input2: + reads += ' ' + options.input2 + opts = '-p %s %s' % ( options.num_threads, space ) + if options.single_paired == 'paired': + opts += ' -r %s' % options.mate_inner_dist + if options.settings == 'preSet': + cmd = cmd % ( opts, index_path, reads ) + else: + try: + if int( options.min_anchor_length ) >= 3: + opts += ' -a %s' % options.min_anchor_length + else: + raise Exception, 'Minimum anchor length must be 3 or greater' + opts += ' -m %s' % options.splice_mismatches + opts += ' -i %s' % options.min_intron_length + opts += ' -I %s' % options.max_intron_length + opts += ' -g %s' % options.max_multihits + # Custom junctions options. + if options.gene_model_annotations: + opts += ' -G %s' % options.gene_model_annotations + if options.raw_juncs: + opts += ' -j %s' % options.raw_juncs + if options.no_novel_juncs: + opts += ' --no-novel-juncs' + if options.library_type: + opts += ' --library-type %s' % options.library_type + if options.no_novel_indels: + opts += ' --no-novel-indels' + else: + if options.max_insertion_length: + opts += ' --max-insertion-length %i' % int( options.max_insertion_length ) + if options.max_deletion_length: + opts += ' --max-deletion-length %i' % int( options.max_deletion_length ) + # Max options do not work for Tophat v1.2.0, despite documentation to the contrary. (Fixed in version 1.3.1) + # need to warn user of this fact + #sys.stdout.write( "Max insertion length and max deletion length options don't work in Tophat v1.2.0\n" ) + + # Search type options. + if options.coverage_search: + opts += ' --coverage-search --min-coverage-intron %s --max-coverage-intron %s' % ( options.min_coverage_intron, options.max_coverage_intron ) + else: + opts += ' --no-coverage-search' + if options.closure_search: + opts += ' --closure-search --min-closure-exon %s --min-closure-intron %s --max-closure-intron %s' % ( options.min_closure_exon, options.min_closure_intron, options.max_closure_intron ) + else: + opts += ' --no-closure-search' + if options.microexon_search: + opts += ' --microexon-search' + if options.single_paired == 'paired': + opts += ' --mate-std-dev %s' % options.mate_std_dev + if options.initial_read_mismatches: + opts += ' --initial-read-mismatches %d' % int( options.initial_read_mismatches ) + if options.seg_mismatches: + opts += ' --segment-mismatches %d' % int( options.seg_mismatches ) + if options.seg_length: + opts += ' --segment-length %d' % int( options.seg_length ) + if options.min_segment_intron: + opts += ' --min-segment-intron %d' % int( options.min_segment_intron ) + if options.max_segment_intron: + opts += ' --max-segment-intron %d' % int( options.max_segment_intron ) + cmd = cmd % ( opts, index_path, reads ) + except Exception, e: + # Clean up temp dirs + if os.path.exists( tmp_index_dir ): + shutil.rmtree( tmp_index_dir ) + stop_err( 'Something is wrong with the alignment parameters and the alignment could not be run\n' + str( e ) ) + #print cmd + + # Run + try: + tmp_out = tempfile.NamedTemporaryFile().name + tmp_stdout = open( tmp_out, 'wb' ) + tmp_err = tempfile.NamedTemporaryFile().name + tmp_stderr = open( tmp_err, 'wb' ) + print cmd + proc = subprocess.Popen( args=cmd, shell=True, cwd=".", stdout=tmp_stdout, stderr=tmp_stderr ) + returncode = proc.wait() + tmp_stderr.close() + # get stderr, allowing for case where it's very large + tmp_stderr = open( tmp_err, 'rb' ) + stderr = '' + buffsize = 1048576 + try: + while True: + stderr += tmp_stderr.read( buffsize ) + if not stderr or len( stderr ) % buffsize != 0: + break + except OverflowError: + pass + tmp_stdout.close() + tmp_stderr.close() + if returncode != 0: + raise Exception, stderr + + # TODO: look for errors in program output. + except Exception, e: + stop_err( 'Error in tophat:\n' + str( e ) ) + + # Clean up temp dirs + if os.path.exists( tmp_index_dir ): + shutil.rmtree( tmp_index_dir ) + +if __name__=="__main__": __main__()
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tophat_wrapper.xml Thu Jan 23 12:30:49 2014 -0500 @@ -0,0 +1,563 @@ +<tool id="tophat" name="Tophat for Illumina" version="1.5.0"> + <!-- Wrapper compatible with Tophat versions 1.3.0 to 1.4.1 --> + <description>Find splice junctions using RNA-seq data</description> + <version_command>tophat --version</version_command> + <requirements> + <requirement type="package" version="0.1.18">samtools</requirement> + <requirement type="package" version="0.12.7">bowtie</requirement> + <requirement type="package" version="1.4.0">tophat</requirement> + </requirements> + <command interpreter="python"> + tophat_wrapper.py + ## Change this to accommodate the number of threads you have available. + --num-threads="\${GALAXY_SLOTS:-4}" + ## Provide outputs. + --junctions-output=$junctions + --hits-output=$accepted_hits + + ## Handle reference file. + #if $refGenomeSource.genomeSource == "history": + --own-file=$refGenomeSource.ownFile + #else: + --indexes-path="${refGenomeSource.index.fields.path}" + #end if + + ## Are reads single-end or paired? + --single-paired=$singlePaired.sPaired + + ## First input file always required. + --input1=$input1 + + ## Set params based on whether reads are single-end or paired. + #if $singlePaired.sPaired == "single": + --settings=$singlePaired.sParams.sSettingsType + #if $singlePaired.sParams.sSettingsType == "full": + -a $singlePaired.sParams.anchor_length + -m $singlePaired.sParams.splice_mismatches + -i $singlePaired.sParams.min_intron_length + -I $singlePaired.sParams.max_intron_length + -g $singlePaired.sParams.max_multihits + --min-segment-intron $singlePaired.sParams.min_segment_intron + --max-segment-intron $singlePaired.sParams.max_segment_intron + --initial-read-mismatches=$singlePaired.sParams.initial_read_mismatches + --seg-mismatches=$singlePaired.sParams.seg_mismatches + --seg-length=$singlePaired.sParams.seg_length + --library-type=$singlePaired.sParams.library_type + + ## Indel search. + #if $singlePaired.sParams.indel_search.allow_indel_search == "Yes": + ## --allow-indels + --max-insertion-length $singlePaired.sParams.indel_search.max_insertion_length + --max-deletion-length $singlePaired.sParams.indel_search.max_deletion_length + #else: + --no-novel-indels + #end if + + ## Supplying junctions parameters. + #if $singlePaired.sParams.own_junctions.use_junctions == "Yes": + #if $singlePaired.sParams.own_junctions.gene_model_ann.use_annotations == "Yes": + -G $singlePaired.sParams.own_junctions.gene_model_ann.gene_annotation_model + #end if + #if $singlePaired.sParams.own_junctions.raw_juncs.use_juncs == "Yes": + -j $singlePaired.sParams.own_junctions.raw_juncs.raw_juncs + #end if + ## TODO: No idea why a string cast is necessary, but it is: + #if str($singlePaired.sParams.own_junctions.no_novel_juncs) == "Yes": + --no-novel-juncs + #end if + #end if + + #if $singlePaired.sParams.closure_search.use_search == "Yes": + --closure-search + --min-closure-exon $singlePaired.sParams.closure_search.min_closure_exon + --min-closure-intron $singlePaired.sParams.closure_search.min_closure_intron + --max-closure-intron $singlePaired.sParams.closure_search.max_closure_intron + #else: + --no-closure-search + #end if + #if $singlePaired.sParams.coverage_search.use_search == "Yes": + --coverage-search + --min-coverage-intron $singlePaired.sParams.coverage_search.min_coverage_intron + --max-coverage-intron $singlePaired.sParams.coverage_search.max_coverage_intron + #else: + --no-coverage-search + #end if + ## TODO: No idea why the type conversion is necessary, but it seems to be. + #if str($singlePaired.sParams.microexon_search) == "Yes": + --microexon-search + #end if + #end if + #else: + --input2=$singlePaired.input2 + -r $singlePaired.mate_inner_distance + --settings=$singlePaired.pParams.pSettingsType + #if $singlePaired.pParams.pSettingsType == "full": + --mate-std-dev=$singlePaired.pParams.mate_std_dev + -a $singlePaired.pParams.anchor_length + -m $singlePaired.pParams.splice_mismatches + -i $singlePaired.pParams.min_intron_length + -I $singlePaired.pParams.max_intron_length + -g $singlePaired.pParams.max_multihits + --min-segment-intron $singlePaired.pParams.min_segment_intron + --max-segment-intron $singlePaired.pParams.max_segment_intron + --initial-read-mismatches=$singlePaired.pParams.initial_read_mismatches + --seg-mismatches=$singlePaired.pParams.seg_mismatches + --seg-length=$singlePaired.pParams.seg_length + --library-type=$singlePaired.pParams.library_type + + ## Indel search. + #if $singlePaired.pParams.indel_search.allow_indel_search == "Yes": + ## --allow-indels + --max-insertion-length $singlePaired.pParams.indel_search.max_insertion_length + --max-deletion-length $singlePaired.pParams.indel_search.max_deletion_length + #else: + --no-novel-indels + #end if + + ## Supplying junctions parameters. + #if $singlePaired.pParams.own_junctions.use_junctions == "Yes": + #if $singlePaired.pParams.own_junctions.gene_model_ann.use_annotations == "Yes": + -G $singlePaired.pParams.own_junctions.gene_model_ann.gene_annotation_model + #end if + #if $singlePaired.pParams.own_junctions.raw_juncs.use_juncs == "Yes": + -j $singlePaired.pParams.own_junctions.raw_juncs.raw_juncs + #end if + ## TODO: No idea why type cast is necessary, but it is: + #if str($singlePaired.pParams.own_junctions.no_novel_juncs) == "Yes": + --no-novel-juncs + #end if + #end if + + #if $singlePaired.pParams.closure_search.use_search == "Yes": + --closure-search + --min-closure-exon $singlePaired.pParams.closure_search.min_closure_exon + --min-closure-intron $singlePaired.pParams.closure_search.min_closure_intron + --max-closure-intron $singlePaired.pParams.closure_search.max_closure_intron + #else: + --no-closure-search + #end if + #if $singlePaired.pParams.coverage_search.use_search == "Yes": + --coverage-search + --min-coverage-intron $singlePaired.pParams.coverage_search.min_coverage_intron + --max-coverage-intron $singlePaired.pParams.coverage_search.max_coverage_intron + #else: + --no-coverage-search + #end if + ## TODO: No idea why the type conversion is necessary, but it seems to be. + #if str ($singlePaired.pParams.microexon_search) == "Yes": + --microexon-search + #end if + #end if + #end if + </command> + <inputs> + <param format="fastqsanger" name="input1" type="data" label="RNA-Seq FASTQ file" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33" /> + <expand macro="refGenomeSourceConditional"> + <options from_data_table="tophat_indexes"> + <filter type="sort_by" column="2"/> + <validator type="no_options" message="No genomes are available for the selected input dataset"/> + </options> + </expand> + <conditional name="singlePaired"> + <param name="sPaired" type="select" label="Is this library mate-paired?"> + <option value="single">Single-end</option> + <option value="paired">Paired-end</option> + </param> + <when value="single"> + <conditional name="sParams"> + <param name="sSettingsType" type="select" label="TopHat settings to use" help="Use the Full parameter list to change default settings."> + <option value="preSet">Default settings</option> + <option value="full">Full parameter list</option> + </param> + <when value="preSet" /> + <!-- Full/advanced params. --> + <when value="full"> + <param name="library_type" type="select" label="Library Type" help="TopHat will treat the reads as strand specific. Every read alignment will have an XS attribute tag. Consider supplying library type options below to select the correct RNA-seq protocol."> + <option value="fr-unstranded">FR Unstranded</option> + <option value="fr-firststrand">FR First Strand</option> + <option value="fr-secondstrand">FR Second Strand</option> + </param> + <param name="anchor_length" type="integer" value="8" label="Anchor length (at least 3)" help="Report junctions spanned by reads with at least this many bases on each side of the junction." /> + <param name="splice_mismatches" type="integer" value="0" label="Maximum number of mismatches that can appear in the anchor region of spliced alignment" /> + <param name="min_intron_length" type="integer" value="70" label="The minimum intron length" help="TopHat will ignore donor/acceptor pairs closer than this many bases apart." /> + <param name="max_intron_length" type="integer" value="500000" label="The maximum intron length" help="When searching for junctions ab initio, TopHat will ignore donor/acceptor pairs farther than this many bases apart, except when such a pair is supported by a split segment alignment of a long read." /> + <conditional name="indel_search"> + <param name="allow_indel_search" type="select" label="Allow indel search"> + <option value="Yes">Yes</option> + <option value="No">No</option> + </param> + <when value="No"/> + <when value="Yes"> + <param name="max_insertion_length" type="integer" value="3" label="Max insertion length." help="The maximum insertion length." /> + <param name="max_deletion_length" type="integer" value="3" label="Max deletion length." help="The maximum deletion length." /> + </when> + </conditional> +alignments (number of reads divided by average depth of coverage)" help="0.0 to 1.0 (0 to turn off)" /> + <param name="max_multihits" type="integer" value="20" label="Maximum number of alignments to be allowed" /> + <param name="min_segment_intron" type="integer" value="50" label="Minimum intron length that may be found during split-segment (default) search" /> + <param name="max_segment_intron" type="integer" value="500000" label="Maximum intron length that may be found during split-segment (default) search" /> + <param name="initial_read_mismatches" type="integer" min="0" value="2" label="Number of mismatches allowed in the initial read mapping" /> + <param name="seg_mismatches" type="integer" min="0" max="3" value="2" label="Number of mismatches allowed in each segment alignment for reads mapped independently" /> + <param name="seg_length" type="integer" value="25" label="Minimum length of read segments" /> + + <!-- Options for supplying own junctions. --> + <conditional name="own_junctions"> + <param name="use_junctions" type="select" label="Use Own Junctions"> + <option value="No">No</option> + <option value="Yes">Yes</option> + </param> + <when value="Yes"> + <conditional name="gene_model_ann"> + <param name="use_annotations" type="select" label="Use Gene Annotation Model"> + <option value="No">No</option> + <option value="Yes">Yes</option> + </param> + <when value="No" /> + <when value="Yes"> + <param format="gtf,gff3" name="gene_annotation_model" type="data" label="Gene Model Annotations" help="TopHat will use the exon records in this file to build a set of known splice junctions for each gene, and will attempt to align reads to these junctions even if they would not normally be covered by the initial mapping."/> + </when> + </conditional> + <conditional name="raw_juncs"> + <param name="use_juncs" type="select" label="Use Raw Junctions"> + <option value="No">No</option> + <option value="Yes">Yes</option> + </param> + <when value="No" /> + <when value="Yes"> + <param format="interval" name="raw_juncs" type="data" label="Raw Junctions" help="Supply TopHat with a list of raw junctions. Junctions are specified one per line, in a tab-delimited format. Records look like: [chrom] [left] [right] [+/-] left and right are zero-based coordinates, and specify the last character of the left sequenced to be spliced to the first character of the right sequence, inclusive."/> + </when> + </conditional> + <param name="no_novel_juncs" type="select" label="Only look for supplied junctions"> + <option value="No">No</option> + <option value="Yes">Yes</option> + </param> + </when> + <when value="No" /> + </conditional> <!-- /own_junctions --> + + <!-- Closure search. --> + <conditional name="closure_search"> + <param name="use_search" type="select" label="Use Closure Search"> + <option value="No">No</option> + <option value="Yes">Yes</option> + </param> + <when value="Yes"> + <param name="min_closure_exon" type="integer" value="50" label="During closure search for paired end reads, exonic hops in the potential splice graph must be at least this long. The default is 50." /> + <param name="min_closure_intron" type="integer" value="50" label="Minimum intron length that may be found during closure search" /> + <param name="max_closure_intron" type="integer" value="5000" label="Maximum intron length that may be found during closure search" /> + </when> + <when value="No" /> + </conditional> + <!-- Coverage search. --> + <conditional name="coverage_search"> + <param name="use_search" type="select" label="Use Coverage Search"> + <option selected="true" value="Yes">Yes</option> + <option value="No">No</option> + </param> + <when value="Yes"> + <param name="min_coverage_intron" type="integer" value="50" label="Minimum intron length that may be found during coverage search" /> + <param name="max_coverage_intron" type="integer" value="20000" label="Maximum intron length that may be found during coverage search" /> + </when> + <when value="No" /> + </conditional> + <param name="microexon_search" type="select" label="Use Microexon Search" help="With this option, the pipeline will attempt to find alignments incident to microexons. Works only for reads 50bp or longer."> + <option value="No">No</option> + <option value="Yes">Yes</option> + </param> + </when> <!-- full --> + </conditional> <!-- sParams --> + </when> <!-- single --> + <when value="paired"> + <param format="fastqsanger" name="input2" type="data" label="RNA-Seq FASTQ file" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33" /> + <param name="mate_inner_distance" type="integer" value="20" label="Mean Inner Distance between Mate Pairs" /> + <conditional name="pParams"> + <param name="pSettingsType" type="select" label="TopHat settings to use" help="Use the Full parameter list to change default settings."> + <option value="preSet">Default settings</option> + <option value="full">Full parameter list</option> + </param> + <when value="preSet" /> + <!-- Full/advanced params. --> + <when value="full"> + <param name="library_type" type="select" label="Library Type" help="TopHat will treat the reads as strand specific. Every read alignment will have an XS attribute tag. Consider supplying library type options below to select the correct RNA-seq protocol."> + <option value="fr-unstranded">FR Unstranded</option> + <option value="fr-firststrand">FR First Strand</option> + <option value="fr-secondstrand">FR Second Strand</option> + </param> + <param name="mate_std_dev" type="integer" value="20" label="Std. Dev for Distance between Mate Pairs" help="The standard deviation for the distribution on inner distances between mate pairs."/> + <param name="anchor_length" type="integer" value="8" label="Anchor length (at least 3)" help="Report junctions spanned by reads with at least this many bases on each side of the junction." /> + <param name="splice_mismatches" type="integer" value="0" label="Maximum number of mismatches that can appear in the anchor region of spliced alignment" /> + <param name="min_intron_length" type="integer" value="70" label="The minimum intron length" help="TopHat will ignore donor/acceptor pairs closer than this many bases apart." /> + <param name="max_intron_length" type="integer" value="500000" label="The maximum intron length" help="When searching for junctions ab initio, TopHat will ignore donor/acceptor pairs farther than this many bases apart, except when such a pair is supported by a split segment alignment of a long read." /> + <expand macro="indel_searchConditional" /> + <param name="max_multihits" type="integer" value="20" label="Maximum number of alignments to be allowed" /> + <param name="min_segment_intron" type="integer" value="50" label="Minimum intron length that may be found during split-segment (default) search" /> + <param name="max_segment_intron" type="integer" value="500000" label="Maximum intron length that may be found during split-segment (default) search" /> + <param name="initial_read_mismatches" type="integer" min="0" value="2" label="Number of mismatches allowed in the initial read mapping" /> + <param name="seg_mismatches" type="integer" min="0" max="3" value="2" label="Number of mismatches allowed in each segment alignment for reads mapped independently" /> + <param name="seg_length" type="integer" value="25" label="Minimum length of read segments" /> + <!-- Options for supplying own junctions. --> + <expand macro="own_junctionsConditional" /> + <!-- Closure search. --> + <conditional name="closure_search"> + <param name="use_search" type="select" label="Use Closure Search"> + <option value="No">No</option> + <option value="Yes">Yes</option> + </param> + <when value="Yes"> + <param name="min_closure_exon" type="integer" value="50" label="During closure search for paired end reads, exonic hops in the potential splice graph must be at least this long. The default is 50." /> + <param name="min_closure_intron" type="integer" value="50" label="Minimum intron length that may be found during closure search" /> + <param name="max_closure_intron" type="integer" value="5000" label="Maximum intron length that may be found during closure search" /> + </when> + <when value="No" /> + </conditional> + <!-- Coverage search. --> + <conditional name="coverage_search"> + <param name="use_search" type="select" label="Use Coverage Search"> + <option selected="true" value="Yes">Yes</option> + <option value="No">No</option> + </param> + <when value="Yes"> + <param name="min_coverage_intron" type="integer" value="50" label="Minimum intron length that may be found during coverage search" /> + <param name="max_coverage_intron" type="integer" value="20000" label="Maximum intron length that may be found during coverage search" /> + </when> + <when value="No" /> + </conditional> + <param name="microexon_search" type="select" label="Use Microexon Search" help="With this option, the pipeline will attempt to find alignments incident to microexons. Works only for reads 50bp or longer."> + <option value="No">No</option> + <option value="Yes">Yes</option> + </param> + </when> <!-- full --> + </conditional> <!-- pParams --> + </when> <!-- paired --> + </conditional> + </inputs> + + <outputs> + <data format="bed" name="insertions" label="${tool.name} on ${on_string}: insertions" from_work_dir="tophat_out/insertions.bed"> + <expand macro="dbKeyActions" /> + </data> + <data format="bed" name="deletions" label="${tool.name} on ${on_string}: deletions" from_work_dir="tophat_out/deletions.bed"> + <expand macro="dbKeyActions" /> + </data> + <data format="bed" name="junctions" label="${tool.name} on ${on_string}: splice junctions" from_work_dir="tophat_out/junctions.bed"> + <expand macro="dbKeyActions" /> + </data> + <data format="bam" name="accepted_hits" label="${tool.name} on ${on_string}: accepted_hits" from_work_dir="tophat_out/accepted_hits.bam"> + <expand macro="dbKeyActions" /> + </data> + </outputs> + <macros> + <import>tophat_macros.xml</import> + <macro name="dbKeyActions"> + <actions> + <conditional name="refGenomeSource.genomeSource"> + <when value="indexed"> + <action type="metadata" name="dbkey"> + <option type="from_data_table" name="tophat_indexes" column="1" offset="0"> + <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/> + <filter type="param_value" ref="refGenomeSource.index" column="0"/> + </option> + </action> + </when> + <when value="history"> + <action type="metadata" name="dbkey"> + <option type="from_param" name="refGenomeSource.ownFile" param_attribute="dbkey" /> + </action> + </when> + </conditional> + </actions> + </macro> + </macros> + <tests> + <!-- Test base-space single-end reads with pre-built index and preset parameters --> + <test> + <!-- TopHat commands: + tophat -o tmp_dir -p 1 tophat_in1 test-data/tophat_in2.fastqsanger + Rename the files in tmp_dir appropriately + --> + <param name="input1" ftype="fastqsanger" value="tophat_in2.fastqsanger" /> + <param name="genomeSource" value="indexed" /> + <param name="index" value="tophat_test" /> + <param name="sPaired" value="single" /> + <param name="sSettingsType" value="preSet" /> + <output name="junctions" file="tophat_out1j.bed" /> + <output name="accepted_hits" file="tophat_out1h.bam" compare="sim_size" /> + </test> + <!-- Test using base-space test data: paired-end reads, index from history. --> + <test> + <!-- TopHat commands: + bowtie-build -f test-data/tophat_in1.fasta tophat_in1 + tophat -o tmp_dir -p 1 -r 20 tophat_in1 test-data/tophat_in2.fastqsanger test-data/tophat_in3.fastqsanger + Rename the files in tmp_dir appropriately + --> + <param name="input1" ftype="fastqsanger" value="tophat_in2.fastqsanger" /> + <param name="genomeSource" value="history" /> + <param name="ownFile" ftype="fasta" value="tophat_in1.fasta" /> + <param name="sPaired" value="paired" /> + <param name="input2" ftype="fastqsanger" value="tophat_in3.fastqsanger" /> + <param name="mate_inner_distance" value="20" /> + <param name="pSettingsType" value="preSet" /> + <output name="junctions" file="tophat_out2j.bed" /> + <output name="accepted_hits" file="tophat_out2h.bam" compare="sim_size" /> + </test> + <!-- Test base-space single-end reads with user-supplied reference fasta and full parameters --> + <test> + <!-- Tophat commands: + bowtie-build -f test-data/tophat_in1.fasta tophat_in1 + tophat -o tmp_dir -p 1 -a 8 -m 0 -i 70 -I 500000 -g 40 +coverage-search +min-coverage-intron 50 +max-coverage-intro 20000 +segment-mismatches 2 +segment-length 25 +closure-search +min-closure-exon 50 +min-closure-intron 50 +max-closure-intro 5000 +microexon-search tophat_in1 test-data/tophat_in2.fastqsanger + Replace the + with double-dash + Rename the files in tmp_dir appropriately + --> + <param name="input1" ftype="fastqsanger" value="tophat_in2.fastqsanger"/> + <param name="genomeSource" value="history"/> + <param name="ownFile" value="tophat_in1.fasta"/> + <param name="sPaired" value="single"/> + <param name="sSettingsType" value="full"/> + <param name="library_type" value="FR Unstranded"/> + <param name="anchor_length" value="8"/> + <param name="splice_mismatches" value="0"/> + <param name="min_intron_length" value="70"/> + <param name="max_intron_length" value="500000"/> + <param name="max_multihits" value="40"/> + <param name="min_segment_intron" value="50" /> + <param name="max_segment_intron" value="500000" /> + <param name="seg_mismatches" value="2"/> + <param name="seg_length" value="25"/> + <param name="allow_indel_search" value="Yes"/> + <param name="max_insertion_length" value="3"/> + <param name="max_deletion_length" value="3"/> + <param name="use_junctions" value="Yes" /> + <param name="use_annotations" value="No" /> + <param name="use_juncs" value="No" /> + <param name="no_novel_juncs" value="No" /> + <param name="use_search" value="Yes" /> + <param name="min_closure_exon" value="50" /> + <param name="min_closure_intron" value="50" /> + <param name="max_closure_intron" value="5000" /> + <param name="use_search" value="Yes" /> + <param name="min_coverage_intron" value="50" /> + <param name="max_coverage_intron" value="20000" /> + <param name="microexon_search" value="Yes" /> + <output name="insertions" file="tophat_out3i.bed" /> + <output name="deletions" file="tophat_out3d.bed" /> + <output name="junctions" file="tophat_out3j.bed" /> + <output name="accepted_hits" file="tophat_out3h.bam" compare="sim_size" /> + </test> + <!-- Test base-space paired-end reads with user-supplied reference fasta and full parameters --> + <test> + <!-- TopHat commands: + tophat -o tmp_dir -r 20 -p 1 -a 8 -m 0 -i 70 -I 500000 -g 40 +coverage-search +min-coverage-intron 50 +max-coverage-intro 20000 +segment-mismatches 2 +segment-length 25 +microexon-search tophat_in1 test-data/tophat_in2.fastqsanger test-data/tophat_in3.fastqsanger + Replace the + with double-dash + Rename the files in tmp_dir appropriately + --> + <param name="input1" ftype="fastqsanger" value="tophat_in2.fastqsanger"/> + <param name="genomeSource" value="indexed"/> + <param name="index" value="tophat_test"/> + <param name="sPaired" value="paired"/> + <param name="input2" ftype="fastqsanger" value="tophat_in3.fastqsanger"/> + <param name="mate_inner_distance" value="20"/> + <param name="pSettingsType" value="full"/> + <param name="library_type" value="FR Unstranded"/> + <param name="mate_std_dev" value="20"/> + <param name="anchor_length" value="8"/> + <param name="splice_mismatches" value="0"/> + <param name="min_intron_length" value="70"/> + <param name="max_intron_length" value="500000"/> + <param name="max_multihits" value="40"/> + <param name="min_segment_intron" value="50" /> + <param name="max_segment_intron" value="500000" /> + <param name="seg_mismatches" value="2"/> + <param name="seg_length" value="25"/> + <param name="allow_indel_search" value="No"/> + <param name="use_junctions" value="Yes" /> + <param name="use_annotations" value="No" /> + <param name="use_juncs" value="No" /> + <param name="no_novel_juncs" value="No" /> + <param name="use_search" value="No" /> + <param name="microexon_search" value="Yes" /> + <output name="junctions" file="tophat_out4j.bed" /> + <output name="accepted_hits" file="tophat_out4h.bam" compare="sim_size" /> + </test> + </tests> + + <help> +**Tophat Overview** + +TopHat_ is a fast splice junction mapper for RNA-Seq reads. It aligns RNA-Seq reads to mammalian-sized genomes using the ultra high-throughput short read aligner Bowtie, and then analyzes the mapping results to identify splice junctions between exons. Please cite: Trapnell, C., Pachter, L. and Salzberg, S.L. TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 25, 1105-1111 (2009). + +.. _Tophat: http://tophat.cbcb.umd.edu/ + +------ + +**Know what you are doing** + +.. class:: warningmark + +There is no such thing (yet) as an automated gearshift in splice junction identification. It is all like stick-shift driving in San Francisco. In other words, running this tool with default parameters will probably not give you meaningful results. A way to deal with this is to **understand** the parameters by carefully reading the `documentation`__ and experimenting. Fortunately, Galaxy makes experimenting easy. + +.. __: http://tophat.cbcb.umd.edu/manual.html + +------ + +**Input formats** + +Tophat accepts files in Sanger FASTQ format. Use the FASTQ Groomer to prepare your files. + +------ + +**Outputs** + +Tophat produces two output files: + +- junctions -- A UCSC BED_ track of junctions reported by TopHat. Each junction consists of two connected BED blocks, where each block is as long as the maximal overhang of any read spanning the junction. The score is the number of alignments spanning the junction. +- accepted_hits -- A list of read alignments in BAM_ format. + +.. _BED: http://genome.ucsc.edu/FAQ/FAQformat.html#format1 +.. _BAM: http://samtools.sourceforge.net/ + +Two other possible outputs, depending on the options you choose, are insertions and deletions, both of which are in BED format. + +------- + +**Tophat settings** + +All of the options have a default value. You can change any of them. Some of the options in Tophat have been implemented here. + +------ + +**Tophat parameter list** + +This is a list of implemented Tophat options:: + + -r This is the expected (mean) inner distance between mate pairs. For, example, for paired end runs with fragments + selected at 300bp, where each end is 50bp, you should set -r to be 200. There is no default, and this parameter + is required for paired end runs. + --mate-std-dev INT The standard deviation for the distribution on inner distances between mate pairs. The default is 20bp. + -a/--min-anchor-length INT The "anchor length". TopHat will report junctions spanned by reads with at least this many bases on each side of the junction. Note that individual spliced + alignments may span a junction with fewer than this many bases on one side. However, every junction involved in spliced alignments is supported by at least one + read with this many bases on each side. This must be at least 3 and the default is 8. + -m/--splice-mismatches INT The maximum number of mismatches that may appear in the "anchor" region of a spliced alignment. The default is 0. + -i/--min-intron-length INT The minimum intron length. TopHat will ignore donor/acceptor pairs closer than this many bases apart. The default is 70. + -I/--max-intron-length INT The maximum intron length. When searching for junctions ab initio, TopHat will ignore donor/acceptor pairs farther than this many bases apart, except when such a pair is supported by a split segment alignment of a long read. The default is 500000. + -g/--max-multihits INT Instructs TopHat to allow up to this many alignments to the reference for a given read, and suppresses all alignments for reads with more than this many + alignments. The default is 40. + -G/--GTF [GTF 2.2 file] Supply TopHat with a list of gene model annotations. TopHat will use the exon records in this file to build a set of known splice junctions for each gene, and will attempt to align reads to these junctions even if they would not normally be covered by the initial mapping. + -j/--raw-juncs [juncs file] Supply TopHat with a list of raw junctions. Junctions are specified one per line, in a tab-delimited format. Records look like: [chrom] [left] [right] [+/-], left and right are zero-based coordinates, and specify the last character of the left sequenced to be spliced to the first character of the right sequence, inclusive. + -no-novel-juncs Only look for junctions indicated in the supplied GFF file. (ignored without -G) + --no-closure-search Disables the mate pair closure-based search for junctions. Currently, has no effect - closure search is off by default. + --closure-search Enables the mate pair closure-based search for junctions. Closure-based search should only be used when the expected inner distance between mates is small (about or less than 50bp) + --no-coverage-search Disables the coverage based search for junctions. + --coverage-search Enables the coverage based search for junctions. Use when coverage search is disabled by default (such as for reads 75bp or longer), for maximum sensitivity. + --microexon-search With this option, the pipeline will attempt to find alignments incident to microexons. Works only for reads 50bp or longer. + --butterfly-search TopHat will use a slower but potentially more sensitive algorithm to find junctions in addition to its standard search. Consider using this if you expect that your experiment produced a lot of reads from pre-mRNA, that fall within the introns of your transcripts. + --segment-mismatches Read segments are mapped independently, allowing up to this many mismatches in each segment alignment. The default is 2. + --segment-length Each read is cut up into segments, each at least this long. These segments are mapped independently. The default is 25. + --min-closure-exon During closure search for paired end reads, exonic hops in the potential splice graph must be at least this long. The default is 50. + --min-closure-intron The minimum intron length that may be found during closure search. The default is 50. + --max-closure-intron The maximum intron length that may be found during closure search. The default is 5000. + --min-coverage-intron The minimum intron length that may be found during coverage search. The default is 50. + --max-coverage-intron The maximum intron length that may be found during coverage search. The default is 20000. + --min-segment-intron The minimum intron length that may be found during split-segment search. The default is 50. + --max-segment-intron The maximum intron length that may be found during split-segment search. The default is 500000. + </help> +</tool>