Mercurial > repos > devteam > tabular_to_fastq

changeset 0:9ae652b76979 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Imported from capsule None
author devteam
date Thu, 23 Jan 2014 12:31:40 -0500
parents
children 7bde4f066435
files tabular_to_fastq.py tabular_to_fastq.xml test-data/fastq_to_tabular_out_1.tabular test-data/fastq_to_tabular_out_2.tabular test-data/sanger_full_range_as_cssanger.fastqcssanger test-data/sanger_full_range_original_sanger.fastqsanger tool_dependencies.xml
diffstat 7 files changed, 102 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tabular_to_fastq.py	Thu Jan 23 12:31:40 2014 -0500
@@ -0,0 +1,29 @@
+#Dan Blankenberg
+import sys
+
+def main():
+    input_filename = sys.argv[1]
+    output_filename = sys.argv[2]
+    identifier_col = int( sys.argv[3] ) - 1
+    sequence_col = int( sys.argv[4] ) - 1
+    quality_col = int( sys.argv[5] ) - 1
+    
+    max_col = max( identifier_col, sequence_col, quality_col )
+    num_reads = None
+    fastq_read = None
+    skipped_lines = 0
+    out = open( output_filename, 'wb' )
+    for num_reads, line in enumerate( open( input_filename ) ):
+        fields = line.rstrip( '\n\r' ).split( '\t' )
+        if len( fields ) > max_col:
+            out.write( "@%s\n%s\n+\n%s\n" % ( fields[identifier_col], fields[sequence_col], fields[quality_col] ) )
+        else:
+            skipped_lines += 1
+    
+    out.close()
+    if num_reads is None:
+        print "Input was empty."
+    else:
+        print "%i tabular lines were written as FASTQ reads. Be sure to use the FASTQ Groomer tool on this output before further analysis." % ( num_reads + 1 - skipped_lines )
+    
+if __name__ == "__main__": main()
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tabular_to_fastq.xml	Thu Jan 23 12:31:40 2014 -0500
@@ -0,0 +1,47 @@
+<tool id="tabular_to_fastq" name="Tabular to FASTQ" version="1.0.0">
+  <description>converter</description>
+  <requirements>
+    <requirement type="package" version="1.0.0">galaxy_sequence_utils</requirement>
+  </requirements>
+  <command interpreter="python">tabular_to_fastq.py '$input_file' '$output_file' '$identifier' '$sequence' '$quality'</command>
+  <inputs>
+    <param name="input_file" type="data" format="tabular" label="Tabular file to convert" />
+    <param name="identifier" label="Identifier column" type="data_column" data_ref="input_file" />
+    <param name="sequence" label="Sequence column" type="data_column" data_ref="input_file" />
+    <param name="quality" label="Quality column" type="data_column" data_ref="input_file" />
+  </inputs>
+  <outputs>
+    <data name="output_file" format="fastq" />
+  </outputs>
+  <tests>
+    <!-- basic test -->
+    <test>
+      <param name="input_file" value="fastq_to_tabular_out_1.tabular" ftype="tabular" />
+      <param name="identifier" value="1" />
+      <param name="sequence" value="2" />
+      <param name="quality" value="3" />
+      <output name="output_file" file="sanger_full_range_original_sanger.fastqsanger" />
+    </test>
+    <!-- color space test -->
+    <test>
+      <param name="input_file" value="fastq_to_tabular_out_2.tabular" ftype="tabular" />
+      <param name="identifier" value="1" />
+      <param name="sequence" value="2" />
+      <param name="quality" value="3" />
+      <output name="output_file" file="sanger_full_range_as_cssanger.fastqcssanger" />
+    </test>
+  </tests>
+  <help>
+**What it does**
+
+This tool attempts to convert a tabular file containing sequencing read data to a FASTQ formatted file. The FASTQ Groomer tool should always be used on the output of this tool. 
+
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. &lt;http://www.ncbi.nlm.nih.gov/pubmed/20562416&gt;`_
+
+
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fastq_to_tabular_out_1.tabular	Thu Jan 23 12:31:40 2014 -0500
@@ -0,0 +1,2 @@
+FAKE0001 Original version has PHRED scores from 0 to 93 inclusive (in that order)	ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTAC	!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
+FAKE0002 Original version has PHRED scores from 93 to 0 inclusive (in that order)	CATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCA	~}|{zyxwvutsrqponmlkjihgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fastq_to_tabular_out_2.tabular	Thu Jan 23 12:31:40 2014 -0500
@@ -0,0 +1,2 @@
+FAKE0001 Original version has PHRED scores from 0 to 93 inclusive (in that order)	G2131313131313131313131313131313131313131313131313131313131313131313131313131313131313131313131	!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
+FAKE0002 Original version has PHRED scores from 93 to 0 inclusive (in that order)	G3131313131313131313131313131313131313131313131313131313131313131313131313131313131313131313131	~}|{zyxwvutsrqponmlkjihgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sanger_full_range_as_cssanger.fastqcssanger	Thu Jan 23 12:31:40 2014 -0500
@@ -0,0 +1,8 @@
+@FAKE0001 Original version has PHRED scores from 0 to 93 inclusive (in that order)
+G2131313131313131313131313131313131313131313131313131313131313131313131313131313131313131313131
++
+!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
+@FAKE0002 Original version has PHRED scores from 93 to 0 inclusive (in that order)
+G3131313131313131313131313131313131313131313131313131313131313131313131313131313131313131313131
++
+~}|{zyxwvutsrqponmlkjihgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sanger_full_range_original_sanger.fastqsanger	Thu Jan 23 12:31:40 2014 -0500
@@ -0,0 +1,8 @@
+@FAKE0001 Original version has PHRED scores from 0 to 93 inclusive (in that order)
+ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTAC
++
+!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
+@FAKE0002 Original version has PHRED scores from 93 to 0 inclusive (in that order)
+CATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCA
++
+~}|{zyxwvutsrqponmlkjihgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml	Thu Jan 23 12:31:40 2014 -0500
@@ -0,0 +1,6 @@
+<?xml version="1.0"?>
+<tool_dependency>
+  <package name="galaxy_sequence_utils" version="1.0.0">
+      <repository changeset_revision="195699b1562a" name="package_galaxy_utils_1_0" owner="devteam" prior_installation_required="False" toolshed="http://testtoolshed.g2.bx.psu.edu" />
+    </package>
+</tool_dependency>