Mercurial > repos > devteam > quality_filter
diff quality_filter.xml @ 0:5da8dce9fd62 draft
Imported from capsule None
author | devteam |
---|---|
date | Tue, 01 Apr 2014 09:13:08 -0400 |
parents | |
children | 0c48b354dcfe |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/quality_filter.xml Tue Apr 01 09:13:08 2014 -0400 @@ -0,0 +1,119 @@ +<tool id="qualityFilter" name="Filter nucleotides" version="1.0.1"> + <description> based on quality scores</description> + <requirements> + <requirement type="package" version="0.7.1">bx-python</requirement> + <requirement type="package" version="1.7.1">numpy</requirement> + </requirements> + <command interpreter="python"> + quality_filter.py + $input + $out_file1 + $primary_species + $mask_species + $score + $mask_char + ${mask_region.region} + #if $mask_region.region == "3" + ${mask_region.lengthr},${mask_region.lengthl} + #elif $mask_region.region == "0" + 1 + #else + ${mask_region.length} + #end if + ${GALAXY_DATA_INDEX_DIR}/quality_scores.loc + </command> + <inputs> + <param format="maf" name="input" type="data" label="Select data"/> + <param name="primary_species" type="select" label="Use quality scores of" display="checkboxes" multiple="true"> + <options> + <filter type="data_meta" ref="input" key="species" /> + </options> + </param> + <param name="mask_species" type="select" label="Mask Species" display="checkboxes" multiple="true"> + <options> + <filter type="data_meta" ref="input" key="species" /> + </options> + </param> + <param name="score" size="10" type="integer" value="20" label="Quality score cut-off" help="Cut-off value of 20 means mask all nucleotides having quality score less than or equal to 20"/> + <param name="mask_char" size="5" type="select" label="Mask character"> + <option value="0" selected="true">#</option> + <option value="1">$</option> + <option value="2">^</option> + <option value="3">*</option> + <option value="4">?</option> + <option value="5">N</option> + </param> + <conditional name="mask_region"> + <param name="region" type="select" label="Mask region"> + <option value="0" selected="true">Only the corresponding nucleotide </option> + <option value="1">Corresponding column + right-side neighbors</option> + <option value="2">Corresponding column + left-side neighbors</option> + <option value="3">Corresponding column + neighbors on both sides</option> + </param> + <when value="0"> + </when> + <when value="1"> + <param name="length" size="10" type="integer" value="2" label="Number of right-side neighbors"/> + </when> + <when value="2"> + <param name="length" size="10" type="integer" value="2" label="Number of left-side neighbors"/> + </when> + <when value="3"> + <param name="lengthr" size="10" type="integer" value="2" label="Number of neighbors on right-side" /> + <param name="lengthl" size="10" type="integer" value="2" label="Number of neighbors on left-side" /> + </when> + </conditional> + </inputs> + <outputs> + <data format="maf" name="out_file1" metadata_source="input"/> + </outputs> + <requirements> + <requirement type="python-module">numpy</requirement> + </requirements> + <tests> + <test> + <param name="input" value="6.maf"/> + <param name="primary_species" value="panTro2"/> + <param name="mask_species" value="hg18"/> + <param name="score" value="50"/> + <param name="mask_char" value="0"/> + <param name="region" value="0" /> + <output name="out_file1" file="6_quality_filter.maf"/> + </test> + </tests> + <help> + +.. class:: infomark + +**What it does** + +This tool takes a MAF file as input and filters nucleotides in every alignment block of the MAF file based on their quality/PHRED scores. + +----- + +.. class:: warningmark + +**Note** + +Any block/s not containing the primary species (species whose quality scores is to be used), will be omitted. +Also, any primary species whose quality scores are not available in Galaxy will be considered as a non-primary species. This info will appear as a message in the job history panel. + +----- + +**Example** + +- For the following alignment block:: + + a score=4050.0 + s hg18.chrX 3719221 48 - 154913754 tattttacatttaaaataaatatgtaaatatatattttatatttaaaa + s panTro2.chrX 3560945 48 - 155361357 tattttatatttaaaataaagatgtaaatatatattttatatttaaaa + +- running this tool with **Primary species as panTro2**, **Mask species as hg18, panTro2**, **Quality cutoff as 20**, **Mask character as #** and **Mask region as only the corresponding position** will return:: + + a score=4050.0 + s hg18.chrX 3719221 48 - 154913754 ###tttac#####a###a#atatgtaaat###tattt#####ttaaaa + s panTro2.chrX 3560945 48 - 155361357 ###tttat#####a###a#agatgtaaat###tattt#####ttaaaa + + where, the positions containing # represent panTro2 nucleotides having quality scores less than 20. + </help> +</tool>