Mercurial > repos > devteam > lda_analysis

changeset 1:423bcc3a3785 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded correct tarball.
author devteam
date Mon, 28 Jul 2014 11:41:28 -0400
parents 2a8638f0c47e
children cf85ea165ce0
files MINE.xml lda_analy.xml mine_wrapper.py r_wrapper.sh test-data/lda_analy_output.txt test-data/matrix_generator_for_pc_and_lda_output.tabular tool_dependencies.xml
diffstat 7 files changed, 535 insertions(+), 169 deletions(-) [+]
line wrap: on
line diff
--- a/MINE.xml	Mon Jul 28 11:30:31 2014 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,82 +0,0 @@
-<tool id="maximal_information_based_nonparametric_exploration" name="MINE" version="0.0.1">
-  <description>- Maximal Information-based Nonparametric Exploration</description>
-  <requirements>
-      <requirement type="package" version="1.0.1">MINE</requirement>
-  </requirements>
-  <command interpreter="python">mine_wrapper.py
-    --jar "\${JAVA_JAR_PATH}/MINE.jar" 
-    
-    --infile "${input_file}"
-    
-    #if str( $master_variable_type.master_variable_type_selector ) in [ 'allPairs', 'adjacentPairs' ]:
-      --master_variable "${master_variable_type.master_variable_type_selector}"
-    #else:
-        --master_variable "${master_variable_type.master_variable}"
-    #end if
-    
-    --cv "${cv}"
-    
-    --exp "${exp}"
-    
-    --c "${c}"
-    
-    ##--gc ##skip
-    
-    
-    #if str( $master_variable_type.master_variable_type_selector ) != 'allPairs' and $master_variable_type.permute:
-      --permute
-    #end if
-    
-    --output_results "${output_results}"
-    
-    --output_log "${output_log}"
-  </command>
-  <inputs>
-    <param name="input_file" type="data" format="csv" label="CSV file" />
-    
-    <conditional name="master_variable_type">
-      <param name="master_variable_type_selector" type="select" label="Choose the master variable type">
-        <option value="allPairs">allPairs</option>
-        <option value="adjacentPairs">adjacentPairs</option>
-        <option value="compare_against_ith" selected="True">compare against i-th</option>
-      </param>
-      <when value="compare_against_ith">
-        <param type="integer" value="0" name="master_variable" />
-        <param type="boolean" truevalue="--permute" false_value="" name="permute" checked="False" />
-      </when>
-      <when value="adjacentPairs">
-        <param type="boolean" truevalue="--permute" false_value="" name="permute" checked="False" />
-      </when>
-    </conditional>
-    
-    <param type="float" value="0" name="cv" />
-    
-    <param type="float" value="0.6" name="exp" />
-    
-    <param type="float" value="15" name="c" />
-    
-  </inputs>
-  <outputs>
-    <data format="csv" name="output_results" label="${tool.name} on ${on_string} (Results)" />
-    <data format="txt" name="output_log" label="${tool.name} on ${on_string} (log)" />
-  </outputs>
-  <tests>
-      <!-- TODO -->
-  </tests>
-  <help>
-**What it does**
-
-Applies the Maximal Information-based Nonparametric Exploration strategy to an input dataset.
-
-See http://www.exploredata.net/ for more information.
-
-------
-
-**Citation**
-
-For the underlying tool, please cite `David N. Reshef, Yakir A. Reshef, Hilary K. Finucane5, Sharon R. Grossman, Gilean McVean, Peter J. Turnbaugh, Eric S. Lander, Michael Mitzenmacher, Pardis C. Sabeti Detecting Novel Associations in Large Data Sets. Science. 2011 Dec. &lt;http://www.sciencemag.org/content/334/6062/1518&gt;`_
-
-If you use this tool in Galaxy, please cite Blankenberg D, et al. *In preparation.*
-
-  </help>
-</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/lda_analy.xml	Mon Jul 28 11:41:28 2014 -0400
@@ -0,0 +1,288 @@
+<tool id="lda_analy1" name="Perform LDA" version="1.0.1">
+	<description>Linear Discriminant Analysis</description>
+    <requirements>
+      <requirement type="package" version="2.11.0">R</requirement>
+    </requirements>
+	<command interpreter="sh">r_wrapper.sh $script_file</command>
+	<inputs>
+		<param format="tabular" name="input" type="data" label="Source file"/>
+		<param name="cond" size="30" type="integer" value="3" label="Number of principal components" help="See TIP below">
+			<validator type="empty_field" message="Enter a valid number of principal components, see syntax below for examples"/>
+		</param>
+
+	</inputs>
+	<outputs>
+		<data format="txt" name="output" />
+	</outputs>
+
+	<tests>
+		<test>
+			<param name="input" value="matrix_generator_for_pc_and_lda_output.tabular"/>
+			<output name="output" file="lda_analy_output.txt"/>
+			<param name="cond" value="2"/>
+
+		</test>
+	</tests>
+
+	<configfiles>
+        	<configfile name="script_file">
+
+        rm(list = objects() )
+
+        ############# FORMAT X DATA #########################
+        format&lt;-function(data) {
+            ind=NULL
+            for(i in 1 : ncol(data)){
+                if (is.na(data[nrow(data),i])) {
+                    ind&lt;-c(ind,i)
+                }
+            }
+            #print(is.null(ind))
+            if (!is.null(ind)) {
+                data&lt;-data[,-c(ind)]
+            }
+
+            data
+        }
+
+        ########GET RESPONSES ###############################
+        get_resp&lt;- function(data) {
+            resp1&lt;-as.vector(data[,ncol(data)])
+                resp=numeric(length(resp1))
+            for (i in 1:length(resp1)) {
+                if (resp1[i]=="Y ") {
+                    resp[i] = 0
+                }
+                if (resp1[i]=="X ") {
+                    resp[i] = 1
+                }
+            }
+                return(resp)
+        }
+
+        ######## CHARS TO NUMBERS ###########################
+        f_to_numbers&lt;- function(F) { 
+            ind&lt;-NULL
+            G&lt;-matrix(0,nrow(F), ncol(F))
+            for (i in 1:nrow(F)) {
+                for (j in 1:ncol(F)) {
+                    G[i,j]&lt;-as.integer(F[i,j])
+                }
+            }
+            return(G)
+        }
+
+        ###################NORMALIZING#########################
+        norm &lt;- function(M, a=NULL, b=NULL) {
+            C&lt;-NULL
+            ind&lt;-NULL
+
+            for (i in 1: ncol(M)) {
+                if (sd(M[,i])!=0) {
+                    M[,i]&lt;-(M[,i]-mean(M[,i]))/sd(M[,i])
+                }
+                #   else {print(mean(M[,i]))}   
+            }
+            return(M)
+        }
+
+        ##### LDA DIRECTIONS #################################
+        lda_dec &lt;- function(data, k){
+            priors=numeric(k)
+            grandmean&lt;-numeric(ncol(data)-1)
+            means=matrix(0,k,ncol(data)-1)
+            B = matrix(0, ncol(data)-1, ncol(data)-1)
+            N=nrow(data)
+            for (i in 1:k){
+                priors[i]=sum(data[,1]==i)/N
+                grp=subset(data,data\$group==i)
+                means[i,]=mean(grp[,2:ncol(data)])
+                #print(means[i,])
+                #print(priors[i])
+                #print(priors[i]*means[i,])
+                grandmean = priors[i]*means[i,] + grandmean           
+            }
+
+            for (i in 1:k) {
+                B= B + priors[i]*((means[i,]-grandmean)%*%t(means[i,]-grandmean))
+            }
+    
+            W = var(data[,2:ncol(data)])
+            svdW = svd(W)
+            inv_sqrtW =solve(svdW\$v %*% diag(sqrt(svdW\$d)) %*% t(svdW\$v))
+            B_star= t(inv_sqrtW)%*%B%*%inv_sqrtW
+            B_star_decomp = svd(B_star)
+            directions  = inv_sqrtW%*%B_star_decomp\$v
+            return( list(directions, B_star_decomp\$d) )                          
+        }
+
+        ################ NAIVE BAYES FOR 1D SIR OR LDA ##############
+        naive_bayes_classifier &lt;- function(resp, tr_data, test_data, k=2, tau) {
+            tr_data=data.frame(resp=resp, dir=tr_data)
+            means=numeric(k)
+            #print(k)
+            cl=numeric(k)
+            predclass=numeric(length(test_data))
+            for (i in 1:k) {
+                grp = subset(tr_data, resp==i)
+                means[i] = mean(grp\$dir)
+            #print(i, means[i])  
+            }
+            cutoff = tau*means[1]+(1-tau)*means[2] 
+            #print(tau)
+            #print(means)
+            #print(cutoff)
+            if (cutoff&gt;means[1]) {
+               cl[1]=1 
+               cl[2]=2
+            }
+            else {
+               cl[1]=2 
+               cl[2]=1
+            }
+
+            for (i in 1:length(test_data)) {
+
+                if (test_data[i] &lt;= cutoff) {
+                    predclass[i] = cl[1]
+            }
+                else {
+                    predclass[i] = cl[2] 
+            }  
+                }
+            #print(means)
+            #print(mean(means))
+            #X11()
+            #plot(test_data,pch=predclass, col=resp) 
+            predclass
+        }
+
+        ################# EXTENDED ERROR RATES #################
+        ext_error_rate &lt;- function(predclass, actualclass,msg=c("you forgot the message"), pr=1) {
+                 er=sum(predclass != actualclass)/length(predclass)
+
+                 matr&lt;-data.frame(predclass=predclass,actualclass=actualclass)
+                 escapes = subset(matr, actualclass==1)
+                 subjects = subset(matr, actualclass==2)      
+                 er_esc=sum(escapes\$predclass != escapes\$actualclass)/length(escapes\$predclass) 
+                 er_subj=sum(subjects\$predclass != subjects\$actualclass)/length(subjects\$predclass)   
+
+                 if (pr==1) {
+        #             print(paste(c(msg, 'overall : ', (1-er)*100, "%."),collapse=" "))
+        #             print(paste(c(msg, 'within escapes : ', (1-er_esc)*100, "%."),collapse=" "))
+        #             print(paste(c(msg, 'within subjects: ', (1-er_subj)*100, "%."),collapse=" ")) 
+            }
+            return(c((1-er)*100, (1-er_esc)*100, (1-er_subj)*100))                                                                                    
+        }
+
+        ## Main Function ##
+
+	files&lt;-matrix("${input}", 1,1, byrow=T)
+
+	d&lt;-"${cond}"   # Number of PC
+
+	tau&lt;-seq(0,1, by=0.005)
+	#tau&lt;-seq(0,1, by=0.1)
+	for_curve=matrix(-10, 3,length(tau))
+
+	##############################################################
+
+	test_data_whole_X &lt;-read.delim(files[1,1], row.names=1)
+
+	#### FORMAT TRAINING DATA ####################################
+	# get only necessary columns 
+
+	test_data_whole_X&lt;-format(test_data_whole_X)
+	oligo_labels&lt;-test_data_whole_X[1:(nrow(test_data_whole_X)-1),ncol(test_data_whole_X)]
+	test_data_whole_X&lt;-test_data_whole_X[,1:(ncol(test_data_whole_X)-1)]
+
+	X_names&lt;-colnames(test_data_whole_X)[1:ncol(test_data_whole_X)]
+	test_data_whole_X&lt;-t(test_data_whole_X)
+	resp&lt;-get_resp(test_data_whole_X) 
+	ldaqda_resp = resp + 1
+	a&lt;-sum(resp)		# Number of Subject
+	b&lt;-length(resp) - a	# Number of Escape   
+	## FREQUENCIES #################################################
+	F&lt;-test_data_whole_X[,1:(ncol(test_data_whole_X)-1)]
+	F&lt;-f_to_numbers(F)
+	FN&lt;-norm(F, a, b)
+	ss&lt;-svd(FN)
+	eigvar&lt;-NULL
+	eig&lt;-ss\$d^2
+
+	for ( i in 1:length(ss\$d)) {
+		eigvar[i]&lt;-sum(eig[1:i])/sum(eig)
+	}
+
+	#print(paste(c("Variance explained : ", eigvar[d]*100, "%"), collapse=""))
+	
+	Z&lt;-F%*%ss\$v
+
+	ldaqda_data &lt;- data.frame(group=ldaqda_resp,Z[,1:d])
+	lda_dir&lt;-lda_dec(ldaqda_data,2)
+	train_lda_pred &lt;-Z[,1:d]%*%lda_dir[[1]]
+
+	############# NAIVE BAYES CROSS-VALIDATION #############
+	### LDA #####
+
+	y&lt;-ldaqda_resp
+	X&lt;-F
+	cv&lt;-matrix(c(rep('NA',nrow(test_data_whole_X))), nrow(test_data_whole_X), length(tau))
+	for (i in 1:nrow(test_data_whole_X)) {
+	#	print(i)
+		resp&lt;-y[-i]
+		p&lt;-matrix(X[-i,], dim(X)[1]-1, dim(X)[2])
+		testdata&lt;-matrix(X[i,],1,dim(X)[2])
+		p1&lt;-norm(p)
+		sss&lt;-svd(p1)
+		pred&lt;-(p%*%sss\$v)[,1:d]
+		test&lt;- (testdata%*%sss\$v)[,1:d]
+		lda  &lt;- lda_dec(data.frame(group=resp,pred),2)
+		pred &lt;- pred[,1:d]%*%lda[[1]][,1]
+		test &lt;- test%*%lda[[1]][,1]
+		test&lt;-matrix(test, 1, length(test))
+		for (t in 1:length(tau)) {
+			cv[i, t] &lt;- naive_bayes_classifier (resp, pred, test,k=2, tau[t]) 
+		}
+ 	}
+
+	for (t in 1:length(tau)) {
+		tr_err&lt;-ext_error_rate(cv[,t], ldaqda_resp , c("CV"), 1)
+		for_curve[1:3,t]&lt;-tr_err
+	}
+
+	dput(for_curve, file="${output}")
+
+
+		</configfile>
+	</configfiles>
+
+	<help>
+
+.. class:: infomark
+
+**TIP:** If you want to perform Principal Component Analysis (PCA) on the give numeric input data (which corresponds to the "Source file First in "Generate A Matrix" tool), please use *Multivariate Analysis/Principal Component Analysis*
+
+-----
+
+.. class:: infomark
+
+**What it does**
+
+This tool consists of the module to perform the Linear Discriminant Analysis as described in Carrel et al., 2006 (PMID: 17009873)
+
+*Carrel L, Park C, Tyekucheva S, Dunn J, Chiaromonte F, et al. (2006) Genomic Environment Predicts Expression Patterns on the Human 	Inactive X Chromosome. PLoS Genet 2(9): e151. doi:10.1371/journal.pgen.0020151*
+
+-----
+
+.. class:: warningmark
+
+**Note**
+
+- Output from "Generate A Matrix" tool is used as input file for this tool 
+- Output of this tool contains LDA classification success rates for different values of the turning parameter tau (from 0 to 1 with 0.005 interval). This output file will be used to establish the ROC plot, and you can obtain more detail information from this plot. 
+
+
+</help>
+
+</tool>
--- a/mine_wrapper.py	Mon Jul 28 11:30:31 2014 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,85 +0,0 @@
-#!/usr/bin/env python
-#Dan Blankenberg
-
-"""
-A wrapper script for running the MINE.jar commands.
-"""
-
-import sys, optparse, os, tempfile, subprocess, shutil
-
-CHUNK_SIZE = 2**20 #1mb
-
-BASE_NAME = "galaxy_mime_file.txt"
-JOB_ID = "galaxy_mine"
-
-def cleanup_before_exit( tmp_dir ):
-    if tmp_dir and os.path.exists( tmp_dir ):
-        print os.listdir( tmp_dir )
-        shutil.rmtree( tmp_dir )
-
-def open_file_from_option( filename, mode = 'rb' ):
-    if filename:
-        return open( filename, mode = mode )
-    return None
-
-
-def __main__():
-    #Parse Command Line
-    parser = optparse.OptionParser()
-    parser.add_option( '-j', '--jar', dest='jar', action='store', type="string", help='Location of JAR file' )
-    parser.add_option( '-i', '--infile', dest='infile', action='store', type="string", help='infile' )
-    parser.add_option( '-m', '--master_variable', dest='master_variable', action='store', type="string", help='master_variable' )
-    parser.add_option( '-v', '--cv', dest='cv', action='store', type="string", help='cv' )
-    parser.add_option( '-e', '--exp', dest='exp', action='store', type="string", help='exp' )
-    parser.add_option( '-c', '--c', dest='c', action='store', type="string", help='c' )
-    parser.add_option( '-p', '--permute', dest='permute', action='store_true', default=False, help='permute' )
-    parser.add_option( '-o', '--output_results', dest='output_results', action='store', type="string", help='output_results' )
-    parser.add_option( '-l', '--output_log', dest='output_log', action='store', type="string", help='output_log' )
-    parser.add_option( '', '--stdout', dest='stdout', action='store', type="string", default=None, help='If specified, the output of stdout will be written to this file.' )
-    parser.add_option( '', '--stderr', dest='stderr', action='store', type="string", default=None, help='If specified, the output of stderr will be written to this file.' )
-    (options, args) = parser.parse_args()
-    
-    tmp_dir = tempfile.mkdtemp( prefix='tmp-MINE-' )
-    tmp_input_name = os.path.join( tmp_dir, BASE_NAME )
-    if options.permute:
-        permute = "-permute"
-    else:
-        permute = ""
-    
-    os.symlink( options.infile, tmp_input_name )
-    
-    cmd = 'java -jar "%s" "%s" %s -cv%s -exp%s -c%s %s "%s"' % ( options.jar, tmp_input_name, options.master_variable, options.cv, options.exp, options.c, permute, JOB_ID )
-    print cmd
-    
-    #set up stdout and stderr output options
-    stdout = open_file_from_option( options.stdout, mode = 'wb' )
-    stderr = open_file_from_option( options.stderr, mode = 'wb' )
-    #if no stderr file is specified, we'll use our own
-    if stderr is None:
-        stderr = tempfile.NamedTemporaryFile( prefix="MINE-stderr-", dir=tmp_dir )
-    
-    proc = subprocess.Popen( args=cmd, stdout=stdout, stderr=stderr, shell=True, cwd=tmp_dir )
-    return_code = proc.wait()
-    
-    if return_code:
-        stderr_target = sys.stderr
-    else:
-        stderr_target = sys.stdout
-    stderr.flush()
-    stderr.seek(0)
-    while True:
-        chunk = stderr.read( CHUNK_SIZE )
-        if chunk:
-            stderr_target.write( chunk )
-        else:
-            break
-    stderr.close()
-    
-    print os.listdir( tmp_dir )
-    
-    shutil.move( '%s,%s,Results.csv' % ( tmp_input_name, JOB_ID ), options.output_results )
-    shutil.move( '%s,%s,Status.csv' % ( tmp_input_name, JOB_ID ), options.output_log )
-    
-    cleanup_before_exit( tmp_dir )
-
-if __name__=="__main__": __main__()
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/r_wrapper.sh	Mon Jul 28 11:41:28 2014 -0400
@@ -0,0 +1,23 @@
+#!/bin/sh
+
+### Run R providing the R script in $1 as standard input and passing 
+### the remaining arguments on the command line
+
+# Function that writes a message to stderr and exits
+fail()
+{
+    echo "$@" >&2
+    exit 1
+}
+
+# Ensure R executable is found
+which R > /dev/null || fail "'R' is required by this tool but was not found on path" 
+
+# Extract first argument
+infile=$1; shift
+
+# Ensure the file exists
+test -f $infile || fail "R input file '$infile' does not exist"
+
+# Invoke R passing file named by first argument to stdin
+R --vanilla --slave $* < $infile
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/lda_analy_output.txt	Mon Jul 28 11:41:28 2014 -0400
@@ -0,0 +1,134 @@
+structure(c(37.9310344827586, 23.6363636363636, 62.5, 37.9310344827586, 
+23.6363636363636, 62.5, 37.9310344827586, 23.6363636363636, 62.5, 
+37.9310344827586, 23.6363636363636, 62.5, 37.9310344827586, 23.6363636363636, 
+62.5, 37.9310344827586, 23.6363636363636, 62.5, 37.9310344827586, 
+23.6363636363636, 62.5, 37.9310344827586, 23.6363636363636, 62.5, 
+37.9310344827586, 23.6363636363636, 62.5, 37.9310344827586, 23.6363636363636, 
+62.5, 37.9310344827586, 23.6363636363636, 62.5, 37.9310344827586, 
+23.6363636363636, 62.5, 37.9310344827586, 23.6363636363636, 62.5, 
+37.9310344827586, 23.6363636363636, 62.5, 37.9310344827586, 23.6363636363636, 
+62.5, 37.9310344827586, 23.6363636363636, 62.5, 37.9310344827586, 
+23.6363636363636, 62.5, 37.9310344827586, 23.6363636363636, 62.5, 
+37.9310344827586, 23.6363636363636, 62.5, 37.9310344827586, 23.6363636363636, 
+62.5, 37.9310344827586, 23.6363636363636, 62.5, 39.0804597701149, 
+23.6363636363636, 65.625, 39.0804597701149, 23.6363636363636, 
+65.625, 39.0804597701149, 23.6363636363636, 65.625, 39.0804597701149, 
+23.6363636363636, 65.625, 39.0804597701149, 23.6363636363636, 
+65.625, 39.0804597701149, 23.6363636363636, 65.625, 39.0804597701149, 
+23.6363636363636, 65.625, 39.0804597701149, 23.6363636363636, 
+65.625, 39.0804597701149, 23.6363636363636, 65.625, 39.0804597701149, 
+23.6363636363636, 65.625, 39.0804597701149, 23.6363636363636, 
+65.625, 39.0804597701149, 23.6363636363636, 65.625, 39.0804597701149, 
+23.6363636363636, 65.625, 39.0804597701149, 23.6363636363636, 
+65.625, 39.0804597701149, 23.6363636363636, 65.625, 39.0804597701149, 
+23.6363636363636, 65.625, 39.0804597701149, 23.6363636363636, 
+65.625, 39.0804597701149, 23.6363636363636, 65.625, 39.0804597701149, 
+23.6363636363636, 65.625, 39.0804597701149, 23.6363636363636, 
+65.625, 39.0804597701149, 23.6363636363636, 65.625, 39.0804597701149, 
+23.6363636363636, 65.625, 40.2298850574713, 23.6363636363636, 
+68.75, 40.2298850574713, 23.6363636363636, 68.75, 40.2298850574713, 
+23.6363636363636, 68.75, 40.2298850574713, 23.6363636363636, 
+68.75, 40.2298850574713, 23.6363636363636, 68.75, 40.2298850574713, 
+23.6363636363636, 68.75, 40.2298850574713, 23.6363636363636, 
+68.75, 40.2298850574713, 23.6363636363636, 68.75, 40.2298850574713, 
+23.6363636363636, 68.75, 40.2298850574713, 23.6363636363636, 
+68.75, 40.2298850574713, 23.6363636363636, 68.75, 40.2298850574713, 
+23.6363636363636, 68.75, 40.2298850574713, 23.6363636363636, 
+68.75, 40.2298850574713, 23.6363636363636, 68.75, 40.2298850574713, 
+23.6363636363636, 68.75, 40.2298850574713, 23.6363636363636, 
+68.75, 40.2298850574713, 23.6363636363636, 68.75, 40.2298850574713, 
+23.6363636363636, 68.75, 40.2298850574713, 23.6363636363636, 
+68.75, 40.2298850574713, 23.6363636363636, 68.75, 40.2298850574713, 
+23.6363636363636, 68.75, 40.2298850574713, 23.6363636363636, 
+68.75, 40.2298850574713, 23.6363636363636, 68.75, 40.2298850574713, 
+23.6363636363636, 68.75, 40.2298850574713, 23.6363636363636, 
+68.75, 40.2298850574713, 23.6363636363636, 68.75, 40.2298850574713, 
+23.6363636363636, 68.75, 40.2298850574713, 23.6363636363636, 
+68.75, 40.2298850574713, 23.6363636363636, 68.75, 40.2298850574713, 
+23.6363636363636, 68.75, 40.2298850574713, 23.6363636363636, 
+68.75, 40.2298850574713, 23.6363636363636, 68.75, 40.2298850574713, 
+23.6363636363636, 68.75, 40.2298850574713, 23.6363636363636, 
+68.75, 40.2298850574713, 23.6363636363636, 68.75, 40.2298850574713, 
+23.6363636363636, 68.75, 40.2298850574713, 23.6363636363636, 
+68.75, 40.2298850574713, 23.6363636363636, 68.75, 40.2298850574713, 
+23.6363636363636, 68.75, 40.2298850574713, 23.6363636363636, 
+68.75, 40.2298850574713, 23.6363636363636, 68.75, 40.2298850574713, 
+23.6363636363636, 68.75, 40.2298850574713, 23.6363636363636, 
+68.75, 40.2298850574713, 23.6363636363636, 68.75, 40.2298850574713, 
+23.6363636363636, 68.75, 40.2298850574713, 23.6363636363636, 
+68.75, 40.2298850574713, 23.6363636363636, 68.75, 40.2298850574713, 
+23.6363636363636, 68.75, 40.2298850574713, 23.6363636363636, 
+68.75, 40.2298850574713, 23.6363636363636, 68.75, 40.2298850574713, 
+23.6363636363636, 68.75, 39.0804597701149, 21.8181818181818, 
+68.75, 39.0804597701149, 21.8181818181818, 68.75, 39.0804597701149, 
+21.8181818181818, 68.75, 39.0804597701149, 21.8181818181818, 
+68.75, 39.0804597701149, 21.8181818181818, 68.75, 39.0804597701149, 
+21.8181818181818, 68.75, 39.0804597701149, 21.8181818181818, 
+68.75, 39.0804597701149, 21.8181818181818, 68.75, 39.0804597701149, 
+21.8181818181818, 68.75, 40.2298850574713, 21.8181818181818, 
+71.875, 40.2298850574713, 21.8181818181818, 71.875, 40.2298850574713, 
+21.8181818181818, 71.875, 40.2298850574713, 21.8181818181818, 
+71.875, 40.2298850574713, 21.8181818181818, 71.875, 40.2298850574713, 
+21.8181818181818, 71.875, 40.2298850574713, 21.8181818181818, 
+71.875, 41.3793103448276, 21.8181818181818, 75, 42.5287356321839, 
+21.8181818181818, 78.125, 42.5287356321839, 21.8181818181818, 
+78.125, 42.5287356321839, 21.8181818181818, 78.125, 42.5287356321839, 
+21.8181818181818, 78.125, 42.5287356321839, 21.8181818181818, 
+78.125, 42.5287356321839, 21.8181818181818, 78.125, 42.5287356321839, 
+21.8181818181818, 78.125, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 43.6781609195402, 21.8181818181818, 81.25, 43.6781609195402, 
+21.8181818181818, 81.25, 43.6781609195402, 21.8181818181818, 
+81.25, 56.3218390804598, 78.1818181818182, 18.75), .Dim = c(3L, 
+201L))
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/matrix_generator_for_pc_and_lda_output.tabular	Mon Jul 28 11:41:28 2014 -0400
@@ -0,0 +1,88 @@
+ 	AGTR2 	ARHGEF9 	BRWD3 	CLCN5 	FMR1 	GPC3 	GPR173 	GRIA3 	GSPT2 	HUWE1 	KIAA2022 	KLF8 	MAGEH1 	MTM1 	NUDT10 	NUDT11 	PAGE1 	PAGE4 	PAK3 	PCSK1N 	PGK1 	PHF6 	RRAGB 	SHROOM4 	SOX3 	TMEM29 	TRO 	TSR2 	USP51 	UXT 	ZDHHC15 	ZDHHC9 	X(SUM) 	APOOL 	AR 	BEX4 	BEX5 	CHIC1 	CHM 	CPXCR1 	CSTF2 	CXCR3 	CXorf26 	CYSLTR1 	DACH2 	DIAPH2 	DRP2 	EDA 	ESX1 	FGF16 	FXYD8 	GPR23 	HDX 	HEPH 	IL1RAPL2 	ITM2A 	KIAA1166 	KLHL4 	LAS1L 	MAGEE1 	MAGEE2 	MSN 	MTMR8 	NAP1L2 	NRK 	NSBP1 	NXF3 	P2RY10 	PABPC5 	POF1B 	RNF12 	RPS6KA6 	SLC7A3 	SPIN2A 	SPIN3 	SPIN4 	STARD8 	SYTL4 	TAF9B 	TBX22 	TCEAL2 	TCEAL4 	TMEM28 	UBQLN2 	UPRT 	ZCCHC5 	ZNF711 	ZXDA 	Y(SUM) 	
+CTCAGAAAAAAA 	0	0	0	0	0	0	0	0	0	0	1	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	4	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	EOL
+CCATCCATCCATCCATCC 	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	1	0	0	3	0	0	0	0	0	0	0	0	0	4	3	0	0	0	1	0	3	3	0	0	0	3	2	0	0	0	0	3	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	3	0	0	26	EOL
+AGAGGGAGAGGG 	2	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	5	0	0	0	0	0	0	0	0	0	3	3	0	0	0	3	0	3	4	0	0	1	2	2	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	2	0	0	0	0	0	0	4	0	0	30	EOL
+ATCTGTTGATGG 	0	0	0	0	0	0	0	1	0	0	0	0	0	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	4	0	0	0	0	0	0	0	0	0	1	1	0	0	0	2	0	1	0	0	0	0	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	1	0	0	0	0	0	0	2	0	0	11	EOL
+AGGGGTGACAGA 	0	0	1	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	2	2	0	0	2	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	1	0	0	0	0	0	0	1	0	0	12	EOL
+ATCCCATTTACA 	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	EOL
+AAGGGTATCAGT 	0	0	0	0	0	0	0	1	0	0	0	1	0	1	1	0	0	0	2	0	0	0	0	0	0	0	0	0	0	2	0	0	8	0	0	0	0	0	0	0	0	0	3	2	0	0	0	3	0	3	3	0	0	0	0	2	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	1	0	0	0	0	0	0	2	0	0	22	EOL
+ATAATATATACA 	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	1	1	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	3	0	0	0	0	0	0	0	0	0	0	8	EOL
+TATTATATGTATA 	0	1	0	0	0	0	0	1	0	0	0	0	0	1	1	0	0	0	0	0	8	0	0	0	0	0	0	0	0	0	0	0	12	0	0	0	0	0	0	0	0	0	1	0	0	0	0	1	0	1	1	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	6	EOL
+CATCATCATCATCA 	0	0	1	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	1	0	0	4	EOL
+CCCCATGATCCA 	1	0	1	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	4	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	1	1	0	0	0	1	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	1	0	0	7	EOL
+TGATTCCTTAAAGAA 	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	EOL
+AACACTTGGACA 	1	2	2	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	6	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	1	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	1	0	0	5	EOL
+TATTAATATAATTTATAAA 	0	0	1	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	3	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	EOL
+ATGTTTATTTTA 	0	1	1	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	4	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	EOL
+TATCCAGGAGAA 	1	0	1	0	0	0	0	1	0	0	0	0	0	0	2	0	0	0	1	0	0	0	0	0	0	0	0	0	0	2	0	0	8	0	0	0	0	0	0	0	0	0	2	0	0	0	0	2	0	2	2	0	0	0	0	2	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	14	EOL
+CAATTCTCCTGCC 	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	1	3	0	0	0	0	0	0	0	0	0	0	1	0	0	0	1	0	2	2	0	0	0	1	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	1	0	0	11	EOL
+ACCATAAAAATGAGAAC 	0	3	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	1	0	0	0	0	0	0	0	0	5	0	0	0	0	0	0	0	0	0	1	1	0	0	0	1	0	1	1	0	0	1	0	1	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	1	0	0	10	EOL
+CTCAGCCATAAAAA 	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	1	0	0	0	0	0	0	0	3	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	EOL
+ATGAGTGAGAATAT 	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	1	3	0	0	0	0	0	0	0	0	0	0	2	0	0	0	2	0	0	2	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	3	0	0	13	EOL
+ACTGTGAGTCAA 	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	2	0	0	0	0	0	0	0	0	0	3	2	0	0	0	2	0	3	3	0	0	0	3	3	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	3	0	0	26	EOL
+TAAACTAAAGAGCTTCTGCACAGCA 	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	2	0	0	0	2	0	2	3	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	3	0	0	16	EOL
+TCCTTTGGGTATAT 	0	0	0	0	0	0	0	1	0	0	1	0	0	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	2	0	0	6	0	0	0	0	0	0	0	0	0	2	3	0	0	0	4	0	1	2	0	0	0	3	2	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	3	0	0	0	0	0	0	2	0	0	24	EOL
+ATGCTGCTATAAAGACACATGCACAC 	0	1	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	3	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	EOL
+TGCTGGAGAGGATGTGGAGAAATAGGAACACTTTTACACTG 	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	EOL
+TCCACAATGGTTGAA 	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	EOL
+TTGGCTGCATAAAT 	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	3	0	0	0	0	0	0	0	0	0	0	1	0	0	0	1	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	1	0	0	0	0	0	0	1	0	0	6	EOL
+CAATGGAACAGAACAGAGCCCTCAGAAATAA 	0	4	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	5	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	EOL
+GAACTAGAAATACCATTTGACCCAGC 	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	1	0	0	0	0	2	0	0	5	0	0	0	0	0	0	0	0	0	2	2	0	0	0	4	0	2	2	0	0	2	2	2	0	0	0	0	2	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	1	2	0	0	0	0	0	0	4	0	0	28	EOL
+TCAAAGATCAGAT 	1	0	0	0	0	0	0	1	0	0	1	1	0	2	0	0	0	0	0	0	0	0	1	1	0	0	0	0	0	2	0	0	10	0	0	0	0	0	0	0	0	0	2	1	0	0	0	2	0	3	3	0	0	0	0	2	0	0	0	0	3	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	2	0	0	20	EOL
+GACCCATCTCACACCAGTTAGAATG 	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	3	EOL
+CAAAGAGAATAAAATACCTAGGTATTTTATTCTTTTT 	0	0	0	0	0	0	0	0	0	0	0	0	0	1	1	0	0	0	1	0	0	0	2	0	1	0	0	0	0	3	0	0	9	0	0	0	0	0	0	0	1	0	2	1	0	0	0	1	0	2	2	0	0	0	1	3	0	0	0	0	4	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	1	0	0	22	EOL
+AAAATGGCCATACTGCCCAAG 	0	0	0	0	0	0	0	1	0	0	0	0	0	0	1	0	0	0	0	0	1	0	0	1	0	0	0	0	0	1	0	0	5	0	0	0	0	0	0	0	0	0	1	1	0	0	0	1	0	1	1	0	0	0	1	1	0	0	0	0	1	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	2	0	0	12	EOL
+AAATTTTTCCAATTCTGTGAAGAAA 	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	1	0	0	0	0	0	2	0	0	5	0	0	0	0	0	0	0	1	0	2	2	0	0	0	1	0	2	4	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	5	1	0	0	0	0	0	0	1	0	0	20	EOL
+TTCACAATAGCAAAGAC 	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	1	0	0	0	2	0	0	0	0	0	0	2	0	0	6	0	0	0	0	0	0	1	0	0	3	1	0	0	0	1	0	2	1	0	0	0	0	2	0	0	0	0	1	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	1	1	0	0	0	0	0	0	1	0	0	16	EOL
+TAGGAAGAATCAATA 	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	1	0	0	0	1	0	0	1	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	1	0	0	7	EOL
+CTGGGTATATACCCAGTAATGG 	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	1	0	3	0	0	0	0	0	0	0	0	0	0	1	6	0	0	0	0	0	0	0	0	0	2	1	0	0	0	1	0	0	1	0	0	2	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	1	0	0	10	EOL
+TTGGAAGTTCTGGCCAGGGCAA 	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	1	0	2	1	0	0	0	0	0	2	0	0	0	0	0	2	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	1	0	0	0	0	0	0	4	0	0	16	EOL
+TGAAGGACCTCTTCAAGGAGAACTACAAACCACTGCTCAA 	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	1	0	0	0	0	0	0	0	0	0	1	1	0	0	0	1	0	0	1	0	0	0	0	1	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	1	0	0	9	EOL
+CTCTCACCACTCCTATTCAACATA 	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	2	2	0	0	0	0	0	1	0	0	6	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	1	0	0	0	0	1	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	1	1	0	0	0	0	0	0	1	0	0	7	EOL
+ACACACACATAT 	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	3	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	1	0	0	4	EOL
+CCATGAGCATGGAATGTTCT 	2	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	4	0	0	0	0	0	0	0	1	0	0	1	0	0	0	1	0	1	2	0	0	2	1	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	4	0	0	16	EOL
+AACCCAAATGTCC 	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	1	0	0	0	0	0	0	0	1	0	0	3	0	2	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	4	0	0	15	EOL
+TTTACAAGAAAAAAACAAACAACCCCA 	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	1	EOL
+AGTTCTAGATCC 	0	0	0	0	0	0	0	0	0	0	1	0	0	0	1	0	0	0	0	0	0	0	0	0	1	0	0	0	0	1	0	0	4	0	0	0	0	0	0	1	0	0	1	1	0	0	0	3	0	1	2	0	0	0	1	1	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	2	0	0	16	EOL
+CTGGAAGCATTCCCTTT 	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	EOL
+GATCCCATTTGTC 	0	0	1	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	1	0	0	0	1	0	1	0	0	0	0	1	0	0	6	0	0	0	0	0	0	0	0	0	1	2	0	0	0	2	0	1	2	0	0	0	1	1	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	3	1	0	0	0	0	0	0	2	0	0	17	EOL
+GATATGAACAGACA 	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	5	0	0	2	1	0	0	0	0	0	0	0	10	0	0	0	0	0	0	0	0	0	1	0	0	0	0	1	0	0	1	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	1	0	0	7	EOL
+TGGGTTTGTCATA 	1	0	0	0	0	0	0	1	0	0	0	0	0	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	1	0	0	5	0	0	0	0	0	0	0	1	0	2	0	0	0	0	0	0	1	2	0	0	0	0	1	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	9	EOL
+AGTTTCTTTTGC 	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	1	0	0	2	0	0	0	0	0	0	0	0	0	3	1	0	0	0	1	0	0	2	0	0	0	1	2	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	1	0	0	0	0	0	0	2	0	0	16	EOL
+AATTACCCAGTCT 	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	EOL
+TCATGTCATCTGCAAACA 	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	1	1	0	0	0	1	0	1	2	0	0	0	1	0	0	0	0	0	1	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	1	0	0	11	EOL
+AAAACTCTCAAT 	0	1	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	2	0	0	0	1	0	0	0	0	0	0	1	0	0	6	0	0	0	0	0	0	1	0	0	3	1	0	0	0	4	0	4	4	0	0	0	1	2	0	1	0	0	3	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	3	3	0	0	0	0	0	0	1	0	0	31	EOL
+CAACTTCAGCAA 	1	0	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	1	0	0	0	1	0	0	0	0	0	0	1	0	0	6	0	0	0	0	0	0	1	0	0	3	2	0	0	0	3	0	2	1	0	0	0	1	3	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	2	0	0	21	EOL
+ATTGGCTGTGGGTTT 	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	1	0	0	2	0	0	0	0	0	0	0	1	0	1	0	0	0	0	1	0	1	2	0	0	0	0	2	0	1	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	3	0	0	15	EOL
+AATTAGATCCCA 	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	1	0	0	0	1	0	0	0	0	0	0	2	0	0	6	0	0	0	0	0	0	0	0	0	3	1	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	2	0	0	11	EOL
+GACCTAAAACCA 	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	1	0	0	0	0	1	0	1	1	0	0	0	0	0	0	0	0	0	1	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	1	0	0	9	EOL
+AGAATCTACAAT 	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	1	0	0	3	1	0	0	0	0	0	1	0	0	1	2	0	0	0	1	0	2	2	0	0	0	0	1	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	2	0	0	15	EOL
+AAACCAAACACC 	0	0	0	0	0	0	0	1	0	0	0	0	0	1	0	0	0	0	0	0	1	0	1	0	1	0	0	0	0	2	0	0	7	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	1	0	0	4	EOL
+GGAGTTCCAGACCAGCCT 	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	1	0	2	1	0	0	0	1	0	0	1	0	0	0	1	2	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	1	0	0	13	EOL
+CCTTGCCCATGCC 	0	0	1	0	0	0	0	0	0	0	1	0	0	0	1	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	4	0	0	0	0	0	0	0	1	0	0	1	0	0	0	1	0	0	1	0	0	0	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	1	0	0	0	0	0	0	0	0	0	9	EOL
+ATCATACTGAAT 	0	1	0	0	0	0	0	0	0	0	0	0	0	1	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	4	0	0	0	0	0	0	0	0	0	2	2	0	0	0	2	0	2	2	0	0	1	0	1	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	6	2	0	0	0	0	0	0	0	0	0	21	EOL
+AGGAAGTCAAATT 	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	1	0	0	0	0	0	0	1	0	2	1	0	0	0	0	0	1	3	0	0	0	0	3	0	0	0	0	3	0	0	0	0	3	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	2	0	0	21	EOL
+AGCAAACCACCA 	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	1	0	0	0	0	0	0	1	0	0	3	0	0	0	0	0	0	0	1	0	3	2	0	0	0	3	0	3	4	0	0	0	1	5	0	0	0	0	1	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	1	2	0	0	0	0	0	0	1	0	0	29	EOL
+AGCATGATTTATA 	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	3	0	0	0	0	0	0	1	1	0	3	1	0	0	0	2	0	2	2	0	0	1	0	0	0	0	0	0	1	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	2	1	0	0	0	0	0	0	1	0	0	19	EOL
+GAGAGCCAAATCATGAGTG 	0	0	0	0	0	0	0	0	0	0	0	0	0	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	1	1	0	0	1	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	1	1	0	0	0	0	0	0	0	0	0	7	EOL
+AAAGAGCCAAAT 	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	3	EOL
+AGCAATTGTGAATGG 	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	3	0	0	0	0	0	0	0	1	0	2	0	0	0	0	0	0	2	2	0	0	0	0	2	0	0	0	0	2	0	0	0	0	4	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	2	0	0	18	EOL
+CACTATTCACAATTGC 	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	1	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	2	0	0	6	EOL
+TCAGGATACAAAATCAATG 	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	1	1	0	0	0	0	0	1	0	0	4	0	0	0	0	0	0	1	2	0	3	1	0	0	0	2	0	3	1	0	0	0	1	3	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	2	0	0	0	0	0	0	2	0	0	24	EOL
+CAATGAACTCAAACAAATT 	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	1	1	0	1	1	0	0	0	2	0	2	2	0	0	0	1	1	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	1	1	0	0	0	0	0	0	2	0	0	18	EOL
+TCCAACAAAGGACATGAACTCATC 	0	1	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	3	0	0	0	0	0	0	0	0	0	1	1	0	0	0	1	0	1	1	0	0	0	1	2	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	1	0	0	0	0	0	0	1	0	0	12	EOL
+AATTGAACAATGAGAACATGTGGTAT 	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	2	1	0	0	0	0	0	0	0	0	1	1	0	0	0	2	0	0	1	0	0	3	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	1	0	0	0	0	0	0	0	0	0	12	EOL
+AACCACAATGAGAACA 	0	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	1	4	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	3	EOL
+GTGTATATATATACAT 	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	1	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	3	EOL
+ACATATATATAT 	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	1	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	1	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	5	EOL
+GTCAGATGGATA 	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	1	1	0	0	0	1	0	0	0	0	0	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	3	1	0	0	0	0	0	0	1	0	0	10	EOL
+TCATCTGACAAAGGGCTAATATCCAG 	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	3	EOL
+TTTGTCAGGTTTGTCAAAG 	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	EOL
+TTCTTAATCCAGTCTATCATT 	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	1	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	1	0	1	1	0	0	0	1	0	1	3	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	1	1	0	0	0	0	0	0	3	0	0	15	EOL
+TTTAATCCATCTTGA 	0	0	0	0	0	0	0	1	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	1	0	0	3	1	0	0	0	3	0	0	1	0	0	0	0	3	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	4	0	0	20	EOL
+AAACTACCATCAGAGTGAACAGGCA 	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	1	0	2	0	0	0	0	0	0	0	0	1	0	0	5	0	0	0	0	0	0	0	0	0	1	1	0	0	0	1	0	1	1	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	1	0	0	8	EOL
+GCCATCAGAGAAAT 	0	0	0	0	0	0	0	0	0	0	1	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	3	1	0	0	0	0	0	0	1	0	0	8	EOL
+ACAGGCAACCTACA 	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	1	4	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	1	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	2	0	0	7	EOL
+GCAACCTACTCA 	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	1	0	2	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	7	EOL
+TAGAAAACCCCAT 	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	1	0	0	3	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	2	0	0	8	EOL
+ 	X 	X 	X 	X 	X 	X 	X 	X 	X 	X 	X 	X 	X 	X 	X 	X 	X 	X 	X 	X 	X 	X 	X 	X 	X 	X 	X 	X 	X 	X 	X 	X 	 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	Y 	 	
--- a/tool_dependencies.xml	Mon Jul 28 11:30:31 2014 -0400
+++ b/tool_dependencies.xml	Mon Jul 28 11:41:28 2014 -0400
@@ -1,6 +1,6 @@
 <?xml version="1.0"?>
 <tool_dependency>
-  <package name="MINE" version="1.0.1">
-      <repository changeset_revision="13775004e78a" name="package_mine_1_0_1" owner="devteam" toolshed="https://testtoolshed.g2.bx.psu.edu" />
+    <package name="R" version="2.11.0">
+        <repository changeset_revision="497dd02b0fe2" name="package_r_2_11_0" owner="devteam" toolshed="https://testtoolshed.g2.bx.psu.edu" />
     </package>
 </tool_dependency>