# HG changeset patch # User devteam # Date 1444754533 14400 # Node ID 97f0b63ae7cf59c9b090357a88b6667cba64ae10 # Parent 0288c4b3a53f380231af2e6820bf4d5333c9dc59 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 diff -r 0288c4b3a53f -r 97f0b63ae7cf fastx_trimmer.xml --- a/fastx_trimmer.xml Tue Nov 26 12:51:31 2013 -0500 +++ b/fastx_trimmer.xml Tue Oct 13 12:42:13 2015 -0400 @@ -1,51 +1,52 @@ - + fastx_toolkit - zcat -f '$input' | fastx_trimmer -v -f $first -l $last -o $output + + - - - +]]> + - - - + + - - - - + + + - - - - - - - - - - - - - - - - - - - - - + + + + + + + + + + + + + + + + + + + + + + + + **What it does** This tool trims (cut bases from) sequences in a FASTA/Q file. - + -------- **Example** @@ -56,7 +57,7 @@ TATGGTCAGAAACCATATGCAGAGCCTGTAGGCACC >2-1 CAGCGAGGCTTTAATGCCATTTGGCTGTAGGCACCA - + Trimming with First=1 and Last=21, we get a FASTA file with 21 bases in each sequences (starting from the first base):: @@ -71,13 +72,12 @@ TCAGA >2-1 AGGCT - + ------ This tool is based on `FASTX-toolkit`__ by Assaf Gordon. .. __: http://hannonlab.cshl.edu/fastx_toolkit/ - - + diff -r 0288c4b3a53f -r 97f0b63ae7cf tool_dependencies.xml --- a/tool_dependencies.xml Tue Nov 26 12:51:31 2013 -0500 +++ b/tool_dependencies.xml Tue Oct 13 12:42:13 2015 -0400 @@ -1,6 +1,6 @@ - +