# HG changeset patch # User iuc # Date 1525798389 14400 # Node ID 9081fe62bd566d4f8968cabd0cea4de9772a0e5d # Parent 97f0b63ae7cf59c9b090357a88b6667cba64ae10 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1 diff -r 97f0b63ae7cf -r 9081fe62bd56 fastx_trimmer.xml --- a/fastx_trimmer.xml Tue Oct 13 12:42:13 2015 -0400 +++ b/fastx_trimmer.xml Tue May 08 12:53:09 2018 -0400 @@ -1,30 +1,23 @@ - + - - fastx_toolkit - - - - - + + macros.xml + + + - - - - - - - - - + + + - + @@ -42,7 +35,7 @@ - + 2-1 CAGCGAGGCTTTAATGCCATTTGGCTGTAGGCACCA - Trimming with First=1 and Last=21, we get a FASTA file with 21 bases in each sequences (starting from the first base):: >1-1 @@ -78,6 +70,7 @@ This tool is based on `FASTX-toolkit`__ by Assaf Gordon. .. __: http://hannonlab.cshl.edu/fastx_toolkit/ - + ]]> + diff -r 97f0b63ae7cf -r 9081fe62bd56 macros.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Tue May 08 12:53:09 2018 -0400 @@ -0,0 +1,54 @@ + + + + #if $input.is_of_type('fasta.gz', 'fastqsanger.gz', 'fastqsolexa.gz', 'fastqillumina.gz'): + zcat -f '$input' | + #elif $input.is_of_type('fastqsanger.bz2', 'fastqsolexa.bz2', 'fastqillumina.bz2'): + bzcat -f '$input' | + #else: + cat '$input' | + #end if + + + + + + + fastx_toolkit + + + + 0.0.14 + fastqsanger,fastqsanger.gz,fastqsanger.bz2 + fastqsolexa,fastqsolexa.gz,fastqsolexa.bz2 + fastqillumina,fastqillumina.gz,fastqillumina.bz2 + @SANGER@,@SOLEXA@,@ILLUMINA@ + fasta,fasta.gz + + + + @UNPUBLISHED{agordon, + author = "Assaf Gordon", + title = "FASTQ/A short-reads pre-processing tools", + year = "2010", + note = "http://hannonlab.cshl.edu/fastx_toolkit/", + url = "http://hannonlab.cshl.edu/fastx_toolkit/"} + + + + + + + + + + + + + diff -r 97f0b63ae7cf -r 9081fe62bd56 tool_dependencies.xml --- a/tool_dependencies.xml Tue Oct 13 12:42:13 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,6 +0,0 @@ - - - - - -