Mercurial > repos > devteam > fastx_trimmer
view fastx_trimmer.xml @ 5:b962b4efec19 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit 3953b65f6b1c0336e9cadbe0792a5d3b14b5643a
author | iuc |
---|---|
date | Wed, 22 Aug 2018 11:04:02 -0400 |
parents | 748363ac106b |
children | 2ff4f91ff564 |
line wrap: on
line source
<tool id="cshl_fastx_trimmer" version="1.0.2" name="Trim sequences"> <description></description> <macros> <import>macros.xml</import> </macros> <expand macro="requirements" /> <command detect_errors="exit_code"><![CDATA[ @CATS@ fastx_trimmer -v -f $first -l $last -o '$output' @FQQUAL@ @GZIP@ ]]></command> <inputs> <expand macro="fastx_input" /> <param name="first" type="integer" value="1" label="First base to keep" /> <param name="last" type="integer" value="21" label="Last base to keep" /> </inputs> <outputs> <data name="output" format_source="input" metadata_source="input" /> </outputs> <tests> <test> <!-- Trim a FASTA file - remove first four bases (e.g. a barcode) --> <param name="input" value="fastx_trimmer1.fasta" /> <param name="first" value="5"/> <param name="last" value="36"/> <output name="output" ftype="fasta" file="fastx_trimmer1.out" /> </test> <test> <!-- Trim a FASTQ file - remove last 9 bases (e.g. keep only miRNA length sequences) --> <param name="input" value="fastx_trimmer2.fastq" ftype="fastqsolexa"/> <param name="first" value="1"/> <param name="last" value="27"/> <output name="output" ftype="fastqsolexa" file="fastx_trimmer2.out" /> </test> <test> <!-- Trim a FASTQ.gz file and output FASTQ.gz --> <param name="input" value="fastx_trimmer2.fastq.gz" ftype="fastqsanger.gz"/> <param name="first" value="1"/> <param name="last" value="27"/> <output name="output" ftype="fastqsanger.gz" decompress="true" file="fastx_trimmer2.out.gz" /> </test> </tests> <help><![CDATA[ **What it does** This tool trims (cut bases from) sequences in a FASTA/Q file. -------- **Example** Input Fasta file (with 36 bases in each sequences):: >1-1 TATGGTCAGAAACCATATGCAGAGCCTGTAGGCACC >2-1 CAGCGAGGCTTTAATGCCATTTGGCTGTAGGCACCA Trimming with First=1 and Last=21, we get a FASTA file with 21 bases in each sequences (starting from the first base):: >1-1 TATGGTCAGAAACCATATGCA >2-1 CAGCGAGGCTTTAATGCCATT Trimming with First=6 and Last=10, will generate a FASTA file with 5 bases (bases 6,7,8,9,10) in each sequences:: >1-1 TCAGA >2-1 AGGCT ------ This tool is based on `FASTX-toolkit`__ by Assaf Gordon. .. __: http://hannonlab.cshl.edu/fastx_toolkit/ ]]></help> <expand macro="citations" /> <!-- FASTX-Trimmer is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> </tool>