# HG changeset patch
# User devteam
# Date 1444754506 14400
# Node ID defaa5ba1ee2737954824692a14255bf5d3e172b
# Parent 4ed1114bfe880bb2d1bc3e9972a8df6f05ff7567
planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734
diff -r 4ed1114bfe88 -r defaa5ba1ee2 fastx_renamer.xml
--- a/fastx_renamer.xml Tue Aug 20 10:50:39 2013 -0400
+++ b/fastx_renamer.xml Tue Oct 13 12:41:46 2015 -0400
@@ -1,29 +1,32 @@
-
+
fastx_toolkit
- zcat -f $input | fastx_renamer -n $TYPE -o $output -v
+
+
+]]>
+
-
-
+
+
-
-
-
-
-
+
+
+
+
+
-
-
-
-
-
-
+
+
+
+
+
+
**What it does**
This tool renames the sequence identifiers in a FASTQ/A file.
@@ -42,7 +45,7 @@
GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+CSHL_4_FC042GAMMII_2_1_517_596
40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
-
+
Renamed to **nucleotides sequence**::
@GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
@@ -61,7 +64,7 @@
This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
- .. __: http://hannonlab.cshl.edu/fastx_toolkit/
-
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
+
diff -r 4ed1114bfe88 -r defaa5ba1ee2 tool_dependencies.xml
--- a/tool_dependencies.xml Tue Aug 20 10:50:39 2013 -0400
+++ b/tool_dependencies.xml Tue Oct 13 12:41:46 2015 -0400
@@ -1,6 +1,6 @@
-
+