# HG changeset patch # User devteam # Date 1444754506 14400 # Node ID defaa5ba1ee2737954824692a14255bf5d3e172b # Parent 4ed1114bfe880bb2d1bc3e9972a8df6f05ff7567 planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734 diff -r 4ed1114bfe88 -r defaa5ba1ee2 fastx_renamer.xml --- a/fastx_renamer.xml Tue Aug 20 10:50:39 2013 -0400 +++ b/fastx_renamer.xml Tue Oct 13 12:41:46 2015 -0400 @@ -1,29 +1,32 @@ - + fastx_toolkit - zcat -f $input | fastx_renamer -n $TYPE -o $output -v + + +]]> + - - + + - - - - - + + + + + - - - - - - + + + + + + **What it does** This tool renames the sequence identifiers in a FASTQ/A file. @@ -42,7 +45,7 @@ GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT +CSHL_4_FC042GAMMII_2_1_517_596 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40 - + Renamed to **nucleotides sequence**:: @GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT @@ -61,7 +64,7 @@ This tool is based on `FASTX-toolkit`__ by Assaf Gordon. - .. __: http://hannonlab.cshl.edu/fastx_toolkit/ - + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + diff -r 4ed1114bfe88 -r defaa5ba1ee2 tool_dependencies.xml --- a/tool_dependencies.xml Tue Aug 20 10:50:39 2013 -0400 +++ b/tool_dependencies.xml Tue Oct 13 12:41:46 2015 -0400 @@ -1,6 +1,6 @@ - +