view fastx_renamer.xml @ 5:f0cd2c0de268 draft default tip

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit fd099d17eceaa319fbfe429f4725328d88b18c9f

<tool id="cshl_fastx_renamer" name="Rename sequences" version="@VERSION@+galaxy@VERSION_SUFFIX@" profile="22.05" >
    <description></description>
    <macros>
        <import>macros.xml</import>
    </macros>
    <expand macro="requirements">
        <requirement type="package" version="1.0.8">bzip2</requirement>
    </expand>
    <command detect_errors="exit_code"><![CDATA[
@CATS@ fastx_renamer
-n $TYPE
-v
@FQQUAL@
@GZIP@ > '$output'
    ]]></command>

    <inputs>
        <expand macro="fastx_input" />

        <param name="TYPE" type="select" label="Rename sequence identifiers to">
            <option value="SEQ">Nucleotides sequence</option>
            <option value="COUNT">Numeric Counter</option>
        </param>
    </inputs>

    <outputs>
        <data name="output" format_source="input" metadata_source="input" />
    </outputs>
    <tests>
        <test>
            <param name="input" value="fastx_renamer-in1.fastq" />
            <param name="TYPE" value="SEQ" />
            <output name="output" file="fastx_renamer-out1.fastq" />
        </test>
    </tests>
    <help><![CDATA[
**What it does**

This tool renames the sequence identifiers in a FASTQ/A file.

.. class:: infomark

Use this tool at the beginning of your workflow, as a way to keep the original sequence (before trimming, clipping, barcode-removal, etc).

--------

**Example**

The following Solexa-FASTQ file::

    @CSHL_4_FC042GAMMII_2_1_517_596
    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
    +CSHL_4_FC042GAMMII_2_1_517_596
    40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40

Renamed to **nucleotides sequence**::

    @GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
    +GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
    40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40

Renamed to **numeric counter**::

    @1
    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
    +1
    40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40

------

This tool is based on `FASTX-toolkit`__ by Assaf Gordon.

 .. __: http://hannonlab.cshl.edu/fastx_toolkit/
    ]]></help>
    <expand macro="citations" />
</tool>