Mercurial > repos > devteam > fastx_renamer

comparison fastx_renamer.xml @ 1:defaa5ba1ee2 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734
author devteam
date Tue, 13 Oct 2015 12:41:46 -0400
parents 4ed1114bfe88
children 2b324adf4e58
comparison
equal deleted inserted replaced
0:4ed1114bfe88 1:defaa5ba1ee2
1 <tool id="cshl_fastx_renamer" name="Rename sequences" version="0.0.11" > 1 <tool id="cshl_fastx_renamer" name="Rename sequences" version="0.0.11" >
2 <description></description> 2 <description></description>
3 <requirements> 3 <requirements>
4 <requirement type="package" version="0.0.13">fastx_toolkit</requirement> 4 <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
5 </requirements> 5 </requirements>
6 <command>zcat -f $input | fastx_renamer -n $TYPE -o $output -v 6 <command>
7 <![CDATA[
8 zcat -f < '$input' | fastx_renamer -n $TYPE -o '$output' -v
7 #if $input.ext == "fastqsanger": 9 #if $input.ext == "fastqsanger":
8 -Q 33 10 -Q 33
9 #end if 11 #end if
10 </command> 12 ]]>
13 </command>
11 14
12 <inputs> 15 <inputs>
13 <param format="fastqsolexa,fasta,fastqsanger" name="input" type="data" label="FASTQ/A Library to rename" /> 16 <param format="fastqsolexa,fasta,fastqsanger" name="input" type="data" label="FASTQ/A Library to rename" />
14 17
15 <param name="TYPE" type="select" label="Rename sequence identifiers to"> 18 <param name="TYPE" type="select" label="Rename sequence identifiers to">
16 <option value="SEQ">Nucleotides sequence</option> 19 <option value="SEQ">Nucleotides sequence</option>
17 <option value="COUNT">Numeric Counter</option> 20 <option value="COUNT">Numeric Counter</option>
18 </param> 21 </param>
19 </inputs> 22 </inputs>
20 23
21 <outputs> 24 <outputs>
22 <data format="input" name="output" metadata_source="input" /> 25 <data format_source="input" name="output" metadata_source="input" />
23 </outputs> 26 </outputs>
24 27 <tests>
25 <help> 28 </tests>
26 29 <help>
27 **What it does** 30 **What it does**
28 31
29 This tool renames the sequence identifiers in a FASTQ/A file. 32 This tool renames the sequence identifiers in a FASTQ/A file.
30 33
31 .. class:: infomark 34 .. class:: infomark
40 43
41 @CSHL_4_FC042GAMMII_2_1_517_596 44 @CSHL_4_FC042GAMMII_2_1_517_596
42 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT 45 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
43 +CSHL_4_FC042GAMMII_2_1_517_596 46 +CSHL_4_FC042GAMMII_2_1_517_596
44 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40 47 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
45 48
46 Renamed to **nucleotides sequence**:: 49 Renamed to **nucleotides sequence**::
47 50
48 @GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT 51 @GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
49 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT 52 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
50 +GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT 53 +GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
59 62
60 ------ 63 ------
61 64
62 This tool is based on `FASTX-toolkit`__ by Assaf Gordon. 65 This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
63 66
64 .. __: http://hannonlab.cshl.edu/fastx_toolkit/ 67 .. __: http://hannonlab.cshl.edu/fastx_toolkit/
65 </help> 68 </help>
66 <!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> 69 <!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
67 </tool> 70 </tool>