# HG changeset patch # User iuc # Date 1525798294 14400 # Node ID 7bda0f25191f2ab1277b85b8e8f2abdd23c9362f # Parent 17bfc147c9ea4de3340e95a0fb3c2e9c2e769dda planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_collapser commit bbb2e6b6769b03602a8ab97001f88fbec52080a1 diff -r 17bfc147c9ea -r 7bda0f25191f fastx_collapser.xml --- a/fastx_collapser.xml Tue Oct 13 12:41:05 2015 -0400 +++ b/fastx_collapser.xml Tue May 08 12:51:34 2018 -0400 @@ -1,32 +1,30 @@ -<tool id="cshl_fastx_collapser" version="1.0.0" name="Collapse"> +<tool id="cshl_fastx_collapser" version="1.0.1" name="Collapse"> <description>sequences</description> - <requirements> - <requirement type="package" version="0.0.13">fastx_toolkit</requirement> - </requirements> - <command> -<![CDATA[ -zcat -f < '$input' | fastx_collapser -v -o '$output' -#if $input.ext == "fastqsanger": - -Q 33 -#end if -]]> - </command> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements" /> + <command detect_errors="exit_code"><![CDATA[ +@CATS@ fastx_collapser -v +-o '$output' +@FQQUAL@ + ]]></command> <inputs> - <param format="fasta,fastqsanger,fastqsolexa" name="input" type="data" label="Library to collapse" /> + <expand macro="fastx_input" /> </inputs> <outputs> - <data format="fasta" name="output" metadata_source="input" /> + <data name="output" format="fasta" metadata_source="input" /> </outputs> - <!-- The order of sequences in the test output differ between 32 bit and 64 bit machines. <tests> <test> <param name="input" value="fasta_collapser1.fasta" /> - <param name="output" file="fasta_collapser1.out" /> + <!-- The output is sorted differently depending on architecture, + so the sort attribute is needed here --> + <output name="output" file="fasta_collapser1.out" sort="true" /> </test> </tests> - --> - <help> + <help><![CDATA[ **What it does** This tool collapses identical sequences in a FASTA file into a single sequence. @@ -80,11 +78,11 @@ means that the sequence "ATAT" is the second sequence in the file, and it appeared 4 times in the input FASTA file. - ------ This tool is based on `FASTX-toolkit`__ by Assaf Gordon. .. __: http://hannonlab.cshl.edu/fastx_toolkit/ - </help> + ]]></help> + <expand macro="citations" /> </tool> diff -r 17bfc147c9ea -r 7bda0f25191f macros.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Tue May 08 12:51:34 2018 -0400 @@ -0,0 +1,54 @@ +<?xml version="1.0"?> +<macros> + <token name="@CATS@"> + #if $input.is_of_type('fasta.gz', 'fastqsanger.gz', 'fastqsolexa.gz', 'fastqillumina.gz'): + zcat -f '$input' | + #elif $input.is_of_type('fastqsanger.bz2', 'fastqsolexa.bz2', 'fastqillumina.bz2'): + bzcat -f '$input' | + #else: + cat '$input' | + #end if + </token> + <token name="@FQQUAL@"> + <![CDATA[ + #if $input.is_of_type('fastqsanger', 'fastqsanger.gz', 'fastqsanger.bz2'): + -Q 33 + #elif $input.is_of_type('fastqsolexa', 'fastqsolexa.gz', 'fastqsolexa.bz2', 'fastqillumina', 'fastqillumina.gz', 'fastqillumina.bz2'): + -Q 64 + #end if + ]]> + </token> + <xml name="requirements"> + <requirements> + <requirement type="package" version="@VERSION@">fastx_toolkit</requirement> + <yield /> + </requirements> + </xml> + <token name="@VERSION@">0.0.14</token> + <token name="@SANGER@">fastqsanger,fastqsanger.gz,fastqsanger.bz2</token> + <token name="@SOLEXA@">fastqsolexa,fastqsolexa.gz,fastqsolexa.bz2</token> + <token name="@ILLUMINA@">fastqillumina,fastqillumina.gz,fastqillumina.bz2</token> + <token name="@FASTQS@">@SANGER@,@SOLEXA@,@ILLUMINA@</token> + <token name="@FASTAS@">fasta,fasta.gz</token> + <xml name="citations"> + <citations> + <citation type="bibtex"> + @UNPUBLISHED{agordon, + author = "Assaf Gordon", + title = "FASTQ/A short-reads pre-processing tools", + year = "2010", + note = "http://hannonlab.cshl.edu/fastx_toolkit/", + url = "http://hannonlab.cshl.edu/fastx_toolkit/"} + </citation> + </citations> + </xml> + <xml name="fasta_input"> + <param name="input" type="data" format="@FASTAS@" label="Input FASTA file" /> + </xml> + <xml name="fastq_input"> + <param name="input" type="data" format="@FASTQS@" label="Input FASTQ file" /> + </xml> + <xml name="fastx_input"> + <param name="input" type="data" format="@FASTAS@,@FASTQS@" label="Input file in FASTA or FASTQ format" /> + </xml> +</macros> diff -r 17bfc147c9ea -r 7bda0f25191f test-data/fasta_collapser1.out --- a/test-data/fasta_collapser1.out Tue Oct 13 12:41:05 2015 -0400 +++ b/test-data/fasta_collapser1.out Tue May 08 12:51:34 2018 -0400 @@ -7,18 +7,18 @@ >4-3 CTGCTGCGATCGGTGTGC >5-1 -TCAAATTCTAGATTTTTACGG +ACCATTCGAGCATAC >6-1 -ACCATTCGAGCATAC +TGTATTTACAATGACTAGAAA >7-1 TGATTTCCAGAGCCAAT >8-1 -TTACCTCACGATATTGTAATA +CGATTGCCGAAGTCTACCA >9-1 -TGTATTTACAATGACTAGAAA +TCAAATTCTAGATTTTTACGG >10-1 +TTACCTCACGATATTGTAATA +>11-1 CCTTGTAGTGGATTCTGATGA ->11-1 -CGATTGCCGAAGTCTACCA >12-1 -ATGACTTCATCGTCCACCCTTTAGAACT \ No newline at end of file +ATGACTTCATCGTCCACCCTTTAGAACT diff -r 17bfc147c9ea -r 7bda0f25191f tool_dependencies.xml --- a/tool_dependencies.xml Tue Oct 13 12:41:05 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,6 +0,0 @@ -<?xml version="1.0"?> -<tool_dependency> - <package name="fastx_toolkit" version="0.0.13"> - <repository changeset_revision="e76e81b3eccf" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="https://testtoolshed.g2.bx.psu.edu" /> - </package> -</tool_dependency>