Mercurial > repos > devteam > fastx_clipper
view fastx_clipper.xml @ 6:e797fa738289 draft
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_clipper commit df67d3123613c9d4a9c2482d4e9b5e89aeda39a9"
author | iuc |
---|---|
date | Tue, 23 Nov 2021 11:22:24 +0000 |
parents | 40200bfa25cd |
children | b0cca5893f09 |
line wrap: on
line source
<tool id="cshl_fastx_clipper" name="Clip" version="1.0.3+galaxy0"> <description>adapter sequences</description> <macros> <import>macros.xml</import> </macros> <expand macro="requirements"> <requirement type="package" version="1.0.8">bzip2</requirement> </expand> <command detect_errors="exit_code"><![CDATA[ @CATS@ fastx_clipper -l $minlength -a '$clip_source.clip_sequence' -d $keepdelta -v $KEEP_N $DISCARD_OPTIONS @FQQUAL@ @GZIP@ > '$output' ]]></command> <inputs> <expand macro="fastx_input" /> <param name="minlength" type="integer" value="15" label="Minimum sequence length (after clipping, sequences shorter than this length will be discarded" /> <conditional name="clip_source"> <param name="clip_source_list" type="select" label="Source"> <option value="prebuilt" selected="true">Standard (select from the list below)</option> <option value="user">Enter custom sequence</option> </param> <when value="user"> <param name="clip_sequence" label="Enter custom clipping sequence" type="text" value="AATTGGCC" /> </when> <when value="prebuilt"> <param name="clip_sequence" type="select" label="Choose Adapter"> <options from_file="fastx_clipper_sequences.txt"> <column name="name" index="1"/> <column name="value" index="0"/> </options> </param> </when> </conditional> <param name="keepdelta" type="integer" value="0" label="Enter a non-zero value to keep the adapter sequence and x bases that follow it" help="Use this for hairpin barcoding. keep at 0 unless you know what you're doing" /> <param name="KEEP_N" type="select" label="Discard sequences with unknown (N) bases"> <option value="">Yes</option> <option value="-n">No</option> </param> <param name="DISCARD_OPTIONS" type="select" label="Output options"> <option value="-c">Output only clipped sequences (i.e. sequences which contained the adapter)</option> <option value="-C">Output only non-clipped sequences (i.e. sequences which did not contained the adapter)</option> <option value="">Output both clipped and non-clipped sequences</option> </param> </inputs> <outputs> <data name="output" format_source="input" metadata_source="input" /> </outputs> <tests> <test> <param name="input" value="fastx_clipper1.fastq" ftype="fastqsolexa"/> <param name="minlength" value="15" /> <param name="clip_source_list" value="user" /> <param name="clip_sequence" value="CAATTGGTTAATCCCCCTATATA" /> <param name="keepdelta" value="0" /> <param name="KEEP_N" value="-n" /> <param name="DISCARD_OPTIONS" value="-c" /> <output name="output" ftype="fastqsolexa" file="fastx_clipper1a.out" /> </test> </tests> <help><![CDATA[ **What it does** This tool clips adapters from the 3'-end of the sequences in a FASTA/FASTQ file. -------- **Clipping Illustration:** .. image:: fastx_clipper_illustration.png **Clipping Example:** .. image:: fastx_clipper_example.png **In the above example:** * Sequence no. 1 was discarded since it wasn't clipped (i.e. didn't contain the adapter sequence). (**Output** parameter). * Sequence no. 5 was discarded --- it's length (after clipping) was shorter than 15 nt (**Minimum Sequence Length** parameter). ------ This tool is based on `FASTX-toolkit`__ by Assaf Gordon. .. __: http://hannonlab.cshl.edu/fastx_toolkit/ ]]></help> <expand macro="citations" /> </tool>