comparison fastqsolexa_to_fasta_qual.xml @ 0:b471da1d7303 draft default tip

Imported from capsule None

0:b471da1d7303

<tool id="fastqsolexa_to_fasta_qual" name="FASTQSOLEXA-to-FASTA-QUAL" version="1.0.0">
  <description>extracts sequences and quality scores from FASTQSOLEXA data</description>
  <command interpreter="python">fastqsolexa_to_fasta_qual.py $input1 $output1 $output2 $input1.extension</command>
  <inputs>
    <param name="input1" type="data" format="fastqsolexa" label="Fastqsolexa file"/>
  </inputs>
  <outputs>
    <data name="output1" format="fasta"/>
    <data name="output2" format="qualsolexa"/>
  </outputs>
  <tests>
    <!-- NOTE: this tool generates 2 output files, but our functional tests currently only handle the last one generated -->
    <test>
      <param name="input1" value="1.fastqsolexa" ftype="fastqsolexa" />
      <output name="output1" file="fastqsolexa_to_fasta_qual_out4.fasta" />
      <output name="output2" file="fastqsolexa_to_fasta_qual_out4.qualsolexa" />
    </test>
    <test>
      <param name="input1" value="2.fastqsolexa" ftype="fastqsolexa" />
      <output name="output1" file="fastqsolexa_to_fasta_qual_out2.fasta" />
      <output name="output2" file="fastqsolexa_to_fasta_qual_out2.qualsolexa" />
    </test>
  </tests>
  <help>

.. class:: warningmark

IMPORTANT: This tool currently only supports data where the quality scores are integers or ASCII quality scores with base 64.  

-----

**What it does**

This tool extracts sequences and quality scores from FASTQ data ( Solexa variant ), producing a FASTA dataset and a QUAL dataset.

-----

**Example1**

- Converting the following Solexa fastq data::

    @seq1  
    GACAGCTTGGTTTTTAGTGAGTTGTTCCTTTCTTT  
    +seq1  
    hhhhhhhhhhhhhhhhhhhhhhhhhhPW@hhhhhh  
    @seq2  
    GCAATGACGGCAGCAATAAACTCAACAGGTGCTGG  
    +seq2  
    hhhhhhhhhhhhhhYhhahhhhWhAhFhSIJGChO

- will extract the following sequences::

    >seq1
    GACAGCTTGGTTTTTAGTGAGTTGTTCCTTTCTTT
    >seq2
    GCAATGACGGCAGCAATAAACTCAACAGGTGCTGG
    
- and quality scores::

    >seq1
    40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 16 23 0 40 40 40 40 40 40 
    >seq2
    40 40 40 40 40 40 40 40 40 40 40 40 40 40 25 40 40 33 40 40 40 40 23 40 1 40 6 40 19 9 10 7 3 40 15 

**Example2**

- Converting the following Solexa fastq data::

    @HANNIBAL_1_FC302VTAAXX:2:1:228:167
    GAATTGATCAGGACATAGGACAACTGTAGGCACCAT
    +HANNIBAL_1_FC302VTAAXX:2:1:228:167
    40 40 40 40 35 40 40 40 25 40 40 26 40 9 33 11 40 35 17 40 40 33 40 7 9 15 3 22 15 30 11 17 9 4 9 4
    @HANNIBAL_1_FC302VTAAXX:2:1:156:340
    GAGTTCTCGTCGCCTGTAGGCACCATCAATCGTATG
    +HANNIBAL_1_FC302VTAAXX:2:1:156:340
    40 15 40 17 6 36 40 40 40 25 40 9 35 33 40 14 14 18 15 17 19 28 31 4 24 18 27 14 15 18 2 8 12 8 11 9

- will extract the following sequences::

    >HANNIBAL_1_FC302VTAAXX:2:1:228:167
    GAATTGATCAGGACATAGGACAACTGTAGGCACCAT
    >HANNIBAL_1_FC302VTAAXX:2:1:156:340
    GAGTTCTCGTCGCCTGTAGGCACCATCAATCGTATG

- and quality scores::

    >HANNIBAL_1_FC302VTAAXX:2:1:228:167
    40 40 40 40 35 40 40 40 25 40 40 26 40 9 33 11 40 35 17 40 40 33 40 7 9 15 3 22 15 30 11 17 9 4 9 4
    >HANNIBAL_1_FC302VTAAXX:2:1:156:340
    40 15 40 17 6 36 40 40 40 25 40 9 35 33 40 14 14 18 15 17 19 28 31 4 24 18 27 14 15 18 2 8 12 8 11 9

    </help>
</tool>