# HG changeset patch
# User devteam
# Date 1418399706 18000
# Node ID 36980a78cc83629d5f0882ae67e4c08e2f09fec7
# Parent  bf15645bae105c2ec0015c22dbcb7b501895f2c5
Uploaded

diff -r bf15645bae10 -r 36980a78cc83 rgFastQC.py
--- a/rgFastQC.py	Wed Nov 12 14:02:29 2014 -0500
+++ b/rgFastQC.py	Fri Dec 12 10:55:06 2014 -0500
@@ -151,4 +151,4 @@
         os.makedirs(opts.outputdir)
     
     fastqc_runner = FastQCRunner(opts)
-    fastqc_runner.run_fastqc()
\ No newline at end of file
+    fastqc_runner.run_fastqc()
diff -r bf15645bae10 -r 36980a78cc83 rgFastQC.xml
--- a/rgFastQC.xml	Wed Nov 12 14:02:29 2014 -0500
+++ b/rgFastQC.xml	Fri Dec 12 10:55:06 2014 -0500
@@ -1,12 +1,20 @@
-<tool name="FastQC:Read QC" id="fastqc" version="0.62">
-  <description>reports using FastQC</description>
-  <command interpreter="python">
-    rgFastQC.py 
+<tool id="fastqc" name="FastQC" version="0.63">
+    <description>Read Quality reports</description>
+    <requirements>
+        <requirement type="package" version="0.11.2">FastQC</requirement>
+    </requirements>
+    <stdio>
+        <exit_code range="1:" />
+        <exit_code range=":-1" />
+        <regex match="Error:" />
+        <regex match="Exception:" />
+    </stdio>
+    <command interpreter="python">
+    rgFastQC.py
         -i "$input_file"
         -d "$html_file.files_path"
         -o "$html_file"
         -t "$text_file"
-        -n "$out_prefix"
         -f "$input_file.ext"
         -j "$input_file.name"
         -e "\$FASTQC_JAR_PATH/fastqc"
@@ -16,44 +24,33 @@
         #if $limits.dataset and str($limits) > ''
             -l "$limits"
         #end if
-  </command>
-  <requirements>
-    <requirement type="package" version="0.11.2">FastQC</requirement>
-  </requirements>
-  <inputs>
-    <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" />
-    <param name="out_prefix" value="FastQC" type="text" label="Title for the output file - to remind you what the job was for" size="80"
-      help="Letters and numbers only please - other characters will be removed">
-    <sanitizer invalid_char="">
-        <valid initial="string.letters,string.digits"/>
-    </sanitizer>
-    </param>
-    <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" 
-           help="tab delimited file with 2 columns: name and sequence.  For example: Illumina Small RNA RT Primer   CAAGCAGAAGACGGCATACGA"/>
-    <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file"
-       help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" />
-  </inputs>
-  <outputs>
-    <data format="html" name="html_file"  label="${out_prefix}_${input_file.name}_Webpage.html" />
-    <data format="txt" name="text_file"  label="${out_prefix}_${input_file.name}_RawData.txt" />
-  </outputs>
-  <tests>
-    <test>
-      <param name="input_file" value="1000gsample.fastq" />
-      <param name="out_prefix" value="fastqc_out" />
-      <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" />
-      <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/>
-      <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="100"/>
-    </test>
-    <test>
-      <param name="input_file" value="1000gsample.fastq" />
-      <param name="out_prefix" value="fastqc_out" />
-      <param name="limits" value="fastqc_customlimits.txt" ftype="txt" />
-      <output name="html_file" file="fastqc_report2.html" ftype="html" lines_diff="100"/>
-      <output name="text_file" file="fastqc_data2.txt" ftype="txt" lines_diff="100"/>
-    </test>
-  </tests>
-  <help>
+    </command>
+    <inputs>
+        <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" />
+        <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" 
+            help="tab delimited file with 2 columns: name and sequence.  For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/>
+        <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file"
+            help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" />
+    </inputs>
+    <outputs>
+        <data format="html" name="html_file" label="${tool.name} on ${on_string}: Webpage" />
+        <data format="txt" name="text_file"  label="${tool.name} on ${on_string}: RawData" />
+    </outputs>
+    <tests>
+        <test>
+            <param name="input_file" value="1000gsample.fastq" />
+            <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" />
+            <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/>
+            <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="100"/>
+        </test>
+        <test>
+            <param name="input_file" value="1000gsample.fastq" />
+            <param name="limits" value="fastqc_customlimits.txt" ftype="txt" />
+            <output name="html_file" file="fastqc_report2.html" ftype="html" lines_diff="100"/>
+            <output name="text_file" file="fastqc_data2.txt" ftype="txt" lines_diff="100"/>
+        </test>
+    </tests>
+    <help>
 
 .. class:: infomark
 
diff -r bf15645bae10 -r 36980a78cc83 shed_upload.tar.gz
Binary file shed_upload.tar.gz has changed