Mercurial > repos > devteam > fastqc
diff test-data/fastqc_data_contaminants.txt @ 22:a35575615aa4 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/fastqc commit 9aa395df821f0d3607867c83536ac97f9ffe8b29
| author | iuc |
|---|---|
| date | Thu, 08 Jun 2023 20:01:52 +0000 |
| parents | b44429593dd8 |
| children |
line wrap: on
line diff
--- a/test-data/fastqc_data_contaminants.txt Sun Sep 12 11:19:52 2021 +0000 +++ b/test-data/fastqc_data_contaminants.txt Thu Jun 08 20:01:52 2023 +0000 @@ -1,10 +1,11 @@ -##FastQC 0.11.9 +##FastQC 0.12.1 >>Basic Statistics pass #Measure Value Filename 1000trimmed_fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4905 +Total Bases 254.2 kbp Sequences flagged as poor quality 0 Sequence length 1-108 %GC 40 @@ -344,81 +345,81 @@ >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.73598369011212 -#Duplication Level Percentage of deduplicated Percentage of total -1 99.44249432170142 98.1855249745158 -2 0.47491224447656405 0.9378185524974516 -3 0.041296716911005574 0.12232415902140673 -4 0.020648358455502787 0.08154943934760449 -5 0.0 0.0 -6 0.0 0.0 -7 0.0 0.0 -8 0.0 0.0 -9 0.0 0.0 ->10 0.020648358455502787 0.672782874617737 ->50 0.0 0.0 ->100 0.0 0.0 ->500 0.0 0.0 ->1k 0.0 0.0 ->5k 0.0 0.0 ->10k+ 0.0 0.0 +#Duplication Level Percentage of total +1 98.1855249745158 +2 0.9378185524974516 +3 0.12232415902140673 +4 0.08154943934760449 +5 0.0 +6 0.0 +7 0.0 +8 0.0 +9 0.0 +>10 0.672782874617737 +>50 0.0 +>100 0.0 +>500 0.0 +>1k 0.0 +>5k 0.0 +>10k+ 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT 33 0.672782874617737 TestContaminant (100% over 24bp) >>END_MODULE >>Adapter Content pass -#Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter -1 0.0 0.0 0.0 0.0 0.0 -2 0.0 0.0 0.0 0.0 0.0 -3 0.0 0.0 0.0 0.0 0.0 -4 0.0 0.0 0.0 0.0 0.0 -5 0.0 0.0 0.0 0.0 0.0 -6 0.0 0.0 0.0 0.0 0.0 -7 0.0 0.0 0.0 0.0 0.0 -8 0.0 0.0 0.0 0.0 0.0 -9 0.0 0.0 0.0 0.0 0.0 -10-11 0.0 0.0 0.0 0.0 0.0 -12-13 0.0 0.0 0.0 0.0 0.0 -14-15 0.0 0.0 0.0 0.0 0.0 -16-17 0.0 0.0 0.0 0.0 0.0 -18-19 0.0 0.0 0.0 0.0 0.0 -20-21 0.12232415902140673 0.0 0.0 0.0 0.0 -22-23 0.12232415902140673 0.0 0.0 0.0 0.0 -24-25 0.12232415902140673 0.0 0.0 0.0 0.0 -26-27 0.1325178389398573 0.0 0.0 0.0 0.0 -28-29 0.2038735983690112 0.0 0.0 0.0 0.0 -30-31 0.22426095820591233 0.0 0.0 0.0 0.0 -32-33 0.22426095820591233 0.0 0.0 0.0 0.0 -34-35 0.24464831804281345 0.0 0.0 0.0 0.0 -36-37 0.3058103975535168 0.0 0.0 0.0 0.0 -38-39 0.4383282364933741 0.0 0.0 0.0 0.0 -40-41 0.4689092762487258 0.0 0.0 0.0 0.0 -42-43 0.4689092762487258 0.0 0.0 0.0 0.0 -44-45 0.4689092762487258 0.0 0.0 0.0 0.0 -46-47 0.4689092762487258 0.0 0.0 0.0 0.0 -48-49 0.4689092762487258 0.0 0.0 0.0 0.0 -50-51 0.4689092762487258 0.0 0.0 0.0 0.0 -52-53 0.4689092762487258 0.0 0.0 0.0 0.0 -54-55 0.4689092762487258 0.0 0.0 0.0 0.0 -56-57 0.4689092762487258 0.0 0.0 0.0 0.0 -58-59 0.4689092762487258 0.0 0.0 0.0 0.0 -60-61 0.4689092762487258 0.0 0.0 0.0 0.0 -62-63 0.4689092762487258 0.0 0.0 0.0 0.0 -64-65 0.4689092762487258 0.0 0.0 0.0 0.0 -66-67 0.4689092762487258 0.0 0.0 0.0 0.0 -68-69 0.4689092762487258 0.0 0.0 0.0 0.0 -70-71 0.4689092762487258 0.0 0.0 0.0 0.0 -72-73 0.4689092762487258 0.0 0.0 0.0 0.0 -74-75 0.4689092762487258 0.0 0.0 0.0 0.0 -76-77 0.4689092762487258 0.0 0.0 0.0 0.0 -78-79 0.4689092762487258 0.0 0.0 0.0 0.0 -80-81 0.4689092762487258 0.0 0.0 0.0 0.0 -82-83 0.4689092762487258 0.0 0.0 0.0 0.0 -84-85 0.4689092762487258 0.0 0.0 0.0 0.0 -86-87 0.4689092762487258 0.0 0.0 0.0 0.0 -88-89 0.4689092762487258 0.0 0.0 0.0 0.0 -90-91 0.4689092762487258 0.0 0.0 0.0 0.0 -92-93 0.4689092762487258 0.0 0.0 0.0 0.0 -94-95 0.4689092762487258 0.0 0.0 0.0 0.0 -96-97 0.4689092762487258 0.0 0.0 0.0 0.0 +#Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence PolyA PolyG +1 0.0 0.0 0.0 0.0 0.020387359836901122 0.0 +2 0.0 0.0 0.0 0.0 0.06116207951070336 0.0 +3 0.0 0.0 0.0 0.0 0.06116207951070336 0.0 +4 0.0 0.0 0.0 0.0 0.06116207951070336 0.0 +5 0.0 0.0 0.0 0.0 0.12232415902140673 0.0 +6 0.0 0.0 0.0 0.0 0.12232415902140673 0.0 +7 0.0 0.0 0.0 0.0 0.12232415902140673 0.0 +8 0.0 0.0 0.0 0.0 0.14271151885830785 0.0 +9 0.0 0.0 0.0 0.0 0.14271151885830785 0.0 +10-11 0.0 0.0 0.0 0.0 0.14271151885830785 0.0 +12-13 0.0 0.0 0.0 0.0 0.1529051987767584 0.0 +14-15 0.0 0.0 0.0 0.0 0.17329255861365955 0.0 +16-17 0.0 0.0 0.0 0.0 0.21406727828746175 0.0 +18-19 0.0 0.0 0.0 0.0 0.22426095820591233 0.0 +20-21 0.12232415902140673 0.0 0.0 0.0 0.24464831804281345 0.0 +22-23 0.12232415902140673 0.0 0.0 0.0 0.24464831804281345 0.0 +24-25 0.12232415902140673 0.0 0.0 0.0 0.24464831804281345 0.0 +26-27 0.1325178389398573 0.0 0.0 0.0 0.24464831804281345 0.0 +28-29 0.2038735983690112 0.0 0.0 0.0 0.24464831804281345 0.0 +30-31 0.22426095820591233 0.0 0.0 0.0 0.24464831804281345 0.0 +32-33 0.22426095820591233 0.0 0.0 0.0 0.2650356778797146 0.0 +34-35 0.24464831804281345 0.0 0.0 0.0 0.29561671763506625 0.0 +36-37 0.3058103975535168 0.0 0.0 0.0 0.31600407747196735 0.0 +38-39 0.4383282364933741 0.0 0.0 0.0 0.32619775739041795 0.0 +40-41 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +42-43 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +44-45 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +46-47 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +48-49 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +50-51 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +52-53 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +54-55 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +56-57 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +58-59 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +60-61 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +62-63 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +64-65 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +66-67 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +68-69 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +70-71 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +72-73 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +74-75 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +76-77 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +78-79 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +80-81 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +82-83 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +84-85 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +86-87 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +88-89 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +90-91 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +92-93 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +94-95 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 +96-97 0.4689092762487258 0.0 0.0 0.0 0.32619775739041795 0.0 >>END_MODULE