comparison rgFastQC.xml @ 2:bf15645bae10 draft

Uploaded from GH

1:67355741fbc3

<tool name="FastQC:Read QC" id="fastqc" version="0.62">
  <description>reports using FastQC</description>
  <command interpreter="python">
    rgFastQC.py -i "$input_file" -d "$html_file.files_path" -o "$html_file" -t "$text_file" -n "$out_prefix" -f "$input_file.ext" -j "$input_file.name" -e "\$FASTQC_JAR_PATH/fastqc"
#if $contaminants.dataset and str($contaminants) > ''
-c "$contaminants"
#end if
#if $limits.dataset and str($limits) > ''
-l "$limits"
#end if
  </command>
  <requirements>
    <requirement type="package" version="0.11.2">FastQC</requirement>
  </requirements>
  <inputs>

    </sanitizer>
    </param>
    <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" 
           help="tab delimited file with 2 columns: name and sequence.  For example: Illumina Small RNA RT Primer   CAAGCAGAAGACGGCATACGA"/>
    <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file"
	   help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" />
  </inputs>
  <outputs>
    <data format="html" name="html_file"  label="${out_prefix}_${input_file.name}_Webpage.html" />
    <data format="txt" name="text_file"  label="${out_prefix}_${input_file.name}_RawData.txt" />
  </outputs>

All except Basic Statistics and Overrepresented sequences are plots.
 .. _FastQC: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/
 .. _Picard-tools: http://picard.sourceforge.net/index.shtml

</help>
</tool>

2:bf15645bae10

<tool name="FastQC:Read QC" id="fastqc" version="0.62">
  <description>reports using FastQC</description>
  <command interpreter="python">
    rgFastQC.py 
        -i "$input_file"
        -d "$html_file.files_path"
        -o "$html_file"
        -t "$text_file"
        -n "$out_prefix"
        -f "$input_file.ext"
        -j "$input_file.name"
        -e "\$FASTQC_JAR_PATH/fastqc"
        #if $contaminants.dataset and str($contaminants) > ''
            -c "$contaminants"
        #end if
        #if $limits.dataset and str($limits) > ''
            -l "$limits"
        #end if
  </command>
  <requirements>
    <requirement type="package" version="0.11.2">FastQC</requirement>
  </requirements>
  <inputs>

    </sanitizer>
    </param>
    <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" 
           help="tab delimited file with 2 columns: name and sequence.  For example: Illumina Small RNA RT Primer   CAAGCAGAAGACGGCATACGA"/>
    <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file"
       help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" />
  </inputs>
  <outputs>
    <data format="html" name="html_file"  label="${out_prefix}_${input_file.name}_Webpage.html" />
    <data format="txt" name="text_file"  label="${out_prefix}_${input_file.name}_RawData.txt" />
  </outputs>

All except Basic Statistics and Overrepresented sequences are plots.
 .. _FastQC: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/
 .. _Picard-tools: http://picard.sourceforge.net/index.shtml

    </help>
    <citations>
        <citation type="bibtex">
        @ARTICLE{andrews_s,
            author = {Andrews, S.},
            keywords = {bioinformatics, ngs, qc},
            priority = {2},
            title = {{FastQC A Quality Control tool for High Throughput Sequence Data}},
            url = {http://www.bioinformatics.babraham.ac.uk/projects/fastqc/}
        }
        </citation>
    </citations>
</tool>