# HG changeset patch # User devteam # Date 1390498312 18000 # Node ID e018cfd2dc026aa8513ff5e06edd0ed898f6665e Imported from capsule None diff -r 000000000000 -r e018cfd2dc02 fastq_to_tabular.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastq_to_tabular.py Thu Jan 23 12:31:52 2014 -0500 @@ -0,0 +1,38 @@ +#Dan Blankenberg +import sys +from galaxy_utils.sequence.fastq import fastqReader + +def stop_err( msg ): + sys.stderr.write( msg ) + sys.exit() + +def main(): + if len(sys.argv) != 5: + stop_err("Wrong number of arguments. Expect: fasta tabular desrc_split [type]") + input_filename = sys.argv[1] + output_filename = sys.argv[2] + descr_split = int( sys.argv[3] ) - 1 + if descr_split < 0: + stop_err("Bad description split value (should be 1 or more)") + input_type = sys.argv[4] or 'sanger' #input type should ordinarily be unnecessary + + num_reads = None + fastq_read = None + out = open( output_filename, 'wb' ) + if descr_split == 0: + #Don't divide the description into multiple columns + for num_reads, fastq_read in enumerate( fastqReader( open( input_filename ), format = input_type ) ): + out.write( "%s\t%s\t%s\n" % ( fastq_read.identifier[1:].replace( '\t', ' ' ), fastq_read.sequence.replace( '\t', ' ' ), fastq_read.quality.replace( '\t', ' ' ) ) ) + else: + for num_reads, fastq_read in enumerate( fastqReader( open( input_filename ), format = input_type ) ): + words = fastq_read.identifier[1:].replace( '\t', ' ' ).split(None, descr_split) + #pad with empty columns if required + words += [""]*(descr_split-len(words)) + out.write( "%s\t%s\t%s\n" % ("\t".join(words), fastq_read.sequence.replace( '\t', ' ' ), fastq_read.quality.replace( '\t', ' ' ) ) ) + out.close() + if num_reads is None: + print "No valid FASTQ reads could be processed." + else: + print "%i FASTQ reads were converted to Tabular." % ( num_reads + 1 ) + +if __name__ == "__main__": main() diff -r 000000000000 -r e018cfd2dc02 fastq_to_tabular.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastq_to_tabular.xml Thu Jan 23 12:31:52 2014 -0500 @@ -0,0 +1,104 @@ + + converter + + galaxy_sequence_utils + + fastq_to_tabular.py '$input_file' '$output_file' $descr_columns '${input_file.extension[len( 'fastq' ):]}' + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +**What it does** + +This tool converts FASTQ sequencing reads to a Tabular file. + +It is conventional to take the first word of the FASTQ "@" title line as the identifier, and any remaining text to be a free form description. +It is therefore often useful to split this text into two columns in Galaxy (identifier and any description) by setting **How many columns to divide title string into?** to **2**. +In some cases the description can be usefully broken up into more columns -- see the examples . + +Tab characters, if present in the source FASTQ title, will be converted to spaces. + +----- + +**Example** + +Consider the following two 454 reads in Sanger FASTQ format (using line wrapping for display, but do note not all tools will accept line wrapped FASTQ files):: + + @FSRRS4401BE7HA [length=395] [gc=36.46] [flows=800] [phred_min=0] [phred_max=40] [trimmed_length=95] + tcagTTAAGATGGGATAATATCCTCAGATTGCGTGATGAACTTTGTTCTGGTGGAGGAGAAGGAAGTGCATTCGACGTAT + GCCCGTTTGTCGATATTTGtatttaaagtaatccgtcacaaatcagtgacataaatattatttagatttcgggagcaact + ttatttattccacaagcaggtttaaattttaaatttaaattattgcagaagactttaaattaacctcgttgtcggagtca + tttgttcggttattggtcgaaagtaaccncgggaagtgccgaaaactaacaaacaaaagaagatagtgaaattttaatta + aaanaaatagccaaacgtaactaactaaaacggacccgtcgaggaactgccaacggacgacacagggagtagnnn + +FSRRS4401BE7HA [length=395] [gc=36.46] [flows=800] [phred_min=0] [phred_max=40] [trimmed_length=95] + FFFDDDDDDDA666?688FFHGGIIIIIIIIIIIIIIIIIIHHHIIIIIIIIIGHGFFFFF====DFFFFFFFFFFFFFF + D???:3104/76=:5...4.3,,,366////4<ABBAAA=CCFDDDDDDDD:666CDFFFF=<ABA=;:333111<===9 + 9;B889FFFFFFDDBDBDDD=8844231..,,,-,,,,,,,,1133..---17111,,,,,22555131121.--.,333 + 11,.,,3--,,.,,--,3511123..--!,,,,--,----9,,,,8=,,-,,,-,,,,---26:9:5-..1,,,,11//, + ,,,!,,1917--,,,,-3.,--,,17,,,,---+11113.030000,,,044400036;96662.//;7><;!!! + @FSRRS4401BRRTC [length=145] [gc=38.62] [flows=800] [phred_min=0] [phred_max=38] [trimmed_length=74] + tcagCCAGCAATTCCGACTTAATTGTTCTTCTTCCATCATTCATCTCGACTAACAGTTCTACGATTAATGAGTTTGGCtt + taatttgttgttcattattgtcacaattacactactgagactgccaaggcacncagggataggnn + +FSRRS4401BRRTC [length=145] [gc=38.62] [flows=800] [phred_min=0] [phred_max=38] [trimmed_length=74] + FFFFFFFFFDDDDFFFFGFDDDDBAAAAA=<4444@@B=555:BBBBB@@?8:8<?<89898<84442;==3,,,514,, + ,11,,,.,,21777555513,..--1115758.//34488><<;;;;9944/!/4,,,57855!! + +By default this is converted into a 3 column tabular file, with the full FASTQ title used as column 1: + +=================================================================================================== ============== ============== +FSRRS4401BE7HA [length=395] [gc=36.46] [flows=800] [phred_min=0] [phred_max=40] [trimmed_length=95] tcagTTAA...nnn FFFDDDDD...!!! +FSRRS4401BRRTC [length=145] [gc=38.62] [flows=800] [phred_min=0] [phred_max=38] [trimmed_length=74] tcagCCAG...gnn FFFFFFFF...5!! +=================================================================================================== ============== ============== + +If you specified the title should be turned into 2 columns, you'd get 4 columns in total: + +============== ==================================================================================== ============== ============== +FSRRS4401BE7HA [length=395] [gc=36.46] [flows=800] [phred_min=0] [phred_max=40] [trimmed_length=95] tcagTTAA...nnn FFFDDDDD...!!! +FSRRS4401BRRTC [length=145] [gc=38.62] [flows=800] [phred_min=0] [phred_max=38] [trimmed_length=74] tcagCCAG...gnn FFFFFFFF...5!! +============== ==================================================================================== ============== ============== + +Similarly, for this example treating the title string as 7 columns makes sense: + +============== ============ ========== =========== ============= ============== =================== ============== ============== +FSRRS4401BE7HA [length=395] [gc=36.46] [flows=800] [phred_min=0] [phred_max=40] [trimmed_length=95] tcagTTAA...nnn FFFDDDDD...!!! +FSRRS4401BRRTC [length=145] [gc=38.62] [flows=800] [phred_min=0] [phred_max=38] [trimmed_length=74] tcagCCAG...gnn FFFFFFFF...5!! +============== ============ ========== =========== ============= ============== =================== ============== ============== + +Note the sequences and quality strings have been truncated for display purposes in the above tables. + +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_ + + + + diff -r 000000000000 -r e018cfd2dc02 test-data/fastq_to_tabular_out_1.tabular --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fastq_to_tabular_out_1.tabular Thu Jan 23 12:31:52 2014 -0500 @@ -0,0 +1,2 @@ +FAKE0001 Original version has PHRED scores from 0 to 93 inclusive (in that order) ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTAC !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~ +FAKE0002 Original version has PHRED scores from 93 to 0 inclusive (in that order) CATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCA ~}|{zyxwvutsrqponmlkjihgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! diff -r 000000000000 -r e018cfd2dc02 test-data/fastq_to_tabular_out_2.tabular --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fastq_to_tabular_out_2.tabular Thu Jan 23 12:31:52 2014 -0500 @@ -0,0 +1,2 @@ +FAKE0001 Original version has PHRED scores from 0 to 93 inclusive (in that order) G2131313131313131313131313131313131313131313131313131313131313131313131313131313131313131313131 !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~ +FAKE0002 Original version has PHRED scores from 93 to 0 inclusive (in that order) G3131313131313131313131313131313131313131313131313131313131313131313131313131313131313131313131 ~}|{zyxwvutsrqponmlkjihgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! diff -r 000000000000 -r e018cfd2dc02 test-data/fastq_to_tabular_out_3.tabular --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fastq_to_tabular_out_3.tabular Thu Jan 23 12:31:52 2014 -0500 @@ -0,0 +1,2 @@ +FAKE0001 Original version has PHRED scores from 0 to 93 inclusive (in that order) ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTAC !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~ +FAKE0002 Original version has PHRED scores from 93 to 0 inclusive (in that order) CATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCA ~}|{zyxwvutsrqponmlkjihgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! diff -r 000000000000 -r e018cfd2dc02 test-data/sanger_full_range_as_cssanger.fastqcssanger --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sanger_full_range_as_cssanger.fastqcssanger Thu Jan 23 12:31:52 2014 -0500 @@ -0,0 +1,8 @@ +@FAKE0001 Original version has PHRED scores from 0 to 93 inclusive (in that order) +G2131313131313131313131313131313131313131313131313131313131313131313131313131313131313131313131 ++ +!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~ +@FAKE0002 Original version has PHRED scores from 93 to 0 inclusive (in that order) +G3131313131313131313131313131313131313131313131313131313131313131313131313131313131313131313131 ++ +~}|{zyxwvutsrqponmlkjihgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! diff -r 000000000000 -r e018cfd2dc02 test-data/sanger_full_range_original_sanger.fastqsanger --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sanger_full_range_original_sanger.fastqsanger Thu Jan 23 12:31:52 2014 -0500 @@ -0,0 +1,8 @@ +@FAKE0001 Original version has PHRED scores from 0 to 93 inclusive (in that order) +ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTAC ++ +!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~ +@FAKE0002 Original version has PHRED scores from 93 to 0 inclusive (in that order) +CATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCA ++ +~}|{zyxwvutsrqponmlkjihgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! diff -r 000000000000 -r e018cfd2dc02 tool_dependencies.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_dependencies.xml Thu Jan 23 12:31:52 2014 -0500 @@ -0,0 +1,6 @@ + + + + + +